CN104195058B

CN104195058B - Cordyceps militaris engineering bacterium capable of improving capability of cordyceps militaris to infect host insects

Info

Publication number: CN104195058B
Application number: CN201410218655.6A
Authority: CN
Inventors: 江克清; 韩日畴
Original assignee: Guangdong Institute of Applied Biological Resources
Current assignee: Institute of Zoology of Guangdong Academy of Sciences
Priority date: 2014-05-22
Filing date: 2014-05-22
Publication date: 2017-01-25
Anticipated expiration: 2034-05-22
Also published as: CN104195058A

Abstract

The invention discloses a cordyceps militaris engineering bacterium capable of improving the capability of cordyceps militaris to infect host insects. The cordyceps militaris engineering bacterium is cordyceps militaris which is modified by a cordyceps sinensis serine hydrolytic enzyme gene csp1 or csp 2 and can express the serine hydrolytic enzyme gene csp1 or csp2; the nucleotide sequence of the serine hydrolytic enzyme gene csp1 is shown as SEQ ID NO. 1; and the nucleotide sequence of the serine hydrolytic enzyme gene csp2 is shown as SEQ ID NO. 2. The capability of the cordyceps militaris to infect greater wax moths is really improved by modifying the cordyceps militaris with the exogenous serine hydrolytic enzyme gene. The cordyceps militaris engineering bacterium provides a technical reference for improving the capability of cordyceps militaris to infect insects.

Description

A kind of Cordyceps militaris (L.) Link. engineering bacteria that can improve Cordyceps militaris (L.) Link. infection host insect ability

Technical field:

The invention belongs to Biochemistry and Molecular Biology field is and in particular to one kind can improve Cordyceps militaris (L.) Link. infection host elder brother The Cordyceps militaris (L.) Link. engineering bacteria of worm ability.

Background technology:

The serine protein hydrolase of entomopathogenic fungi typically has function (the joshi et of degraded insect cuticle Al., 1995), it is the protease family that a class has identical catalyst mechanism, acts on the peptide bond in macro-molecular protein, makes Become small protein.Serine protein hydrolase catalyzing activation is real by the amino acid residue change of one group of active center Existing.In yeast system, the protease of expression has certain post translational processing ability, so that the foreign protein of results is had necessarily Folding processing in degree and glycosylation modified, the albumen of therefore yeast system expression have certain function (Wang Shihua etc., 2007).It is two serine proteases from csp1 the and csp2 gene of Cordyceps, insect cuticle can be hydrolyzed, belong to In protease s8a subfamily member；Research shows that the Cordyceps serine protease of expression in yeast cells has degraded elder brother The ability (zhang et al., 2008b) of polypide wall.

The ability of Cordyceps militaris (L.) Link. infected insect is to evaluate an important indicator of Cordyceps militaris (L.) Link. character.Improve fungal infection host's energy The research of power is common in biocontrol fungi such as muscardine, in green muscardine funguss, mainly thin to funguses by turning a related gene Host insect ability is infected to improve it in born of the same parents.For example turn bt virulence gene, serine stretch protein genoid, agglutinin gene (callaghan et al., 2005；Lu et al., 2008；Fang et al., 2010) etc. funguses are conducive to accelerate invasion elder brother Polypide wall.This research integrates the serine hydrolase gene of Cordyceps in Cordyceps militaris (L.) Link. genome dna by atmt method, with Phase improves the ability that Cordyceps militaris (L.) Link. jm4 bacterial strain infects greater wax moth.

Content of the invention:

It is an object of the invention to provide a kind of can improve the Cordyceps militaris (L.) Link. engineering bacteria that Cordyceps militaris (L.) Link. infects host insect ability.

The present invention can improve the Cordyceps militaris (L.) Link. engineering bacteria that Cordyceps militaris (L.) Link. infects host insect ability, is to turn to have Cordyceps silk ammonia Acid hydrolysis enzyme gene csp1 or csp2, and the Cordyceps militaris (L.) Link. of serine hydrolase csp1 or csp2 can be expressed, described serine water Solution enzyme gene csp1, its nucleotide sequence as shown in seq id no.1, described serine hydrolase gene csp2, its nucleoside Acid sequence is as shown in seq id no.2.

This research and utilization atmt method construct turn Cordyceps serine hydrolase gene (csp1, csp2 and both The gene c0c2 merging) Cordyceps militaris (L.) Link. jm4, the muton of acquisition can be identified by green fluorescence.By rt-pcr, southern The method such as blot, western bolt and sporophore culture screens the normal muton of a collection of growth characteristics, carries out greater wax moth Linal-instar larvae infection experiment.Greater wax moth linal-instar larvae infection experiment finds, the mutant strain turning csp1, csp2, c0c2 is to galleria mellonella waxmoth The lethal ability of linal-instar larvae significantly improves, but the elder brother of c0c2 (merging two genes of csp1 and csp2) Cordyceps militaris (L.) Link. mutant strain Insect infection ability is not than the mutant bacteria plant height of individual gene (csp1 or csp2).

In a word, trans-exogenous serine hydrolase gene improves the ability that Cordyceps militaris (L.) Link. infects greater wax moth really, and the present invention is Improve Cordyceps militaris (L.) Link. and insecticide ability offer Technical Reference is provided.

Brief description:

Fig. 1 is pkht-gfp carrier figure；

Fig. 2 is amplification csp1, csp2, c0c2 genetic fragment；M:dl2000dna marker1: blank；2-5: respectively It is the pcr product of csp1, csp2, c0 and c2；6-7:pcr fusion product c0c2 Fig. 3 is the bacterium of escherichia coli dh5 α/pkgc0c2 The pcr that falls identifies, m:dl2000dna marker；1-6: produced with the pcr of csp1-f and csp2-r primer pair amplifies pkgc0c2 bacterium colony Thing；

Fig. 4 is the bacterium colony pcr identification of escherichia coli dh5 α/pkgcsp1 and pkgcsp2, m:dl2000dna marker；1- 6: with the pcr product of csp1 primer amplification pkgcsp1 bacterium colony, 7-12: with the pcr product of csp2 primer amplification pkgcsp2 bacterium colony

Fig. 5 is hind the and kpn double digestion identification of pkgcsp1 and pkgcsp2 plasmid, m:wide range dna Marker (100-6000bp), hind the and kpn double digestion result of 1-3:pkgcsp1 plasmid, 4-6:pkgcsp2 plasmid Hind and kpn double digestion result；

Fig. 6 is hind the and kpn double digestion identification of pkgc0c2 plasmid, m: λ-hind digest dna marker； Hind the and kpn double digestion result of 1-3:pkgc0c2 plasmid；

Fig. 7 is total rna of wild type Cordyceps militaris (L.) Link. jm4 and several muton, m:dl2000dna marker, 1-11: wild Type jm4 and total rna of several muton；

Fig. 8 is the pcr identification of 3 kinds of Cordyceps militaris (L.) Link. transformants, and m:dl2000dna marker, 1-4:pcr expand pkg muton Middle lac-gfp gene, in csp1 gene 12-16:pcr amplification pkgcsp2 muton in 5-11:pcr amplification pkgcsp1 muton Csp2 gene；

