CN104195193B - The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine - Google Patents
The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine Download PDFInfo
- Publication number
- CN104195193B CN104195193B CN201410456080.1A CN201410456080A CN104195193B CN 104195193 B CN104195193 B CN 104195193B CN 201410456080 A CN201410456080 A CN 201410456080A CN 104195193 B CN104195193 B CN 104195193B
- Authority
- CN
- China
- Prior art keywords
- alanine
- aminopropionitrile
- beta
- hydrolysis
- enzymatic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the methods that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine.More specifically, the present invention provides a kind of using nitrilase and its genetic engineering bacterium or the method for combining aspartate ammonia-lyase and its genetic engineering bacterium that high concentration β-aminopropionitrile is hydrolyzed into Beta-alanine, the Beta-alanine are widely used in the medicine such as synthetic pantothenic acid and calcium pantothenate, carnosine, Sodium Pamidronate, Balsalazide or feed and food additives.This method has the distinguishing features such as concentration of substrate is high, reaction condition is mild, pollution-free and process route is simple.
Description
Technical field
The invention belongs to biocatalysis to prepare pharmaceutical intermediate and Green Chemistry field, relate to the use of nitrilase gene work
Journey bacterium, culture or fabricated product combine aspartate ammonia-lyase catalysis high concentration β-aminopropionitrile hydrolysis preparation β-
The method of alanine.
Background technique
Beta-alanine is widely used in the medicine such as synthetic pantothenic acid and calcium pantothenate, carnosine, Sodium Pamidronate, Balsalazide or feed
And food additives.The approach for obtaining Beta-alanine can be obtained by the Substance P hydrolysis such as silk gum, gelatin, zein, purification, but former
Expect limited source, it is at high cost.It is industrial at present main by chemical method production, but chemical synthesis needs strong acid or highly basic etc.
Reaction, the high requirements on the equipment are participated in, and needs to discharge a large amount of high-salt wastewater, it is unfriendly to environment, and also yield is not high.
In recent years, biocatalysis due to environmental-friendly, reaction condition is mild, pollution less, selectivity is high the advantages that cause it is wide
General concern.And river Li Yang etc. is once reported and is utilized the microorganism catalysis β-aminopropionitrile hydrolysis for producing nitrile compound invertase
The method of Beta-alanine, microorganismAlcaligenesSp.OMT-MYl4,Achromobacter xerosiIF012668,Pseodonocardia thermophlia ATCCl9285,Aminobacter aminobrance ATCC23314 etc. can
It is catalyzed β-aminopropionitrile hydrolysis and generates Beta-alanine, wherein microorganismAlcaligenes sp.The catalytic effect of OMT-MYl4 is most
Good, Beta-alanine concentration reaches 3.3 g/L (JP Japanese Laid-Open Patent Publication 10-042886 A, 1998-2-17).Zheng Yuguo etc. is reportedRhodococcus erythropolis For G20 using 1.0% β-aminopropionitrile as substrate, wet thallus amount is 70 g/L, and reaction 5 is small
Shi Hou, Beta-alanine concentration can reach 7.0 g/L(food and fermentation industries, 2008,34 (04): 11-19).
It is reported at present using microorganism catalysis hydrolysis β-aminopropionitrile generate Beta-alanine method, concentration of substrate compared with
It is low, it is difficult to realize industrialization.
Summary of the invention
A kind of genetic engineering bacterium for producing nitrilase is provided in the present invention, and is catalyzed high concentration using the enzyme or thallus
The method that β-aminopropionitrile hydrolysis generates Beta-alanine.Simultaneously converted the ammonia that reaction generates to using aspartate ammonia-lyase
L-Aspartic acid, so that the generation of by-product beta-amino propionamide and the discharge of waste ammonia is effectively reduced, while can be with by-product L-
Aspartic acid.
The genetic engineering bacterium of heretofore described production nitrilase, specific construction method is: design upstream primer (5'
- 3') TCGCATATGATGGATAGCAACCGACCG, downstream primer (5'-3') TTTGGATCCTCAATTGCGCGCGCGAACG,
FromBradyrhizobium japonicum Blr3397 gene is expanded in USDA 110, is building up to the matter of energy expression alien gene
In grain carrier: pET series plasmids, pTXB1 series, pGEX series, pETduet series, pTYB series；Being then seeded into can express
In the host strain of foreign gene: BL21 series, Rosetta series, Origami series, Tuner series；And to genetic engineering bacterium
Fermented and cultured is carried out, the efficient heterogenous expression of nitrilase is realized.