Fig. 9 is the pcr identification of Cordyceps militaris (L.) Link. pkgc0c2 transformant, m:dl2000dna marker, 1,6: expand wild respectively The pcr product of the csp1 and csp2 gene of type jm4,2-5: the pcr product of csp1 gene in amplification pkgc0c2 muton；7-10: The pcr product of csp2 gene in amplification pkgc0c2 muton；

Figure 10 is the green fluorescence detection of Cordyceps militaris (L.) Link. muton, ck: wild type jm4, a1-a3:pkg muton, b1-b3: Pkgcsp1 muton, c1-c3:pkgcsp2 muton, d1-d3:pkgc0c2 muton；

Figure 11 is the Cordyceps militaris (L.) Link.sporophore turning serine hydrolase gene, ck: wild type jm4 sporophore a, b: turn serine The sporophore of hydrolase gene muton；

Figure 12 is that Cordyceps militaris (L.) Link. jm4 genome dna extracts, m.: λ-hind iii digest dna marker, 1: wild type Jm4 genome dna, 2-4. turn serine hydrolyzable group because Cordyceps militaris (L.) Link. mutation subgenom dna；Figure 13 is that the pcr of 3 genes is pure Change product, m:dl2000dna marker, 1:gfp pcr purified product, 2:csp1pcr purified product, 3:csp2pcr purification produces Thing；

Figure 14 is the identification of probe susceptiveness, 1:gfp probe, 2:csp1 probe, 3:csp2 probe；

Figure 15 is southern blot identification (hind digestion) of Cordyceps militaris (L.) Link. transformant；Probe: the gfp of dig- labelling Fragment；M:dna molecular-weight marker dig-labelde0.12-23.1kb；C:jm4 genome dna enzyme action Product；C1:pmd-19+gfp+gpd fragment；C2:pmd-19+gfp+csp1 fragment, c3:pmd-19+gfp+csp2 fragment；1-3: The genome dna digestion products of three pkg transformants；The genome dna digestion products of 4-6: three pkgcsp1 transformants；7- The genome dna digestion products of 9: three pkgcsp2 transformants；The genome dna enzyme action of 10-12: three pkgc0c2 transformants Product.

Figure 16 is the flanking sequence that tail-pcr expands Partial Conversion；M:dl2000dna marker1-3: different conversions First, second and third wheel tail--pcr product of son；

Figure 17 is the enzyme action identification of pet-28a-csp1 and pet-28a-scsp2 recombiant plasmid；M:wide range dna marker(100-6000bp)；The enzyme action result of 1-2:pet-28a-csp1 recombiant plasmid hind and bamh i；3-4:pet- The enzyme action result of 28a-scsp2 recombiant plasmid hind and bamh i；

Figure 18 is the prokaryotic expression of csp1 and scsp2 albumen；M:prestained protein ladder；1,3: do not lure Lead transetta (the de3)/pet-28a-scsp2 recombinant bacterium with induction；2,4: do not induce the transetta with induction (de3)/pet-28a-csp1 recombinant bacterium；

Figure 19 is csp1 the and scsp2 protein concentration analysis of purification；M:prestained protein ladder；1-3: It is 1 μ g respectively, 2 μ g, the bsa of 3 μ g；4-6: it is 0.5 μ l respectively, 1 μ l, the csp1 albumen of 2 μ l；7-9: it is 0.5 μ l respectively, 1 μ l, The scsp2 albumen of 2 μ l；

Figure 20 is the whole protein of Cordyceps militaris (L.) Link. transformant；M:prestained protein ladder1: wild type jm4；2- 10,31, No. 41 of the 2 of 4:pkg transformant, 34, No. 35 5-7:pkgcsp1 transformants；8-10:pkgcsp2 transformant 18, 29th, 3,17, No. 21 of No. 33 11-13:pkgc0c2 transformants；

Figure 21 is the expression that western blot detects csp1 albumen in muton；M:prestained protein Ladder c: positive control；1: wild type jm42:pkg transformant；3-5:pkgcsp1 transformant (10,31, No. 41) 6-8: Pkgc0c2 transformant (3,17, No. 21)；

Figure 22 is the expression that western blot detects csp2 albumen in muton；M:prestained protein Ladder c: positive control；1: wild type jm42:pkg transformant；3-5:pkgcsp2 transformant (18,29, No. 33) 6-8: Pkgc0c2 transformant (3,17, No. 21)；

Figure 23 be variable concentrations turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infect 7 days of greater wax moth larva dead Die rate, ck: sterilized water；Jm4: wild type Cordyceps militaris (L.) Link.；

Figure 24 is 14 days that turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infection greater wax moth larva of variable concentrations Mortality rate, ck: sterilized water；Jm4: wild type Cordyceps militaris (L.) Link.；

Figure 25 is 21 days that turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infection greater wax moth larva of variable concentrations Mortality rate, ck: sterilized water；Jm4: wild type Cordyceps militaris (L.) Link..

Specific embodiment:

Following examples are that the present invention is further illustrated, rather than limitation of the present invention.

Embodiment 1:

3.3 experimental technique

3.3.1 the jm4 mutation word bank turning mycelia csp1, csp2, c0c2 gene builds

3.3.1.1pkgcsp1, the vector construction of pkgcsp2, pkgc0c2

Based on the carrier pkht-gfp (abbreviation pkg) being suitable for funguses atmt method, carry out serine hydrolase gene Plasmid construction.Include following element in the border of pkht-gfp carrier from right to left: gpd promoter, mcs multiple clone site, Trpc terminator, cam resistant gene, ori replicon, hyg hygromycin gene and gfp green fluorescence protein gene, wherein Hph+ptrpc is named as phyg.All serine hydrolase genes are all inserted into mcs (restricted enzyme xba-kpn) In, form corresponding carrier.

Concrete construction method is:

Transformed with pkht carrier for basic framework, carrier is kana resistance (mullins et al., 2001).

Pkht-gfp carrier:

1st, ecor single endonuclease digestion pkht carrier, the dna QIAquick Gel Extraction Kit recovery purifying of qiangen company through ciap (takara) process in case carrier connects certainly.Lacz+gfp fragment through identical ecor single endonuclease digestion, recovery purifying.

2nd, the pkht carrier 0.5 μ l processing and lacz+gfp fragment 1 μ l connects, and adds 2 × ligase buffer (promega) 2 μ l, last moisturizing 0.5 μ l, 16 DEG C of coupled reactions 2 hours.

3rd, after 4 μ l connection products being mixed with the e.coli dh5 α competent cell of 50 μ l, ice bath 30min.42 DEG C of water-baths Hot agitated reaction 45s, then places 3min on ice.Add lb culture medium 500 μ l, 250rpm shakes 45min at 37 DEG C.

4th, take the lb culture medium antibacterial liquid of 200 μ l, on coating kana resistance lb culture plate, culture 16-20 is little at 37 DEG C When.The dark lower greeny positive monoclonal of picking, extracts plasmid, carries out sequencing analysis.Correct cloning vehicle is named as pkht1.