The culture that can be above-mentioned nitrilase gene engineering recombinant bacterium for nitrilase of the invention, is also possible to
Pass through the somatic cells or its fabricated product obtained after being centrifuged culture medium.Wherein fabricated product refers to the extraction that thallus obtains
Object, broken liquid or the separation product that the separation and/or purifying of the progress of extract nitrilase are obtained, or pass through fixation
Change the immobilizing product of extract or fabricated product.
The genetic engineering bacterium for producing nitrilase or the genetic engineering bacterium for producing aspartate ammonia-lyase are trained through seed
Base culture is supported, is inoculated into fermentation medium by a certain percentage, after a certain period of time, inducer IPTG or lactose or both is added in culture
Mixture Fiber differentiation certain time, thalline were collected by centrifugation.
The building of reaction system:
A certain amount of β-aminopropionitrile is dissolved in a certain amount of water by system one, is added 6 M hydrochloric acid tune pH to particular value, is matched
It is set to the solution of a certain concentration, certain pH, a certain amount of production nitrilase gene engineering bacteria or pure enzyme is added, at a certain temperature
Conversion 4~8 hours, obtains Beta-alanine and beta-amino propionamide after isolating and purifying after fully reacting.
A certain amount of β-aminopropionitrile is dissolved in a certain amount of water by system two, and fumaric acid (powder) is added to adjust pH to specific
Value is configured to the solution of a certain concentration, certain pH, and a certain amount of production nitrilase gene engineering bacteria or pure enzyme is added and produces asparagus fern
Propylhomoserin ammonia lyase genetic engineering bacterium or pure enzyme convert 3~8 hours, at a certain temperature after fully reacting after isolating and purifying
Obtain Beta-alanine and L-Aspartic acid.
PH value of the present invention is preferably able to be maintained at nitrilase and can express within the scope of its active pH, preferably pH
Value is 6.0~10.0.Reaction temperature preferably remains in nitrilase and can express within the scope of the temperature of its activity, and preferably 20~50
℃。
There is no limit usual substrate is 140~280 g/L to concentration of substrate of the present invention.
When catalyst of the present invention is resting cell, dosage is 50~100 g/L.
Nitrilase of the present invention can be catalyzed β-aminopropionitrile hydrolysis and generate Beta-alanine, if in conjunction with aspartic acid
Ammonia lyase can then reduce the generation of by-product beta-amino propionamide, and can reduce the discharge of ammonia, while can be with by-product
L-Aspartic acid, chemical equation are as follows:
Specific embodiment
It is further illustrated below by way of specific embodiment, its object is to better understand summary of the invention, but this
A little embodiments are not construed as limiting the invention.
Embodiment 1: the acquisition of cance high-expression gene engineering bacteria
Design upstream primer (5'-3') TCGCATATGATGGATAGCAACCGACCG, downstream primer (5'-3')
TTTGGATCCTCAATTGCGCGCGCGAACG, fromBradyrhizobium japonicumBlr3397 is expanded in USDA110
Gene, construct PTXB1 (restriction enzyme site Nde I, BamH I) plasmid, by recombinant plasmid import host strain in, and to engineering bacteria into
Row fermented and cultured, realizes the efficient heterogenous expression of nitrilase, host cell be e. coli bl21, Rosetta or
Origami is filtered out and is present in endobacillary genetic engineering bacterium with soluble nitrilase, wherein with Escherichia coli Rosetta
(DE3) relatively preferable for the recombinant bacterium destination protein expression of host strain.It is not less than 20% engineering bacteria with destination protein expression quantity,
It is saved as production labor journey bacterium strain, and in the form of glycerol stock or milk freeze-drying lactobacillus.
The culture of 2 genetic engineering bacterium of embodiment and the preparation of resting cell
Single colonie is seeded in 5 fermentation mediums of the ml containing corresponding antibiotic on picking plate, culture 15h or so conduct
Seed liquor is seeded in the fermentation medium containing 600 ml according to 1% inoculum concentration, cultivates on 37 DEG C, the shaking table of 200 rpm
To OD600=0.6~0.8 or so, the IPTG that final concentration of 0.1mM is added carries out 10 h or more of induction, is centrifuged and is trained with 8000 rpm
Nutrient solution collects thallus.
Embodiment 3 is catalyzed β-aminopropionitrile single hydrolysis using resting cell blr3397
It takes the resting cell of 3.5 g blr3397 to be resuspended in after 6.0 g β-aminopropionitriles are added in 30 mL to be adjusted to dense HCl
It in the aqueous solution of pH 7.5 (6.0 g, 2.5 M), is then reacted 5 hours in the shaking table of 30 DEG C, 200 rpm, HPLC detection display
Fully reacting (FDAA is derivative, mobile phase triethylamine: acetonitrile 62.5:37.5), purifying products are strong cation-exchanging resin, are used
1 M hydrochloric acid slowly flows across resin, and dosage is about 2-3 times of resin volume, and 1.5 times of bed volumes flow through per hour；It is rinsed with water
Being discharged pH is 4.0 or so；Resin is flowed through with 1 M NaOH, dosage and flow velocity are identical as 1；Being rinsed with water to water outlet pH is 10.0 left
It is right；Resin is changed into H with 1M hydrochloric acid+Type, dosage are 3-5 times of resin volume, and flow velocity is identical as 1；Acid stream after the completion of, spend from
It is 6.0 or more that sub- water, which is rinsed to pH value, that is, be can be used.5.12 g of product containing 13% or so beta-amino propionamide is obtained, yield is
67%。
Embodiment 4 using resting cell blr3397 be catalyzed β-aminopropionitrile single hydrolysis, while add fumaric acid with
The generation of aspartate ammonia-lyase reduction amide
With fumaric acid tune after taking the resting cell of 4.0 g blr3397 to be resuspended in 25 mL, 6.05 g β-aminopropionitriles of addition
Into the aqueous solution of pH7.5 (6.05g, 3.0M), at the same add about 4.0 g of aspartate ammonia-lyase thallus, then in 30 DEG C,
The shaking table of 200 rpm reacts 4 hours, HPLC detection display fully reacting (FDAA is derivative, mobile phase triethylamine: acetonitrile 62.5:
37.5), the content of aspartic acid, beta-amino propionamide and Beta-alanine is followed successively by 18%, 3% and 79% in reaction mixture.Product
Purifying strong cation-exchanging resin, slowly flows across resin with 1 M hydrochloric acid, dosage is about 2-3 times of resin volume, per hour
1.5 times of bed volumes flow through；Being rinsed with water water outlet pH is 4.0 or so；Resin, dosage and flow velocity and 1 phase are flowed through with 1M NaOH
Together；Being rinsed with water to water outlet pH is 10.0 or so；Resin is changed into H with 1M hydrochloric acid+Type, dosage are 3-5 times of resin volume, stream
Speed is identical as 1；Acid stream after the completion of, with deionized water rinse to pH value be 6.0 or more, obtain containing aspartic acid, Beta-alanine and
The crude product of beta-amino propionamide.It is successively isolated and purified, is obtained with strong cation-exchanging resin, strong anion exchange resin later
5.85 g Beta-alanine, yield 76%.