5th, with expression vector (pan2-4) dna, 5760bp (genbank:z32750.1) plasmid is template, Trpc primer (pst kpn-trpc f:

gggctgcagggtaccgatccacttaacgttactgaaat；Pst-trpc r: gggctgcagActagaaagaaggattacctcta), pfu dna polymerase, dntp and pcr reactant liquor, amplification obtains trpc(729bp).Pst single endonuclease digestion pkht1 carrier, the dna QIAquick Gel Extraction Kit recovery purifying of qiangen company through ciap (takara) process in case carrier connects certainly.Trpc fragment through identical pst single endonuclease digestion, recovery purifying, then with pst single endonuclease digestion Pkht1 carrier connects, and then proceeds in e.coli dh5 α competent cell.Clone and detection are carried out by 3,4 steps.In pkht1 Insert trpc and bring the restriction enzyme site of a kpn in upstream into.The direction that is correctly inserted into of trpc is kpn site near pkht Carrier right margin.Correct plasmid is named as pkht2.

6th, with expression vector (pan2-4) dna, 5760bp (genbank:z32750.1) plasmid is template, Gpd primer (hind-gpd-f:gggaagcttcaattcccttgtatctctacac；Xba-gpd-r: gggtctagaGgtgatgtctgctcaagcg), pfu dna polymerase, dntp and pcr reactant liquor, amplification obtains gpd (2.3kb).Its pcr reaction system: 10 × pcr buffer5 μ l, upstream (forward) and each 1 μ of downstream (reverse) primer L, expression vector100ng is template, 10mm dntps1 μ l, pfu-taq (1u/ μ l), last moisturizing to 50 μ l. Pcr reaction condition: 94 DEG C of thermal denaturations 5min, 94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, carry out altogether 30 times following Ring；Last 72 DEG C of extension 10min, obtain gpd product.

7th, the dna QIAquick Gel Extraction Kit recovery purifying gpd product of qiangen company, after hind and xba double digestion gpd again The fragment of secondary recovery 2.3kb.Pmd19-gfp (in gfp gene insertion vector pmd19) carrier is after hind and xba double digestion Reclaim the carrier segments of 2692bp.It is connected with the gpd product of hind and xba double digestion, then convert entrance e.coli dh5 α In competent cell, clone and inspection carry out by 3,4 steps, pmd19-t resistance is ampicillin.Be sequenced correct carrier life Entitled 19t-gpd.

8th, 19t-gpd and pkht2 be after hind and kpn enzyme action, be separately recovered purification 2.3kb gpd fragment and Pkht2 carrier.Again both are connected, convert, clone and check and carry out by 2,3,4 steps.Correct carrier is named as pkht- gfp.Introduce multiple clone site in pkht-gfp carrier to include: xba, bamh, sma, xma and kpn.Pkht-gfp carrier Figure is as shown in Figure 1.

9: all serine hydrolase genes are all inserted in mcs (restricted enzyme xba-kpn), formed corresponding Carrier.

1) csp1, csp2, c0c2 gene primer

Table 1

2) the pcr amplification of csp1, csp2, c0c2 gene and the structure of pkgcsp1, pkgcsp2 and pkgc0c2

The nucleotide sequence of serine hydrolase gene csp1, as shown in seq id no.1, with csp1 gene as template, is used Expand the primer of csp1 gene in table 1: xba-csp1-f and kpn-csp1-r carries out pcr reaction as primer, expand csp1 Gene, amplification obtains csp1 fragment.Xba and kpn double digestion csp1 fragment and pkht-gfp carrier, recovery purifying purpose piece Section, then reconnects, and so that csp1 fragment is inserted in the xba-kpn of pkht-gfp carrier, obtains pkgcsp1.

The nucleotide sequence of serine hydrolase gene csp2, as shown in seq id no.2, with csp2 gene as template, is used Expand the primer of csp2 gene in table 1: xba-csp2-f and kpn-csp2-r carries out pcr reaction as primer, expand csp2 Gene, amplification obtains csp2 fragment.Xba and kpn double digestion csp2 fragment and pkht-gfp carrier, recovery purifying purpose piece Section, then reconnects, and so that csp2 fragment is inserted in the xba-kpn of pkht-gfp carrier, obtains pkgcsp2.

With csp1 gene as template, with expanding the primer of c0 fragment in table 1: xba-csp1-f and c0-r enters as primer Row pcr reacts, and amplification obtains c0 fragment.With csp2 gene as template, with expanding the primer of c2 fragment: c2-f and kpn in table 1 Csp2-r carries out pcr reaction as primer, and amplification obtains c2 fragment.Using c0 fragment and c2 fragment mix as mould Plate, to expand the primer xba-csp1-f and kpn csp2-r of c0c2 fragment as primer, carries out pcr reaction, and it merges pcr Reaction system: each 1 μ l of 10 × pcr buffer5 μ l, upstream (forward) and downstream (reverse) primer, c0 and c2 fragment is each 50ng, 10mm dntps1 μ l, pfu-taq (1u/ μ l), last moisturizing to 50 μ l.Pcr reaction condition: 94 DEG C of thermal denaturations 3min, 94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, carry out 30 circulations altogether；Last 72 DEG C of extension 10min.Expand To c0c2 fragment, this c0c2 fragment is will to remove the csp1 gene after terminator taa and the csp1 base removing start codon atg Because of the fragment linking together.Xba and kpn double digestion c0c2 fragment and pkht-gfp carrier, recovery purifying purpose fragment, so After reconnect, make c0c2 fragment insert pkht-gfp carrier xba-kpn in, obtain pkgc0c2.3) atmt carrier and bacterial strain Construction procedures.

3.3.1.2atmt method turns serine hydrolase gene in jm4

Cordyceps militaris (L.) Link. (cordyceps militaris) jm4 with wild type (this bacterial strain is disclosed in document: zheng z, huang c,cao l,xie c,han r.agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus cordyceps militaris.fungal biol.2011mar；115 (3): 265-74, this bacterial strain the applicant also hold, can be with the application Shen Please provide to the public in 20 years from day) it is material, list of references (zheng z, huang c, cao l, xie c, han r.agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus cordyceps militaris.fungal biol.2011mar；115 (3) agriculture bacillus mediated (atmt) method disclosed in: 265-74), with atmt method respectively carrier pkgcsp1, pkgcsp2 and Pkgc0c2 imports in the conidium of Cordyceps militaris (L.) Link. jm4, respectively build obtain Cordyceps militaris (L.) Link. jm4 pkgcsp1, pkgcsp2 and Pkgc0c2 mutation word bank (i.e. various transformants).

3.3.1.3rt-pcr detect transformant

Extract total rna of Cordyceps militaris (L.) Link. transformant using trizol solution, detailed process is as follows:

1) weigh cordyceps mycelium 0.1g, be positioned over mortar liquid nitrogen grinding.