SEQUENCE LISTING
<110>Tianjin Institute of Industrial Biotechnology, the Chinese Academy of Sciences
<120>method that the hydrolysis of enzymatic high concentration β-aminopropionitrile prepares Beta-alanine
<130> A new nitrilase from Bradyrhizobium japonicum USDA 110 gene
cloning, biochemical characterization and substrate specificit
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 960
<212> DNA
<213> blr3397
<400> 1
atgatggata gcaaccgacc gaacacctac aaggcggccg tcgttcaggc cgcgtcagat 60
ccgacaagct cgctggtgtc ggcgcaaaag gcggcggccc tgatcgagaa ggccgctggc 120
gccggcgcga ggctggtcgt tttccctgaa gccttcattg gcggctatcc caagggaaat 180
tcgttcggcg ctcccgtcgg catgcgcaag cccgaaggac gcgaggcgtt ccgtttgtat 240
tgggaggcgg ccatcgatct cgatggcgtg gaggtcgaga cgatcgctgc ggcggccgcc 300
gcaaccggtg cctttaccgt catcggctgc atcgagcgag agcagggcac gctctactgc 360
acggcgctgt tcttcgacgg ggcgcgtggg ctcgtcggca agcaccgcaa gctgatgccg 420
actgcgggcg agcggctgat ctggggtttc ggcgacggct cgaccatgcc ggtgttcgag 480
acctcgctcg gcaatatcgg cgccgtgatc tgctgggaga actacatgcc gatgctgcgc 540
atgcacatgt acagccaggg catcagcatc tactgcgctc caaccgcgga tgatcgcgat 600
acctggcttc cgaccatgca gcatatcgcc ctggagggac gctgcttcgt cctgacggcc 660
tgtcagcatc tcaagcgcgg cgccttcccg gcggactacg agtgcgcgct gggcgccgat 720
cccgagaccg tgctcatgcg cggcggcagc gccatcgtca atccgctcgg caaggtgctg 780
gcgggtccat gcttcgaggg ggagaccatc ctgtatgccg acattgcgct cgacgaggtg 840
acgcgcggca agtttgattt cgacgccgcg gggcactatt cccgtccgga cgttttccag 900
ctcgtcgtcg acgatcgacc gaagcgggca gtatcaaccg tcagcgccgt tcgcgcgcgc 960
Claims (9)
1. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine, it is characterised in that by deriving from
The nitrilase and aspartic acid ammonia of blr3397 coded by said gene in Bradyrhizobium japonicum USDA110
Cracking enzymatic hydrolysis β-aminopropionitrile obtains Beta-alanine and L-Aspartic acid, includes the following steps:
A) in the fermentation medium by nitrilase gene engineering bacteria, amplification cultivation is carried out, and carries out induction and generates destination protein
Afterwards, thalline were collected by centrifugation for progress；
B) pH of β-aminopropionitrile aqueous solution is adjusted to appropriate value using fumaric acid, nitrilase and aspartic acid ammonia is then added
Lyases reacts certain time under certain temperature；Supernatant liquor is collected in sterilizing from reaction system after fully reacting, using strong
Cation exchange resin and strong anion exchange resin isolate and purify to obtain Beta-alanine and L-Aspartic acid；The beta-amino third
The concentration of nitrile is 140~280 g/L.
2. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Nitrilase gene engineering bacteria described in step a) is expanded from Bradyrhizobium japonicum USDA110
Blr3397 gene, is building up in plasmid vector, obtains the cance high-expression gene engineering bacteria of blr3397 nitrilase.
3. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
The plasmid of genetic engineering bacterium energy efficiently expressing exogenous gene described in step a) is one of following: pET series plasmids, pTXB1
Series, pGEX series, pETduet series, pTYB series；The host strain of efficiently expressing exogenous gene is one of following: BL21
Series, Rosetta series, Origami series, Tuner series.
4. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Nitrilase described in step b) or aspartic acid amino lyases be complete microbial cell, microbial cell extract,
The thick pure enzyme of ammonium sulfate, the purified rear higher enzyme of purity or the enzyme catalyst form being fixed on carrier.
5. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Reaction condition described in step b): temperature is 20~50 DEG C, and the reaction time is 3-8 hours.
6. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Reaction condition described in step b): temperature is 25~30 DEG C, and the reaction time is 3-8 hours.
7. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Reaction condition described in step b): pH is 6.0~10.0, and the reaction time is 3-8 hours.
8. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Reaction condition described in step b): pH 7.5, reaction time are 3-8 hours.