2) add 1ml trizol solution in process of lapping, be fully ground and receive immigration 1.5ml centrifuge tube after dissolving, cover tightly Lid, fierce vibration 15 seconds, room temperature stands 5 minutes；

2) 4 DEG C, 12,000rpm centrifugations 10 minutes, take supernatant to proceed in new 1.5ml centrifuge tube；

4) often pipe adds the chloroform of 0.2ml, covers tightly lid, acutely vibration 15 seconds；Room temperature stands 3 minutes；

5) 4 DEG C, 12,000rpm centrifugations 10 minutes, carefully draw upper strata aqueous phase, proceed to another new 1.5ml centrifuge tube；

6) add the chloroform of 1 times of volume, cover tightly lid, acutely vibration 15 seconds, room temperature stands 3 minutes；

7) 4 DEG C, 12,000rpm centrifugations 10 minutes, careful upper strata aqueous phase of drawing proceeds to another new 1.5ml centrifuge tube；

8) add the isopropanol (0.5 volume trizol) of 0.5ml, gently mix；Room temperature stands 10 minutes；

9) 4 DEG C, 12,000rpm centrifugations 10 minutes, rna is sunken to ttom of pipe；

10) abandon supernatant, add the ethanol (pre-cooling) of 1ml75%, gentle inversion washing precipitation；

11) 4 DEG C, 7500rpm is centrifuged 5 minutes；

12) supernatant, drying at room temperature 10 minutes are carefully abandoned；

13) the ultrapure water dissolution that appropriate depc was processed, 55-60 DEG C incubates 5 minutes,

14) subpackage, -80 DEG C of storages；

15) with ultraviolet spectrophotometry and 1% agarose gel electrophoresiies detection rna concentration and quality.

3.3.1.4tail-pcr

Pkgcsp1, pkgcsp2 and pkgc0c2 that tail-pcr expands jm4 are mutated t-dna on position in word bank, with Ad1 is degenerate primer, the article delivered with reference to mullins etc. (2001), the sequence of amplification t-dna right boundary.

Tail-pcr the primer is as follows:

ad1	wagtgnagwancanaga
		rb1	ggcactggccgtcgttttacaacg
rb2	aacgtcgtgactgggaaaaccctg
		rb3	cccttcccaacagttgcgcag
lb1	agggttcctatagggtttcgctcatg
		lb2	catgtgttgagcatataagaaaccct
lb3	cgaattaattcggcgttaattcagt

3.3.1.5 sequence analysis

Sequencing analysis are carried out to the sequence of the t-dna right boundary of amplification.

3.3.1.6 fluorescence microscope detects muton

1) solid ppda culture:

2) take the mycelia that each muton grows on solid ppda on a small quantity, be scattered in aseptic ultra-pure water.

3) draw mycelia liquid on microscope slide, covered, gfp fluorescin in fluorescence microscopy Microscopic observation mycelia Accumulation situation.

3.3.1.6southern blot analysis

With reference to dig high prime dna labeling and detection starter kit.

3.3.2csp1 the prokaryotic expression with csp2 gene

3.3.2.1pcr amplification csp1 and csp2 gene

Amplification csp1 full-length gene；Csp2 forward primer is to start to design from the 91st base of this gene, from the 94th Base is initially bamh restriction endonuclease sites, so the albumen obtained by prokaryotic expression is 31 aminoacid having lacked n end Scsp2.Pcr product glue reclaim purification.

Table 2: the primer of amplification csp1 full-length gene and csp2 part

With csp1 gene as template, with the bamh-csp1-f and hind of the amplification csp1 full-length gene shown in table 2- Csp1-r is primer, and amplification obtains csp1 full-length gene.

With csp2 gene as template, the bamh-csp2-f and hind-csp2-r of the amplification csp2 shown in table 2 is for drawing Thing, amplification obtains csp2 fragment.

3.3.2.2 double digestion purpose fragment

With bamh and hind double digestion csp1 full-length gene and carrier pet-28a respectively.

With bamh and hind double digestion csp2 fragment and carrier pet-28a respectively.

By following system sample-adding, flicking tube wall makes reactant mix, and 37 DEG C incubate 1 hour.3 μ l digestion products are taken to carry out electricity Swimming, checks whether that enzyme action is completely individual, remaining digestion products glue reclaim after purification, directly using or -20 DEG C save backup.

3.3.1.3 connecting

16 DEG C or room temperature connect 2 hours.

3.3.2.4 conversion: proceed in dh5 α competent cell by standardization program

3.3.2.5 bacterium colony pcr detection: routinely program pcr detection.

3.3.2.6 enzyme action identification: routinely program, so that in csp1 full-length gene insertion vector pet-28a, obtaining Plasmid pet-28a-csp1.So that in csp2 fragment insertion vector pet-28a, obtaining plasmid pet-28a-csp2.

3.3.2.7csp1 and the prokaryotic expression of csp2 gene

Correct pet-28a-csp1 and pet-28a-csp2 plasmid routinely proceeds to transetta (de3) or bl21 (de3) competent cell, is coated on corresponding resistant panel.Picking monoclonal shakes bacterium and iptg abduction delivering.

Iptg induction prokaryotic expression process is as follows:

1) 2 transetta (de3) of picking or bl21 (de3) bacterium colony from each flat board, in 34 containing 50 μ g/mlkan sums (bacterium of bl21 (de3) no cam resistance) is cultivated, 37 DEG C, 180rpm is overnight in μ g/ml cam liquid lb.

2) overnight bacterium is inoculated in the liquid lb triangular flask containing corresponding resistant with 1: 100 respectively, 37 DEG C, 180rpm, and 3 is little When.When od reaches 0.6 about, 1ml bacterium is taken to be comparison respectively.The iptg of the final concentration of 1mm of remaining addition, 37 DEG C, 180rpm cultivates 4 hours.

3) take 1ml bacterium respectively, centrifugation, collect supernatant precipitation.

4) induction bacterium and non-induction bacterium add 2 × loading buffer of 30 μ l respectively, mix and boil 5min.

5) sds-page glue, loading, electrophoresis are prepared.

6), after electrophoresis, dye, decolour, take pictures.

3.3.3csp1 the Antibody preparation with csp2 albumen

3.3.3.1 a large amount of abduction delivering csp1 and csp2 albumen

1) inoculate: respectively the expression bacterium 5ml mother solution of two genes is accessed in the 600ml liquid lb containing corresponding resistant, 37 DEG C, 180rpm shakes 3 hours.

2) induce: add iptg to final concentration of 1mm, induce 5 hours.

3) detect: take 1ml to test expression from the big bottle of 600ml.

4) receive bacterium in a large number: 50ml centrifuge tube is poured in bacterium pre-cooling (ice-water bath or put 4 DEG C) into after 10 minutes, 4000rpm, 4 DEG C from The heart 15 minutes, collects thalline.

5) wash: the thalline of collection is dissolved in the normal saline of 30ml (0.85%), mix, 8500rpm is centrifuged 5 minutes.

3.3.3.2 inclusion body washing

1) crush: add the super-broken buffer of 17ml (1/3 bacterium solution volume) in the thalline collected, mix, ultrasonication 40 Minute (broken 7 seconds, stop the 5s second).4 DEG C, 9000rpm is centrifuged 10 minutes, retains supernatant.

2) wash: with the resuspended thalline of 10ml washing liquid, 4 DEG C, 5000rpm is centrifuged 10 minutes.Can wash 3-4 time, stay every time It is used for clearly sds-page gel electrophoresis.Solution is placed on ice or 4 DEG C.

3) wash: washed 3-4 time with 10ml washing liquid ii, leave supernatant every time, for sds-page electrophoresis.Solution is placed in On ice or 4 DEG C.

4) resolution of precipitate: precipitation solubilization of inclusion bodies liquid is dissolved into 1ml.

5) detect: the solution of each several part is taken 20 μ l, sds-page glue detection after process.

3.3.3.3 albumen cuts glue reclaim

Inspection purpose band it is possible to a large amount of sds-page electrophoresis, dyeing, is decoloured in which Guan Zhonghou.Cut purpose band, Grind.Albumin glue after grinding adds albumen lixiviating solution, and 4 DEG C overnight.

3.3.2.4 extraction is processed

1) 4 DEG C, 9000rpm centrifugation lixiviating solution 30 minutes.Supernatant is poured in 50ml test tube, and precipitation can continue to extract.

2) supernatant, with 4 times of acetone precipitations, is placed in precipitation 2 hours in -20 DEG C or -80 DEG C of refrigerators, preferably overnight.

3) 4 DEG C, 9000rpm is centrifuged 20 minutes, abandons propanoic acid.Precipitation dissolves egg with appropriate super-broken buffer or buffer d In vain.

4) purity of protein inspection and sample presentation prepare antibody.

3.3.4western csp1 and csp2 albumen in blot detection jm4 transformant

3.3.4.1elisa detect an anti-potency of csp1 and csp2 albumen

1) antigen is pre-coated: with being coated buffer by antigen diluent (preliminary experiment determination), every hole adds 100 μ l to be coated liquid, Place 60 minutes for 37 DEG C, 4 DEG C overnight.

Note: the concentration of csp1, csp2 purifying protein stock solution is about 5 μ g/ μ l, is diluted to 1ug/ respectively with being coated buffer 100 μ l and 0.5ug/100 μ l.10th hole is that antigen does negative control with 1 μ g/100 μ l bsa.Each ANTIGEN DESIGNThe two is dense Degree gradient.

2) wash: abandon the liquid in orifice plate, plus pbst washs 3 times, each 2-3 minute, finally pats dry as far as possible.

3) close: every hole adds confining liquid 200 μ l, and room temperature closes 15 minutes (or 60 minutes), washs 3 times.

4) dilute antibody: serum to be checked is diluted with pbs, respectively 1/50,1/100,1/500,1/1000,1/2000, 1/3000,1/4000,1/6000,1/12000, every hole adds 100 μ l.10th hole bsa is that antigen does negative control, used one Anti- concentration is 1/500.11st, 12 holes are blank (2 holes, not increase serum).

5) Jia one anti-.37 DEG C placement 35-60 minutes, or 4 DEG C overnight.Pbst washes 3 times.

6) Jia two anti-.Every hole enzyme-added labeling antibody hrp- goat-anti exempts from two anti-100 μ l, 37 DEG C of placement 30-60 minutes.

7) pbst washs 4 times, pats dry.Do not pat dry and have false positive.

8) el-opd colour developing.Every hole adds substrate 100 μ l, and room temperature lucifuge develops the color 10 minutes, plus terminate liquid 50 μ l.

9) microplate reader evaluation.

3.3.4.2jm4 Cordyceps militaris (L.) Link. and its total protein extraction of transformant

The mycoprotein extraction agent box description won with reference to shellfish is operated.

1) collect appropriate pupa aweto bacterium ball, aseptic washing 2 times, 4 DEG C, 8000rpm is centrifuged 5 minutes.Precipitation is placed in -80 DEG C Preserve or extracting directly albumen in refrigerator.

2) take 100mg jm4 and transformant fungus ball to be placed in the mortar of pre-cooling, add liquid nitrogen to keep tissue to be in freezing shape Fungus ball is ground into powder as soon as possible by state with grinding mallet.

3) the solution a500 μ l in test kit is added (to be previously added 4 μ l protease inhibitor cocktails and 2 μ l are protein stabilized Agent), continue to grind.

4) sample is drawn onto in 1.5ml centrifuge tube, places 2 hours or overnight for 4 DEG C.

5) 4 DEG C, 12,500rpm centrifugations 2 minutes, abandon precipitation.

6) take 60 μ l supernatants, add 2 × sample-loading buffer boiling water bath 10 minutes.

7) sds-page electrophoresis.

Note: all add 10ul1m dtt in the test of each step, add protease inhibitor in proteolytic.

3.3.4.3 cma staining

In this operating process, required solution is now with the current, and step is as follows:

1) fixing: the gel taking out to be put in the disk added with fixative, room temperature is gently shaken 15 minutes, changes fixative again The gentle shake of room temperature 15 minutes；

2) it is sensitized: the fixative pouring out in disk adds sensitizing solution in the gentle shake of room temperature 30 minutes；

3) rinse: pour out sensitizing solution in disk, cleaned with 250ml distilled water 3 times, all gently shake 5 points at room temperature every time Clock；

4) silver staining: pour out distilled water in disk and add silver staining liquid, gentle shake 20 minutes under room temperature；

5) rinse: pour out silver staining liquid in disk, 250ml distilled water cleans 2 times, all gently shakes 1 minute at room temperature every time；

6) develop the color: pour out in disk distilled water and add nitrite ion, gently shake under room temperature to band can be clearly seen；

7) terminate: pour out nitrite ion and add terminate liquid, room temperature gently shakes 10 minutes；

8) rinse: pour out terminate liquid, plus 250ml distilled water cleans 3 times, the gentle shake of each room temperature 5 minutes.Now can To be imaged to gel.

3.3.4.4sds-page electrophoresis

1) clean glass plate: dip in a liquid detergent and gently cleaned, after with tap water rinse, airing.

2) encapsulating and loading: with reference to Molecular Cloning:A Laboratory guide (Pehanorm Brooker etc., 2002)

3) electrophoresis: electrophoresis to bromjophenol blue has just been run out of and can have been terminated electrophoresis, carries out transferring film

3.3.4.5 the wet transferring film of slot type

1) glue is dipped in transfering buffering liquid and balances 10 minutes.Note: such as detection small molecular protein, this step can be omitted, because Small molecular protein easily spreads plastic emitting.

2) according to one film of size clip and 6 filter paper of glue, put in transfering buffering liquid and balance 10 minutes.Pvdf film needs First soak the 3-5 second with pure methanol.

3) sandwich: sponge, 3 metafiltration paper, glue, pvdf film, 3 metafiltration paper, sponge is shifted in assembling in order, puts well for every layer Afterwards, rushed bubble with glass rod.Make sure to keep in mind: glue is near negative pole face (black side).

4) transfer groove is placed in ice bath, puts into sandwich (black side is to black side).Plus transfering buffering liquid, plug electricity Pole, 100v, 57 minutes (electric current is about 0.3a).Note: sandwich should be checked again for and whether electrode assembles correctly, whether power supply Connect.

5) after transferring film terminates, cut off the electricity supply, take out hybond membrane

3.3.4.6 immuning hybridization and colour developing

1) 25mltbs washes hybond membrane 5 minutes, and room temperature is shaken.

2) abandon tbst, put film 1 hour in 25ml skim milk Block buffer, ambient temperature with gentle shakes.

3) abandon confining liquid, 15ml tbst washes 3 times (5 minute/time), ambient temperature with gentle shakes.

4) abandon tbst, (the one of csp1 resists for 1: 4000 to add the one of appropriate dilution to resist；The one of csp2 resists for 1: 1000), Incubated at room 1-2 hour or 4 DEG C overnight, slow shake.

5) abandon one to resist, 15ml tbst washes 3 times (5 minute/time), room temperature is shaken.

6) abandon tbst, add two anti-, incubated at room 1h of alkali phosphatase (ap) (1: the 3000) labelling of appropriate dilution, Slow shake.

7) abandon two to resist, 15ml tbst washes 3 times (5 minute/time).

8) 15ml tbst washes 1 time.

9) bcip colour developing, lucifuge develops the color to occurring putting into terminating reaction in distilled water during band.

10) take pictures.

3.3.5 the greater wax moth larva infection of transformant

3.3.5.1ppda solid medium is prepared

Peeled potatoes 200g, decocting in water 15 minutes after shredding, decontamination adds glucose 20g, peptone 10g respectively, kh₂po₄3g, mgso₄·7h₂O1.5g, vb0.02g, add water to 1l.Every liter of solid medium plus 15g agarose.121 DEG C of sterilizings 30 minutes.

3.3.5.2 inoculation

Following bacterial strain is accessed flat board: wild type jm4；Turn No. 2, No. 34, No. 35 of jm4 Cordyceps militaris (L.) Link. of pkg empty carrier；Turn The transformant of csp1 10, No. 31, No. 41；Turn No. 18, No. 29, No. 33 of csp2 transformant；Turn c0c2 transformant 3,17 Number, No. 21.At 23 DEG C, culture harvests conidium in 10 days.

3.3.5.3 conidium is collected

10ml sterilized water washes lower conidium from flat board, after three layers of aseptic lens paper filter 2 times, in terms of blood counting chamber Number.Obtained mother solution sterilized water is diluted to variable concentrations, and respectively 2 × 10⁷Individual/ml, 2 × 10⁶Individual/ml, 2 × 10⁵Individual/ml, 2×10⁴Individual/ml, 2 × 10³Individual/ml.Clear water compares.

3.3.5.4 greater wax moth larva bioassay

Pad upper two-layer aseptic filter paper in the culture dish of diameter 9cm, 121 DEG C of moist heat sterilizations 1 hour.Each plate puts 10 Greater wax moth linal-instar larvae, is separately added into the bacterium solution that 1ml has diluted.Comparison plus 1ml sterilized water.Each process is repeated 3 times.By plate It is put in 23 DEG C of culturing room, larva no longer fed food.

3.3.5.5 data analysiss

Every 2 days record greater wax moth mortality rates.All percent value, after arcsine transformation, carry out one- with spss software Way variance analyses.Multiple comparisons adopt duncan method.It is not notable that same letter above block diagram represents variance analyses difference, Different letters represent significant difference (p < 5%).

3.4 results and analysis

3.4.1 the jm4 mutation word bank turning serine hydrolase gene builds

3.4.1.1pkgcsp1, pkgcsp2, pkgc0c2 vector construction

Pcr first expands csp1, csp2, c0 and c2 genetic fragment.It can be observed from fig. 2 that pcr amplification clip size with Expection is consistent, and product carries out glue reclaim purification.

C0 the and c2 fragment reclaiming, is taken 50ng to be mixed into template respectively, is drawn with the downstream of the forward primer of csp1 and csp2 Thing is combined into primer pair, amplifies c0c2 fragment.Expected c0c2 clip size is about 2300bp.Fig. 2 show pcr result and Expected consistent, glue reclaim c0c2 product.

The purified product of pkht-gfp plasmid and csp1, csp2, c0c2 carries out (kpn i and xba) double digestion, glue respectively After recovery purifying product, appropriate carrier and fragment is taken to carry out Ligation in vitro respectively, conversion escherichia coli dh5 α competent cell is simultaneously It is coated on the lb flat board containing kanamycin.Pcr calibrating is carried out to longer bacterium colony on flat board, positive colony sample presentation is sequenced.

1st, pcr detection escherichia coli dh5 α/pkgc0c2 bacterium colony

From figure 3, it can be seen that the pcr primer size of 4 and 6 swimming lanes is close with c0c2, the clone of gained is probably correct , sample presentation is sequenced.

2nd, pcr detects the bacterium colony of escherichia coli dh5 α/pkgcsp1 and pkgcsp2

Fig. 4 shows, pcr expands band it may be possible to correct gram in place for the clone 1,5 and 6 of pkgcsp1 Longzi, can be sequenced with sample presentation.The clone of pkgcsp2 in addition to 7, other 5 bands having suitable size, can be with sample presentation Sequencing.

3rd, double digestion (hind the and kpn) identification of pkgcsp1 and pkgcsp2 plasmid

Hind and kpn enzyme action pkgcsp1 and pkgcsp2 plasmid, can get two bands: the fragment of carrier in theory, Another about 3.3kb band including gpd and csp1 (or csp2).Show from Fig. 5, swimming lane 1 and 5 has suitable band, says This two clones bright are probably correct, then sequence verification.

4th, double digestion (hind and kpn) identification pkgc0c2 plasmid

The expected resultss of hind and kpn double digestion pkgc0c2 plasmid should be two bands: one is carrier, in addition Article one, comprise gpd and c0c2 fragment about 4.4kb band.From shown in Fig. 6, enzyme action result shows, has positive gram of correct pkgc0c2 Grand.

Result correct sample sample presentation is sequenced.Correct positive colony, will extract corresponding plasmid conversion Agrobacterium agl- 1.

3.4.1.2atmt method obtains the transformant that jm4 turns serine hydrolase gene

This experiment utilizes atmt method, the right boundary of several plasmid pkg, pkgcsp1, pkgcsp2, pkgc0c2 it Between element insertion Cordyceps militaris (L.) Link. jm4 genome dna in.The transformant that this experiment preserves is as follows: pkg transformant 64, pkgcsp1 Transformant 76, pkgcsp2 transformant 67, pkgc0c2 transformant 63.

3.4.2 the identification of transformant

3.4.2.1rt-pcr detect the expression of genes of interest in each transformant

Fig. 7 is the extraction of total rna of wild type jm4 and several muton.

Turn in the transformant of pkg empty carrier (pkht-gfp) and contain gfp albumen, can be with this gene as screening mark Note, the clip size about 1000bp of lac-gfp；The transformant turning pkg csp1, pkg csp2 and pkgc0c2 can be used respectively Csp1 and csp2 gene screening, clip size about 1100bp；With wild type Cordyceps militaris (L.) Link. jm4 as negative control.Each transformant training Total rna, and the dnase process with no rna enzyme is extracted after supporting, then reverse transcription cdna first chain.With cdna as template, carry out pcr Amplification identification.

As can be seen from Figure 8: in the jm4 muton of 4 pkg, only 1 does not have signal, other 3 gfp expressions Very high；In the muton of pkgcsp1,2 are had not have purpose band, 2 bands are weaker, 3 bands are very strong；5 of pkgcsp2 Muton all detects csp2 gene, and expresses all very strong.

As can be seen from Figure 9: in the jm4 muton of 4 pkgc0c2, with the primer identification of csp1 gene or csp2 gene T-dna inserts situation, and obtained result is basically identical, and 4 have and weak or strong signal is detected.1 and 6 is wild respectively The pcr amplified production of the csp1 and csp2 gene of type jm4.

3.4.2.2 the gfp albumen in each transformant of fluoroscopic examination

As seen from Figure 10, substantially there is no the accumulation of green fluorescent protein in wild type jm4, so the work in exciting light Do not send fluorescence with lower.And positive transgenic muton can to send bright green under the exciting of certain wavelength light glimmering Light.

After solid ppda flat board is cultivated 10 days, can be seen that under fluorescence microscope, gfp albumen is big in transformant mycelia The situation (Figure 10) of amount accumulation.

3.4.2.3 the sporophore culture of Cordyceps militaris (L.) Link. muton

In sporophore incubation, screening mycelial growth, annesl and all normal muton of former base differentiation, proceed son Entity is cultivated.The yield of sporophore and form the turn serine hydrolase muton close with wild type Cordyceps militaris (L.) Link. jm4 is selected (to scheme 11) carry out next step experiment.

3.4.3 the southern blot analysis of transformant

3.4.3.1 the genome dna of muton extracts

The cell wall of funguses is thicker, and secondary metabolite can be adsorbed with genome dna, causes the more difficult extraction of dna.This experiment Using fungal gene group dna large scale extracting method, can effectively extract the genome dna of more complete pupa aweto bacterium ball.

With agarose gel electrophoresis method and ultraviolet spectrophotometry detection dna concentration and quality.As shown in figure 12, genome The quality of dna and concentration are all preferable, meet the requirement of subsequent experimental.It was found that, the Cordyceps militaris (L.) Link. mycelia of solid ppda culture Being that comparison is difficult extracts the complete and high genome dna of concentration, but liquid ppda culture mycelium pellet just can extract quality in 7 days Good genome dna.Fungus ball incubation time also can affect extraction effect, typically cultivates the gene that the fungus ball more than 10 days extracts Group integrity is not good.

3.4.3.2 probe preparation and susceptiveness test

Figure 13 is the pcr purified product of 3 genes.

Dig high prime dna labeling and detection starter kit according to roche provides Method operated.The probe solution of prepared three is diluted to 1ng/l, then takes 1ng/l stock solution to be diluted to 10pg/ successively This 5 gradients of l, 3pg/l, 1pg/l, 0.1pg/l, 0.3pg/l.Good control dna marked in test kit also press this 5 Individual gradient dilution is good.The control dna having diluted is taken to put in order on film, concentration is put from high to low in pvdf from left to right Film.Put three rows from top to bottom, for three probe gfp, the detection of csp1, csp2.

The probe points of respective concentration film on control dna identical position is taken to be put in UV-crosslinked instrument crosslinking 3 respectively Secondary.First row is gfp, and second row is csp1, and the 3rd row is csp2.Figure 14 shows, the susceptiveness of gfp, csp1, csp2 probe is very Good, it can be seen that speckle after 300,000 times of dilution.Can make of the 30000 of probe or 100000 diluents in test Southern hybrid experiment.

3.4.3.3southern blot detects the insertion situation of genes of interest in transformant

Analyze the insertion sequence in each transformant, only carry a hind restriction enzyme site at promoter gpd end, So the enzyme action of genome dna can select hind.All positive transformants all should carry gfp gene, so using labelling The gfp gene crossed is as probe.According to screening experiment above, select 2,34, No. 35 of pkgfp transformant；Pkgcsp1 converts 10,31, No. 41 of son；3,17, No. 21 of the transformant of the 18 of pkgcsp2 transformant, 29, No. 33 and pkgc0c2 are carried out southern blot.

According to the concentration of total dna, set up the genome dna endonuclease reaction system of wild type and transgenic jm4, each dna Amount of samples is 2-5 μ g.

Figure 15 shows, the swimming lane of wild type jm4 genome dna does not have band, illustrates not having gfp gene in wild type jm4； No. 10 clones of No. 2 clones of transgenic pkgfp and transgenic pkgc1 have outside two hybrid belts, the swimming of other transformants Road all only has a band.Illustrate that the list copy insertion rate of t-dna is about 83%, multicopy rate is about 17%, this and report Result similar (zheng et al., 2011).3.4.4 the flanking sequence analysis of transformant

After each transformant is normally cultivated 7 days in liquid ppda culture medium, the fungus ball of about 0.1g is taken to clean 3 with ultra-pure water Secondary, centrifugation.After fungus ball precipitation is with liquid n quick freeze, -70 DEG C or extracting directly genome dna can be saved in.Integrity Good dna is used for tail-pcr and expands flanking fragment.Note: templet gene group dna added by first round pcr system of 50 μ l must not More than 100 μ g, general consumption is 50 μ g.

Third round the product (> 500bp of tail-pcr amplification) carry out glue reclaim (Figure 16), and clone and be sequenced.To correct Sequencing result be analyzed.

On ncbi website, blastn and blastx is carried out to 9 flanking sequences obtaining and compares.Wherein 33% transformant T-dna be inserted into the gene internal of Cordyceps militaris (L.) Link., such as α-Isosorbide-5-Nitrae-polysaccharide glycogen phosphorylase, monooxygenase, c-8 The inside of sterol isomerase.The t-dna of one of transformant is inserted into α -1,4- polysaccharide glycogen phosphorylase base Inside one intron of cause；The t-dna of one transformant is inserted into the inverse the 52nd of certain exon of c-8 sterol isomerase At individual base；Monooxygenase is to be interrupted at the 148th base of inverse of certain exon.These genes are interrupted not The growth of impact Cordyceps militaris (L.) Link.sporophore.

The flanking sequence of 33% transformant occurs in that pkht carrier sequence, is readed over by comparison discovery and inserts with inverted repeat Enter both phenomenons.Comparison result finds, 33% survey wing sequence homology is very low or does not have homology (being shown in Table 3).

The t-dna flanking sequence blast comparison result of table 3 fractional mutations

3.4.5 prokaryotic expression csp1 and csp2 albumen and Antibody preparation

3.4.5.1 serine protease gene Prokaryotic expression vector construction

N terminal sequence using dnastar software analysis csp2 albumen is mklyvilailpvalaap.This protein sequence Meet the n end principle not being readily expressible: remove outside first methionine, after several aminoacid make whole albumen unstable, As k (lys) l (leu) y (tyr)；The hydrophobic structure at n end also have impact on the expression of albumen.Csp2 albumen n terminal sequence is mostly hydrophobic Aminoacid, such as: a, i, l, p, v, f, w, y.In addition, using http://nihserver.mbi.ucla.edu/racc/ analysis The base feature of csp2 gene, finds that the n end of csp2 gene carries multiple rare codons, can affect its prokaryotic expression.

Through analysis, there is a bamh restriction enzyme site after the 93bp at csp2 gene n end, removal 93 bases above are not Antibody (in the case of nature, hydrophobic amino acid is all to be embedded in active site of protein, does not produce epitope cluster) is prepared in impact.Cut csp2 Several aminoacid at gene n end, remaining gene may be with prokaryotic expression.Remove the csp2 gene life of 93 bases in n end Entitled scsp2.

As seen from Figure 17, csp1 and scsp2 (removing 93, n end base) is correctly connected to expression vector pet- respectively In 28a.Plasmid can be extracted respectively go in transetta (de3) competent cell, and iptg abduction delivering.

3.4.5.2 prokaryotic expression csp1 and csp2 albumen

Show from the prokaryotic expression result of Figure 18, the destination protein of csp1 expression has great expression in the position of about 50kd. The scsp2 gene cutting 93bp base also obtains great expression in transetta (de3) bacterium, expressed albumen size ratio Csp1's is slightly smaller.Transetta (de3) is to transform, from bl21 (de3), the bacterial strain coming, and it can provide rare codon Expression, is substantially " omnipotent expression bacterium ".

3.4.5.3 two serine stretch proteins of glue purification are cut in a large number

It can be observed from fig. 19 that two genes cut glue product in 200kd about position have minimal amount of miscellaneous band, not shadow Sound prepares antibody as antigen.Compare with quantitative bsa, the csp1 protein concentration rough estimate cutting glue purification is 6 μ g/l, purification Scsp2 albumen concentration be about 10 μ g/l.Sample presentation 1ml, to Wen Yuange company, prepares many obtained purifying protein respectively Clone rabbit antibody.

3.4.6 the western blot detection of transformant

3.4.6.1 the whole protein extracting of Cordyceps militaris (L.) Link. jm4

The processing ease of extracting Cordyceps militaris (L.) Link. whole protein, but obtained albumen is impure many, easily carries out next step examination Test.In addition, adding serine hydrolase gene in the transformant of this experiment, further promote extracted albumen by water Solution.Therefore, will note adding protease inhibitor in the overall process extracting albumen, in case degraded.The albumen that Cordyceps militaris (L.) Link. extracts Seldom, the result examining dye is undesirable for amount, so the method dyeing sds-page glue of silver staining, just can see band.Carry out During western blot, applied sample amount just will can detect genes of interest enough.Specifically as shown in figure 20.

3.4.6.2elise the potency that detection csp1 and csp2 mono- resists

Tested according to elise detection method, in colour developing result reading under od492nm.The antigen applied sample amount of csp1 During for 0.5 μ g, the od492nm value of 1/6,000 1 anti-diluents reaches 1.228；When the antigen applied sample amount of csp1 is 1 μ g, 1/6,000 1 The od492nm value of anti-diluent reaches 1.4.

When the antigen applied sample amount of scsp2 is 0.5 μ g, the od492nm value of 1/,500 1 anti-diluents reaches 0.773；Scsp2 resists When former applied sample amount is 1 μ g, the od492nm value of 1/4,000 1 anti-diluents reaches 1.023.

From experimental result it can be seen that the antibody titer of csp1 is very high, the data with 0.5ug/ul antigen gained is very high, says The sensitivity of this antibody bright is high.The data ratio that bsa obtains as negative control is relatively low, illustrate csp1 antibody single-minded Good.The concentration of 1:4000 or 1:6000 can be used when being western blot further.

The potency of scsp2 antibody is more general, but its sensitivity and specificity can meet experiment.Further Do the concentration that can use 1:500 or 1:1000 during western blot.From the above result that can be seen that the antibody specificity of csp1 Better than scsp2, potency is also high.It is probably because causing specificity and sensitivity to have the reason csp2 has been removed several aminoacid Decline.

3.4.6.3csp1 expression in transgenic pupa weeds jm4 for the gene

As seen from Figure 21: the transgenic jm4 of wild type jm4 and insertion gfp does not have any band, illustrates both There is no csp1 albumen, and turn gcsp1 and turn the jm4 muton of gc0c2 the position of 30-40kd have one substantially and unique Band.The csp1 size of prokaryotic expression is in the position of about 50kd, and possible csp1 albumen there occurs when working in funguses Degraded.

3.4.6.4csp2 expression in transgenic pupa weeds jm4 for the gene

Western blot detects expression (Figure 22) in several transgenic jm4 for the csp2 gene it can be seen that wild type Jm4 and insertion gfp transgenic jm4 muton there is no any band, illustrate both there is no csp2 albumen.And turn Gcsp2 has one substantially and uniquely to carry with the jm4 muton turning gc0c2 in the position of 30-40kd.Possible csp2 and csp1 Equally, in action there occurs change when.

3.4.7 the greater wax moth infection experiment of transformant

The jm4 transformant of each transgenic takes 3 mutons for greater wax moth infection experiment respectively, finds during data analysiss There is no difference in 3 mutation subgroups of various genes.When analyzing between group, various transgenic mutons just take 1 group of data.With water Infect for comparison with jm4 wild type.

3.4.7.1 greater wax moth larva infects the death condition of 7 days

The comparison of water process, all greater wax moths all survive.After various Cordyceps militaris (L.) Link. infection greater wax moth 7 days, greater wax moth dead The situation of dying turns few；Wherein 2 × 10³All process of infection level all do not have greater wax moth death condition；Wild type jm4 turns with only (pkg-34) muton of gfp is all not significantly different under any spore amount disposition；With the comparison of wild type jm4, turn Serine hydrolase gene (csp1, csp2 or c0c2) muton is 2 × 10⁷、2×10⁶、2×10⁵Spore level is to greater wax moth The lethal ability of larva all significantly improves；2×10⁷、2×10⁶、2×10⁵Under spore level, turn csp1, csp2 or c0c2 Muton does not have difference (Figure 23) to the lethal ability of greater wax moth larva.

3.4.7.2 greater wax moth larva infects the death condition of 14 days

Cordyceps militaris (L.) Link. infected greater wax moth after 14 days, 2 × 10⁷、2×10⁶Under spore level, various transgenic Cordyceps militaris (L.) Link. are processed Greater wax moth death condition basically reaches maximum death value；Under any spore amount disposition, wild type jm4 and only turn empty carrier (pkg-34) bacterial strain is all not significantly different to the lethal ability of greater wax moth larva；2 × 10⁷、2×10⁶、2×10⁵、2× 10⁴Under spore horizontal processing, compare with wild type, turn serine hydrolase gene mutation all aobvious to the lethal ability of greater wax moth Write and improve；2×10⁷、2×10⁶Under spore horizontal processing, turn the lethal ability to greater wax moth for the muton of csp1, csp2, c0c2 Have any different, but all significantly improve with contrast ratio pathogenecity；2×10⁵、2×10⁴Under spore horizontal processing, turn csp1, csp2, The muton of c0c2 is as broad as long to the lethal ability of greater wax moth.Illustrate that the c0c2 merging two genes of csp1 and csp2 does not have Significantly improve the lethal ability (Figure 24) to insecticide for the Cordyceps militaris (L.) Link..

3.4.7.3 greater wax moth larva infects the death condition of 21 days

Infect greater wax moth after 21 days, except spore concentration is 2 × 10⁵This group of individual/ml is outer, and the greater wax moth of all process is dead Situation is constant, and the lethal ability of each group is all not significantly different from.

In a word, turn csp1, csp2, c0c2 gene really can improve Cordyceps militaris (L.) Link. to greater wax moth lethal ability.

Claims

1. a kind of Cordyceps militaris (L.) Link. that can improve infects the Cordyceps militaris (L.) Link. engineering bacteria of host insect ability it is characterised in that it is to turn to have winter worm Summer grass serine hydrolase gene csp1 or csp2, and the Cordyceps militaris (L.) Link. of serine hydrolase csp1 or csp2 can be expressed, described Serine hydrolase gene csp1, its nucleotide sequence as shown in seq id no.1, described serine hydrolase gene Csp2, its nucleotide sequence is as shown in seq id no.2.