9. a kind of method that the hydrolysis of enzymatic β-aminopropionitrile prepares Beta-alanine as described in claim 1, it is characterised in that
Reaction condition described in step b): the concentration of β-aminopropionitrile is 210 g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410456080.1A CN104195193B (en) | 2014-09-10 | 2014-09-10 | The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410456080.1A CN104195193B (en) | 2014-09-10 | 2014-09-10 | The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195193A CN104195193A (en) | 2014-12-10 |
| CN104195193B true CN104195193B (en) | 2019-05-10 |
Family
ID=52080558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410456080.1A Active CN104195193B (en) | 2014-09-10 | 2014-09-10 | The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195193B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH1042886A (en) * | 1996-07-30 | 1998-02-17 | Mitsui Petrochem Ind Ltd | Production of beta-alanine by microorganism |
| CN101210230A (en) * | 2006-12-28 | 2008-07-02 | 浙江工业大学 | Gene engineering bacterium for producing beta-alanine and its preparation and application |
| CN102851333A (en) * | 2012-03-21 | 2013-01-02 | 蒋光玉 | Method for synthesizing beta-alanine by biological catalysis |
| CN103320480A (en) * | 2013-06-25 | 2013-09-25 | 南京大学 | Method for preparing beta-alanine by coupled enzymatic reaction |
| CN103898033A (en) * | 2012-12-25 | 2014-07-02 | 中国科学院天津工业生物技术研究所 | Construction, expression and application of genetic engineering bacteria for high-production of beta-alanine |
-
2014
- 2014-09-10 CN CN201410456080.1A patent/CN104195193B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH1042886A (en) * | 1996-07-30 | 1998-02-17 | Mitsui Petrochem Ind Ltd | Production of beta-alanine by microorganism |
| CN101210230A (en) * | 2006-12-28 | 2008-07-02 | 浙江工业大学 | Gene engineering bacterium for producing beta-alanine and its preparation and application |
| CN102851333A (en) * | 2012-03-21 | 2013-01-02 | 蒋光玉 | Method for synthesizing beta-alanine by biological catalysis |
| CN103898033A (en) * | 2012-12-25 | 2014-07-02 | 中国科学院天津工业生物技术研究所 | Construction, expression and application of genetic engineering bacteria for high-production of beta-alanine |
| CN103320480A (en) * | 2013-06-25 | 2013-09-25 | 南京大学 | Method for preparing beta-alanine by coupled enzymatic reaction |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195193A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104212784B (en) | Restructuring nitrilase, encoding gene, mutant, engineering bacteria and application | |
| CN107118976B (en) | Enterobacter cloacae and application thereof | |
| CN109735522B (en) | L-aspartic acid-alpha-decarboxylase mutant and application thereof | |
| CN107916283B (en) | A kind of production technology of niacinamide | |
| CN110885803A (en) | Recombinant glufosinate-ammonium dehydrogenase, genetically engineered bacterium and application of recombinant glufosinate-ammonium dehydrogenase in preparation of L-glufosinate-ammonium | |
| CN104878024A (en) | Recombinant Escherichia coli construction and (S)-2-hydroxy-3-phenylpropionic acid synthesis method | |
| CN110724675A (en) | Transaminase catalyst and method for synthesizing (R) -1-tert-butoxycarbonyl-3-aminopiperidine by enzyme method | |
| CN105176955A (en) | Nitrilase derived from arabis alpina, gene, vector, engineering bacterium and application of nitrilase | |
| CN104342463B (en) | A kind of preparation method of 1 cyanocyclohexanoic guanidine-acetic acid | |
| CN104131048A (en) | Biological preparation method of R-3-aminobutanol | |
| CN104131041A (en) | Production method for alpha-ketoglutaric acid | |
| CN104962540A (en) | Nitrilase, encoding genes, carrier and application | |
| CN104212850B (en) | The method that 1 cyanocyclohexanoic guanidine-acetic acid is prepared using nitrilase engineering bacteria | |
| CN107227283A (en) | A kind of Corynebacterium glutamicum and its construction method and application | |
| CN107287144B (en) | Metabolically-modified bacillus subtilis biotransformation cell and preparation method and application thereof | |
| CN105349516A (en) | Threonine deaminase, coding gene, carrier, engineering bacterium and applications | |
| CN104195193B (en) | The method that enzymatic high concentration β-aminopropionitrile hydrolysis prepares Beta-alanine | |
| CN109295023B (en) | Glutamate oxidase mutant, nucleic acid molecule, application and method for preparing ketoglutaric acid | |
| CN104845995A (en) | Method for dynamic regulation and control of threonine efflux transport protein gene expression for production of L-threonine | |
| CN107760642B (en) | Recombinant escherichia coli capable of efficiently decomposing formamide and oxidized phosphite and construction method and application thereof | |
| CN113061562B (en) | Method for producing 1, 4-butanediamine by fermentation of corynebacterium crenatum | |
| CN111549050B (en) | Vitreoscilla hemoglobin expression frame suitable for bacillus and application | |
| CN111518851B (en) | Immobilized enzyme continuous preparation 14/15 N]Process for preparing L-citrulline | |
| CN105602922B (en) | The general raw bacterium amidase of one kind, gene, carrier, engineering bacteria and its application | |
| CN113025601B (en) | Optimized expression and application of nitrilase promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |