CN104195058A

CN104195058A - Cordyceps militaris engineering bacterium capable of improving capability of cordyceps militaris to infect host insects

Info

Publication number: CN104195058A
Application number: CN201410218655.6A
Authority: CN
Inventors: 江克清; 韩日畴
Original assignee: Guangdong Entomological Institute
Current assignee: Institute of Zoology of Guangdong Academy of Sciences
Priority date: 2014-05-22
Filing date: 2014-05-22
Publication date: 2014-12-10
Anticipated expiration: 2034-05-22
Also published as: CN104195058B

Abstract

The invention discloses a cordyceps militaris engineering bacterium capable of improving the capability of cordyceps militaris to infect host insects. The cordyceps militaris engineering bacterium is cordyceps militaris which is modified by a cordyceps sinensis serine hydrolytic enzyme gene csp1 or csp 2 and can express the serine hydrolytic enzyme gene csp1 or csp2; the nucleotide sequence of the serine hydrolytic enzyme gene csp1 is shown as SEQ ID NO. 1; and the nucleotide sequence of the serine hydrolytic enzyme gene csp2 is shown as SEQ ID NO. 2. The capability of the cordyceps militaris to infect greater wax moths is really improved by modifying the cordyceps militaris with the exogenous serine hydrolytic enzyme gene. The cordyceps militaris engineering bacterium provides a technical reference for improving the capability of cordyceps militaris to infect insects.

Description

A kind of Cordyceps militaris (L.) Link. engineering bacteria that can improve Cordyceps militaris (L.) Link. infection host insect ability

Technical field:

The invention belongs to Biochemistry and Molecular Biology field, be specifically related to a kind of Cordyceps militaris (L.) Link. engineering bacteria that can improve Cordyceps militaris (L.) Link. infection host insect ability.

Background technology:

The serine protein hydrolase of insect pathomycete generally has function (the Joshi et al. of degraded insect cuticle, 1995), it is the protease family that a class has identical catalyst mechanism, acts on the peptide bond in macro-molecular protein, makes it to become small protein.Serine protein hydrolase catalyzing activation is changed and is realized by one group, active centre amino-acid residue.The proteolytic enzyme of expressing in yeast system has certain translation post-treatment ability, make the foreign protein of results have folding processing to a certain extent and glycosylation modified, therefore the albumen that yeast system is expressed has certain function (Wang Shihua etc., 2007).The csp1 and the csp2 gene that derive from Cordyceps sinensis are two serine proteases, can be hydrolyzed insect stratum corneum, belong to proteolytic enzyme S8A subfamily member; Research shows that the Cordyceps sinensis serine protease of expressing in yeast cell has the ability (Zhang et al., 2008b) of degraded insect body wall.

The ability of Cordyceps militaris (L.) Link. infected insect is to evaluate an important indicator of Cordyceps militaris (L.) Link. proterties.The research that improves fungi infestation host ability is common in biocontrol fungi as in muscardine, green muscardine fungus, is mainly in fungal cell, to infect host insect ability to improve it by turning a genes involved.For example turn Bt virulence gene, serine stretch protein genoid, agglutinin gene (Callaghan et al., 2005; Lu et al., 2008; Fang et al., 2010) etc. be conducive to fungi and accelerate Invasive insect species body wall.The serine hydrolase gene that this research is integrated Cordyceps sinensis by ATMT method, in Cordyceps militaris (L.) Link. genomic dna, infects the ability of greater wax moth to improving Cordyceps militaris (L.) Link. JM4 bacterial strain.

Summary of the invention:

The object of this invention is to provide a kind of Cordyceps militaris (L.) Link. engineering bacteria that can improve Cordyceps militaris (L.) Link. infection host insect ability.

The Cordyceps militaris (L.) Link. engineering bacteria that can improve Cordyceps militaris (L.) Link. infection host insect ability of the present invention, to turn to have Cordyceps sinensis serine hydrolase gene csp1 or csp2, and can express the Cordyceps militaris (L.) Link. of serine hydrolase Csp1 or Csp2, described serine hydrolase gene csp1, its nucleotide sequence is as shown in SEQ ID NO.1, described serine hydrolase gene csp2, its nucleotide sequence is as shown in SEQ ID NO.2.

This research and utilization ATMT method has built and has turned Cordyceps sinensis serine hydrolase gene (csp1, csp2 and the gene c0c2 that both merge) Cordyceps militaris (L.) Link. JM4, and the muton of acquisition can be identified by green fluorescence.Screen the normal muton of a collection of growth characteristics by methods such as RT-PCR, Southern blot, Western bolt and sporophore cultivations, carry out greater wax moth end instar larvae infection experiment.Greater wax moth end instar larvae infection experiment is found, the mutant strain that turns csp1, csp2, c0c2 significantly improves the lethal ability of galleria mellonella waxmoth end instar larvae, but the insect infection ability of c0c2 (merging csp1 and two genes of csp2) Cordyceps militaris (L.) Link. mutant strain is not than the mutant bacteria plant height of individual gene (csp1 or csp2).

In a word, trans-exogenous serine hydrolase gene has improved the ability that Cordyceps militaris (L.) Link. infects greater wax moth really, and the present invention infects insect ability for raising Cordyceps militaris (L.) Link. provides Technical Reference.

Brief description of the drawings:

Fig. 1 is pKHt-gfp carrier figure;

Fig. 2 is amplification csp1, csp2, c0c2 gene fragment; M:DL2000DNA Marker1: blank; 2-5: the PCR product that is respectively csp1, csp2, c0 and c2; 6-7:PCR fusion product c0c2 Fig. 3 is the bacterium colony PCR qualification of bacillus coli DH 5 alpha/pKgc0c2, M:DL2000DNA Marker; 1-6: with the PCR product of csp1-F and csp2-R primer pair amplification pKgc0c2 bacterium colony;

Fig. 4 is the bacterium colony PCR qualification of bacillus coli DH 5 alpha/pKgcsp1 and pKgcsp2, M:DL2000DNA Marker; 1-6: with the PCR product of csp1 primer amplification pKgcsp1 bacterium colony, 7-12: with the PCR product of csp2 primer amplification pKgcsp2 bacterium colony

Fig. 5 is Hind III and the qualification of kpn I double digestion of pKgcsp1 and pKgcsp2 plasmid, M:Wide Range DNA Marker (100-6000bp), the Hind III of 1-3:pKgcsp1 plasmid and Kpn I double digestion result, the Hind III of 4-6:pKgcsp2 plasmid and Kpn I double digestion result;

Fig. 6 is Hind III and the qualification of Kpn I double digestion of pKgc0c2 plasmid, M: λ-Hind III digest DNA Marker; The Hind III of 1-3:pKgc0c2 plasmid and Kpn I double digestion result;

Fig. 7 is total RNA of wild-type Cordyceps militaris (L.) Link. JM4 and several mutons, M:DL2000DNA Marker, total RNA of 1-11: wild-type JM4 and several mutons;

Fig. 8 is the PCR qualification of 3 kinds of Cordyceps militaris (L.) Link. transformants, M:DL2000DNA Marker, lac-gfp gene in 1-4:PCR amplification pKg muton, csp2 gene in csp1 gene 12-16:PCR amplification pKgcsp2 muton in 5-11:PCR amplification pKgcsp1 muton;

Fig. 9 is the PCR qualification of Cordyceps militaris (L.) Link. pKgc0c2 transformant, M:DL2000DNA Marker, 1,6: the csp1 of the wild-type that increases respectively JM4 and the PCR product of csp2 gene, 2-5: the PCR product of csp1 gene in amplification pKgc0c2 muton; 7-10: the PCR product of csp2 gene in amplification pKgc0c2 muton;

Figure 10 is that the green fluorescence of Cordyceps militaris (L.) Link. muton detects, CK: wild-type JM4, A1-A3:pKg muton, B1-B3:pKgcsp1 muton, C1-C3:pKgcsp2 muton, D1-D3:pKgc0c2 muton;

Figure 11 is the Cordyccps-militaris-(L.)-link. Sporophore that turns serine hydrolase gene, CK: wild-type JM4 sporophore A, B: the sporophore that turns serine hydrolase transgenation;

Figure 12 is Cordyceps militaris (L.) Link. JM4 extracting genome DNA, M.: λ-Hind III digest DNA marker, 1: wild-type JM4 genomic dna, 2-4. turn Serine hydrolyzable group because of Cordyceps militaris (L.) Link. muton genomic dna; Figure 13 is the PCR purified product of 3 genes, M:DL2000DNA Marker, 1:gfp PCR purified product, 2:csp1PCR purified product, 3:csp2PCR purified product;

Figure 14 is the qualification of probe susceptibility, 1:gfp probe, 2:csp1 probe, 3:csp2 probe;

Figure 15 is the southern blot qualification (digestion of Hind III) of Cordyceps militaris (L.) Link. transformant; Probe: the gfp fragment of DIG-mark; M:DNA Molecular-Weight Marker II DIG-Labelde0.12-23.1Kb; C:JM4 genomic dna enzyme is cut product; C1:pMD-19+gfp+gpd fragment; C2:pMD-19+gfp+csp1 fragment, C3:pMD-19+gfp+csp2 fragment; 1-3: the genomic dna enzyme of three pKg transformants is cut product; 4-6: the genomic dna enzyme of three pKgcsp1 transformants is cut product; 7-9: the genomic dna enzyme of three pKgcsp2 transformants is cut product; 10-12: the genomic dna enzyme of three pKgc0c2 transformants is cut product.

Figure 16 is the flanking sequence of Tail-PCR amplification Partial Conversion; M:DL2000DNA Marker1-3: first, second and third of different transformants taken turns Tail--PCR reaction product;

Figure 17 is that the enzyme of pET-28a-csp1 and pET-28a-scsp2 recombinant plasmid is cut qualification; M:Wide Range DNA Marker (100-6000bp); The enzyme of 1-2:pET-28a-csp1 recombinant plasmid Hind III and BamH I is cut result; The enzyme of 3-4:pET-28a-scsp2 recombinant plasmid Hind III and BamH I is cut result;

Figure 18 is the prokaryotic expression of Csp1 and Scsp2 albumen; M:Prestained Protein Ladder; 1,3: not induction and Transetta (the DE3)/pET-28a-scsp2 recombinant bacterium of having induced; 2,4: not induction and Transetta (the DE3)/pET-28a-csp1 recombinant bacterium of having induced;

Figure 19 is Csp1 and the analysis of Scsp2 protein concentration of purifying; M:Prestained Protein Ladder; 1-3: be respectively 1 μ g, 2 μ g, the BSA of 3 μ g; 4-6: be respectively 0.5 μ L, 1 μ L, the Csp1 albumen of 2 μ L; 7-9: be respectively 0.5 μ L, 1 μ L, the Scsp2 albumen of 2 μ L;

Figure 20 is the whole protein of Cordyceps militaris (L.) Link. transformant; M:Prestained Protein Ladder1: wild-type JM4; 10,31, No. 41 of 2,34, No. 35 5-7:pKgcsp1 transformants of 2-4:pKg transformant; 3,17, No. 21 of 18,29, No. 33 11-13:pKgc0c2 transformants of 8-10:pKgcsp2 transformant;

Figure 21 is the expression that Western blot detects Csp1 albumen in muton; M:Prestained Protein Ladder C: positive control; 1: wild-type JM42:pKg transformant; 3-5:pKgcsp1 transformant (10,31, No. 41) 6-8:pKgc0c2 transformant (3,17, No. 21);

Figure 22 is the expression that Western blot detects Csp2 albumen in muton; M:Prestained Protein Ladder C: positive control; 1: wild-type JM42:pKg transformant; 3-5:pKgcsp2 transformant (18,29, No. 33) 6-8:pKgc0c2 transformant (3,17, No. 21);

Figure 23 is 7 days mortality ratio that turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infection greater wax moth larva of different concns, CK: sterilized water; JM4: wild-type Cordyceps militaris (L.) Link.;

Figure 24 is 14 days mortality ratio that turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infection greater wax moth larva of different concns, CK: sterilized water; JM4: wild-type Cordyceps militaris (L.) Link.;

Figure 25 is 21 days mortality ratio that turn serine hydrolase gene Cordyceps militaris (L.) Link. conidium infection greater wax moth larva of different concns, CK: sterilized water; JM4: wild-type Cordyceps militaris (L.) Link..

Embodiment:

Following examples are to further illustrate of the present invention, instead of limitation of the present invention.

Embodiment 1:

3.3 experimental technique

3.3.1 the JM4 sudden change word bank that turns mycelia csp1, csp2, c0c2 gene builds

3.3.1.1pKgcsp1, the vector construction of pKgcsp2, pKgc0c2

For basic, carry out the plasmid construction of serine hydrolase gene taking the carrier pKHt-gfp (be called for short pKg) that is suitable for fungi ATMT method.In the border of pKHt-gfp carrier, comprise from right to left following element: gpd promotor, MCS multiple clone site, trpC terminator, cam resistant gene, ori replicon, hyg hygromycin gene and gfp green fluorescence protein gene, wherein hph+ptrpC called after phyg.All serine hydrolase genes are to be all inserted in MCS (restriction enzyme Xba I-Kpn I), form corresponding carrier.

Concrete construction process is:

Transform taking pKHt carrier as basic framework, carrier is kana resistance (Mullins et al., 2001).

PKHt-gfp carrier:

1, EcoR I single endonuclease digestion pKHt carrier, the DNA of Qiangen company reclaims test kit and reclaims purifying and process in case carrier connects certainly through CIAP (TaKaRa).Through the lacZ+gfp fragment of identical EcoR I single endonuclease digestion, reclaim purifying.

2, the pKHt carrier 0.5 μ L processing is connected with lacZ+gfp fragment 1 μ L, adds 2 × ligase buffer (promega), 2 μ L, last moisturizing 0.5 μ L, 16 DEG C of ligations 2 hours.

3, after 4 μ L connection products are mixed with the E.coli DH5 α competent cell of 50 μ L, ice bath 30min.42 DEG C of hot agitated reaction 45s of water-bath, then place 3min on ice.Add LB substratum 500 μ L, at 37 DEG C, 250rpm jolts 45min.

4, get the LB substratum bacterium liquid of 200 μ L, on coating kana resistance LB culture plate, at 37 DEG C, cultivate 16-20 hour.The dark lower greeny positive monoclonal of picking, extracts plasmid, carries out sequencing analysis.Correct cloning vector called after pKHt1.

5,, with Expression vector (PAN2-4) DNA, 5760bp (GenBank:Z32750.1) plasmid is template, trpC primer (pst I kpn I-trpC – F:

GGG cTGCAGGGTACCgATCCACTTAACGTTACTGAAAT; Pst I-trpC – R:GGG cTGCAGaCTAGAAAGAAGGATTACCTCTA), Pfu DNA polymerase, dNTP and PCR reaction solution, amplification obtains trpC (729bp).Pst I single endonuclease digestion pKHt1 carrier, the DNA of Qiangen company reclaims test kit and reclaims purifying and process in case carrier connects certainly through CIAP (TaKaRa).Through the trpC fragment of identical pst I single endonuclease digestion, reclaim purifying, then be connected with pst I single endonuclease digestion pKHt1 carrier, then proceed in E.coli DH5 α competent cell.Clone and detection are undertaken by 3,4 steps.Insert trpC and bring the restriction enzyme site of a kpn I in upstream at pKHt1.The correct direction of insertion of trpC is that kpn I site is near pKHt carrier right margin.Correct plasmid called after pKHt2.

6,, with Expression vector (PAN2-4) DNA, 5760bp (GenBank:Z32750.1) plasmid is template, gpd primer (Hind III-gpd-F:GGG aAGCTTcAATTCCCTTGTATCTCTACAC; Xba I-gpd-R:GGG tCTAGAgGTGATGTCTGCTCAAGCG), Pfu DNA polymerase, dNTP and PCR reaction solution, amplification obtains gpd (2.3kb).Its PCR reaction system: 10 × PCR buffer5 μ l, upstream (Forward) and the each 1 μ l of downstream (Reverse) primer, Expression vector100ng is template, 10mM dNTPs1 μ l, Pfu-Taq (1U/ μ l), last moisturizing to 50 μ l.PCR reaction conditions: 94 DEG C of thermally denature 5min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C are extended 2min, carry out altogether 30 circulations; Last 72 DEG C are extended 10min, obtain gpd product.

7, the DNA of Qiangen company reclaims test kit and reclaims purifying gpd product, again reclaims the fragment of 2.3kb after Hind III and Xba I double digestion gpd.PMD19-gfp (in gfp gene insertion vector pMD19) carrier reclaims the carrier segments of 2692bp after Hind III and Xba I double digestion.Be connected with the gpd product of Hind III and Xba I double digestion, then transform enter in E.coli DH5 α competent cell, clone and inspection undertaken by 3,4 steps, pMD19-T resistance is ampicillin.The carrier called after 19T-gpd that checks order correct.

8,19T-gpd and pKHt2, after Hind III and kpn I enzyme are cut, reclaim respectively gpd fragment and the pKHt2 carrier of purifying 2.3kb.Again both are connected, transform, cloned and check and undertaken by 2,3,4 steps.Correct carrier called after pKHt-gfp.In pKHt-gfp carrier, introducing multiple clone site comprises: Xba I, BamH I, Sma I, Xma I and Kpn I.PKHt-gfp carrier figure as shown in Figure 1.

9: all serine hydrolase genes are to be all inserted in MCS (restriction enzyme Xba I-Kpn I), form corresponding carrier.

1) csp1, csp2, c0c2 gene primer

Table 1

2) pcr amplification of csp1, csp2, c0c2 gene and the structure of pKgcsp1, pKgcsp2 and pKgc0c2

The nucleotide sequence of serine hydrolase gene csp1 is as shown in SEQ ID NO.1, taking csp1 gene as template, primer with the csp1 gene that increases in table 1: Xba I-csp1-F and Kpn I-csp1-R carry out PCR reaction as primer, amplification csp1 gene, amplification obtains csp1 fragment.Xba I and Kpn I double digestion csp1 fragment and pKHt-gfp carrier, reclaim purifying object fragment, and then connect, and csp1 fragment is inserted in Xba I-Kpn I of pKHt-gfp carrier, obtains pKgcsp1.

The nucleotide sequence of serine hydrolase gene csp2 is as shown in SEQ ID NO.2, taking csp2 gene as template, primer with the csp2 gene that increases in table 1: Xba I-csp2-F and Kpn I-csp2-R carry out PCR reaction as primer, amplification csp2 gene, amplification obtains csp2 fragment.Xba I and Kpn I double digestion csp2 fragment and pKHt-gfp carrier, reclaim purifying object fragment, and then connect, and csp2 fragment is inserted in Xba I-Kpn I of pKHt-gfp carrier, obtains pKgcsp2.

Taking csp1 gene as template, the primer by the c0 fragment that increases in table 1: Xba I-csp1-F and C0-R carry out PCR reaction as primer, amplification obtains c0 fragment.Taking csp2 gene as template, the primer by the c2 fragment that increases in table 1: c2-F and Kpn Ⅰ – csp2-R carry out PCR reaction as primer, and amplification obtains c2 fragment.Mix using c0 fragment and c2 fragment as template, using the primer Xba I-csp1-F of amplification c0c2 fragment and Kpn Ⅰ – csp2-R as primer, carry out PCR reaction, it merges PCR reaction system: 10 × PCR buffer5 μ l, upstream (Forward) and the each 1 μ l of downstream (Reverse) primer, c0 and the each 50ng of c2 fragment, 10mM dNTPs1 μ l, Pfu-Taq (1U/ μ l), last moisturizing to 50 μ l.PCR reaction conditions: 94 DEG C of thermally denature 3min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C are extended 2min, carry out altogether 30 circulations; Last 72 DEG C are extended 10min.Amplification obtains c0c2 fragment, and this c0c2 fragment is the fragment that the csp1 gene of the csp1 gene after removal terminator TAA and removal initiator codon ATG is linked together.Xba I and Kpn I double digestion c0c2 fragment and pKHt-gfp carrier, reclaim purifying object fragment, and then connect, and c0c2 fragment is inserted in Xba I-Kpn I of pKHt-gfp carrier, obtains pKgc0c2.3) construction procedures of ATMT carrier and bacterial strain.

3.3.1.2ATMT method turns serine hydrolase gene in JM4

With Cordyceps militaris (L.) Link. (Cordyceps militaris) JM4 of wild-type, (this bacterial strain is disclosed in document: Zheng Z, Huang C, Cao L, Xie C, Han R.Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus Cordyceps militaris.Fungal Biol.2011Mar; 115 (3): 265-74, this bacterial strain the applicant also hold, can the application rise the applying date in 20 years and provide to the public) be material, reference (Zheng Z, Huang C, Cao L, Xie C, Han R.Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus Cordyceps militaris.Fungal Biol.2011Mar; 115 (3): 265-74) disclosed agriculture bacillus mediated (ATMT) method in, respectively carrier pKgcsp1, pKgcsp2 and pKgc0c2 are imported in the conidium of Cordyceps militaris (L.) Link. JM4 with ATMT method, build respectively pKgcsp1, the pKgcsp2 and the pKgc0c2 sudden change word bank (being various transformants) that obtain Cordyceps militaris (L.) Link. JM4.

3.3.1.3RT-PCR detect transformant

Adopt Trizol solution to extract total RNA of Cordyceps militaris (L.) Link. transformant, detailed process is as follows:

1) take cordyceps mycelium 0.1g, be positioned over mortar liquid nitrogen grinding.

2) add 1mL Trizol solution at process of lapping, after dissolving, fully grind and receive immigration 1.5mL centrifuge tube, cover tightly pipe lid, fierce vibration 15 seconds, standing 5 minutes of room temperature;

2) 4 DEG C, centrifugal 10 minutes of 12,000rpm, gets supernatant and proceeds in new 1.5mL centrifuge tube;

4) every pipe adds the chloroform of 0.2mL, covers tightly lid, thermal agitation 15 seconds; Room temperature leaves standstill 3 minutes;

5) 4 DEG C, centrifugal 10 minutes of 12,000rpm, carefully draws upper strata water, proceeds to another new 1.5mL centrifuge tube;

6) add the chloroform of 1 times of volume, cover tightly lid, thermal agitation 15 seconds, room temperature leaves standstill 3 minutes;

7) 4 DEG C, centrifugal 10 minutes of 12,000rpm, carefully draws upper strata water and proceeds to another new 1.5mL centrifuge tube;

8) add the Virahol (0.5 volume Trizol) of 0.5mL, mix gently; Room temperature leaves standstill 10 minutes;

9) 4 DEG C, centrifugal 10 minutes of 12,000rpm, RNA is sunken to the pipe end;

10) abandon supernatant, add the ethanol (precooling) of 1mL75%, softly put upside down washing precipitation;

11) 4 DEG C, centrifugal 5 minutes of 7500rpm;

12) carefully abandon supernatant, drying at room temperature 10 minutes;

13) appropriate DEPC processed ultrapure water dissolves, 55-60 DEG C of incubation 5 minutes,

14) packing ,-80 DEG C of storages;

15) detect RNA concentration and quality with ultraviolet spectrophotometry and 1% agarose gel electrophoresis.

3.3.1.4Tail-PCR

T-DNA on position in pKgcsp1, the pKgcsp2 of TAIL-PCR amplification JM4 and pKgc0c2 sudden change word bank, taking AD1 as degenerate primer, the article of delivering with reference to (2001) such as Mullins, the sequence on amplification border, T-DNA left and right.

TAIL-PCR the primer is as follows:

AD1	WAGTGNAGWANCANAGA
		RB1	GGCACTGGCCGTCGTTTTACAACG
RB2	AACGTCGTGACTGGGAAAACCCTG
		RB3	CCCTTCCCAACAGTTGCGCAG
LB1	AGGGTTCCTATAGGGTTTCGCTCATG
		LB2	CATGTGTTGAGCATATAAGAAACCCT
LB3	CGAATTAATTCGGCGTTAATTCAGT

3.3.1.5 sequential analysis

The sequence on the border, T-DNA left and right to amplification is carried out sequencing analysis.

3.3.1.6 fluorescent microscope detects muton

1) solid PPDA cultivates:

2) mycelia that each muton grows on solid PPDA that takes a morsel, is scattered in aseptic ultrapure water.

3) draw mycelia liquid on slide glass, covered, the accumulation situation of Gfp fluorescin in fluorescence microscopy Microscopic observation mycelia.

3.3.1.6Southern blot analyzes

With reference to DIG High Prime DNA Labeling and Detection Starter Kit I.

3.3.2csp1 with the prokaryotic expression of csp2 gene

3.3.2.1PCR amplification csp1 and csp2 gene

Amplification csp1 full-length gene; Csp2 forward primer is to start design from the 91st base of this gene, is BamH I restriction endonuclease sites since the 94th base, so the albumen that prokaryotic expression obtains is 31 amino acid whose scsp2 that lacked N end.PCR product glue reclaims purifying.

Table 2: the primer of amplification csp1 full-length gene and csp2 part

Taking csp1 gene as template, taking the BamH I-csp1-F of the amplification csp1 full-length gene shown in table 2 and Hind III-csp1-R as primer, amplification obtains csp1 full-length gene.

Taking csp2 gene as template, taking the BamH I-csp2-F of the amplification csp2 shown in table 2 and Hind III-csp2-R as primer, amplification obtains csp2 fragment.

3.3.2.2 double digestion object fragment

With BamH and Hind III double digestion csp1 full-length gene and carrier pET-28a respectively.

With BamH and Hind III double digestion csp2 fragment and carrier pET-28a respectively.

By following system application of sample, flick tube wall reactant is mixed, 37 DEG C of incubations 1 hour.Get 3 μ L enzymes and cut product and carry out electrophoresis, whether check enzyme to cut whole, remaining enzyme and cut product glue and reclaim after purifying, directly use or-20 DEG C save backup.

3.3.1.3 connect

16 DEG C or room temperature connect 2 hours.

3.3.2.4 transform: proceed in DH5 α competent cell by standard program

3.3.2.5 bacterium colony PCR detects: program PCR detects routinely.

3.3.2.6 enzyme is cut qualification: program routinely, thus make, in csp1 full-length gene insertion vector pET-28a, to obtain plasmid pET-28a-csp1.Thereby make, in csp2 fragment insertion vector pET-28a, to obtain plasmid pET-28a-csp2.

3.3.2.7csp1 and the prokaryotic expression of csp2 gene

Correct pET-28a-csp1 and pET-28a-csp2 plasmid proceed to the competent cell of Transetta (DE3) or Bl21 (DE3) routinely, are coated on corresponding resistant panel.Picking mono-clonal shakes bacterium and IPTG abduction delivering.

IPTG induction prokaryotic expression process is as follows:

1) 2 Transetta of picking (DE3) or Bl21 (DE3) bacterium colony from each flat board, containing 50 μ g/mLKan and 34 μ g/mL cam liquid LB in cultivate (bacterium of Bl21 (DE3) is without cam resistance), 37 DEG C, 180rpm spends the night.

2) spend the night bacterium respectively with in the liquid LB triangular flask being inoculated into containing corresponding resistant at 1: 100,37 DEG C, 180rpm, 3 hours.In the time that OD reaches 0.6 left and right, get respectively 1mL bacterium for contrast.The remaining final concentration that adds is the IPTG of 1mM, and 37 DEG C, 180rpm cultivates 4 hours.

3) get respectively 1mL bacterium, centrifugal, collect cleer and peaceful precipitation.

4) induce bacterium and do not induce bacterium to add respectively 2 × loading buffer of 30 μ L, mixing and boil 5min.

5) prepare SDS-PAGE glue, loading, electrophoresis.

6), after electrophoresis, dye, decolour, take pictures.

3.3.3Csp1 prepare with the antibody of Csp2 albumen

3.3.3.1 a large amount of abduction delivering Csp1 and Csp2 albumen

1) inoculation: respectively the access of the expression bacterium 5mL mother liquor of two genes is contained in the 600mL liquid LB of corresponding resistant, 37 DEG C, 180rpm shakes 3 hours.

2) induction: add IPTG to final concentration be 1mM, induce 5 hours.

3) detect: from the large bottle of 600mL, get the 1ml expression of testing.

4) receive in a large number bacterium: bacterium precooling (ice-water bath or put 4 DEG C) was poured 50mL centrifuge tube into after 10 minutes, centrifugal 15 minutes of 4000rpm, 4 DEG C, collect thalline.

5) washing: the thalline of collection is dissolved in the physiological saline of 30mL (0.85%), mixes centrifugal 5 minutes of 8500rpm.

3.3.3.2 inclusion body washing

1) fragmentation: add the super broken damping fluid of 17mL (1/3 bacteria liquid amass) in the thalline of collecting, mix, ultrasonication 40 minutes (break 7 seconds, stop 5s second).4 DEG C, centrifugal 10 minutes of 9000rpm, retains supernatant.

2) washing I: with the resuspended thalline of 10mL washing lotion I, 4 DEG C, centrifugal 10 minutes of 5000rpm.Can wash 3-4 time, stay supernatant for SDS-PAGE gel electrophoresis at every turn.Solution can be placed in or 4 DEG C on ice.

3) washing II: II washes 3-4 time by 10mL washing lotion, leaves supernatant at every turn, for SDS-PAGE electrophoresis.Solution can be placed in or 4 DEG C on ice.

4) resolution of precipitate: precipitation is dissolved into 1mL with solubilization of inclusion bodies liquid.

5) detect: the solution of each several part is got to 20 μ L, and after processing, SDS-PAGE glue detects.

3.3.3.3 albumen is cut glue recovery

Inspection object band is at which Guan Zhonghou, and just SDS-PAGE electrophoresis in a large number, dyes, and decolours.Cut object band, grind.Albumin glue after grinding adds albumen vat liquor, and 4 DEG C are spent the night.

3.3.2.4 lixiviate processing

1) 4 DEG C, the centrifugal vat liquor of 9000rpm 30 minutes.Supernatant is poured in 50mL test tube, and precipitation can continue lixiviate.

2) 4 times of acetone precipitations for supernatant, are placed in-20 DEG C or-80 DEG C of refrigerators and precipitate 2 hours, preferably spend the night.

3) 4 DEG C, centrifugal 20 minutes of 9000rpm, abandons propionic acid.Appropriate super broken damping fluid or Buffer D soluble protein for precipitation.

4) purity of protein inspection and sample presentation Dispersal risk.

3.3.4Western blot detects Csp1 and Csp2 albumen in JM4 transformant

3.3.4.1ELISA detecting the primary antibodie of Csp1 and Csp2 albumen tires

1) antigen is pre-coated: with coated damping fluid, by antigen diluent (preliminary experiment is determined), every hole adds 100 μ L coating buffers, places 60 minutes for 37 DEG C, and 4 DEG C are spent the night.

Note: Csp1, the concentration of Csp2 purifying protein stoste is about 5 μ g/ μ L, is diluted to respectively 1ug/100 μ L and 0.5ug/100 μ L with coated damping fluid.The 10th hole is that antigen does negative control with 1 μ g/100 μ L BSA.Two concentration gradients of each antigen design.

2) washing: abandon the liquid in orifice plate, add PBST washing 3 times, each 2-3 minute finally pats dry as far as possible.

3) sealing: every hole adds confining liquid 200 μ L, 15 minutes (or 60 minutes) of room temperature sealing, wash 3 times.

4) dilution antibody: serum to be checked is diluted with PBS, be respectively 1/50,1/100,1/500,1/1000,1/2000,1/3000,1/4000,1/6000,1/12000, every hole adds 100 μ L.The 10th hole is that antigen does negative control with BSA, and primary antibodie concentration used is 1/500.11st, 12 holes are blank (2 holes, not increase serum).

5) add primary antibodie.Place 35-60 minute for 37 DEG C, or 4 DEG C are spent the night.PBST washes 3 times.

6) adding two resists.Every hole adds enzyme labelled antibody HRP-goat-anti and exempts from two anti-100 μ L, places 30-60 minute for 37 DEG C.

7) PBST washing 4 times, pats dry.Do not pat dry and have false positive.

8) EL-OPD colour developing.Every hole adds substrate 100 μ L, and room temperature lucifuge colour developing 10 minutes, adds stop buffer 50 μ L.

9) microplate reader evaluation.

3.3.4.2JM4 the total protein of Cordyceps militaris (L.) Link. and transformant thereof extracts

The mycoprotein extraction agent box specification sheets rich with reference to shellfish operates.

1) collect appropriate pupa aweto bacterium ball, aseptic washing 2 times, centrifugal 5 minutes of 4 DEG C, 8000rpm.Precipitation is placed in-80 DEG C of refrigerators and preserves or directly extract albumen.

2) get 100mg JM4 and transform daughter bacteria ball and be placed in the mortar of precooling, add liquid nitrogen to keep tissue in freezing state, as soon as possible bacterium ball is ground into powder with grinding mallet.

3) add the solution A 500 μ L (adding in advance 4 μ L protease inhibitor cocktails and 2 μ L protein stabilisers) in test kit, continue to grind.

4) sample is drawn onto in 1.5mL centrifuge tube, places 2 hours or spend the night for 4 DEG C.

5) 4 DEG C, centrifugal 2 minutes of 12,500rpm, abandons precipitation.

6) get 60 μ L supernatants, add 2 × sample-loading buffer boiling water bath 10 minutes.

7) SDS-PAGE electrophoresis.

Note: all add 10uL1M DTT in each step test, add proteinase inhibitor in the time that protein dissolves.

3.3.4.3 cma staining

Solution required in this operating process is now with the current, and step is as follows:

1) fixing: the gel taking out is put into the dish that is added with stationary liquid, and room temperature is shaken 15 minutes gently, change stationary liquid again room temperature shake 15 minutes gently;

2) sensitization: the stationary liquid of pouring out in dish adds sensitizing solution in the mild shake of room temperature 30 minutes;

3) rinsing: pour out sensitizing solution in dish, with 250mL distilled water cleaning 3 times, all at room temperature shake gently 5 minutes at every turn;

4) silver dyes: pour out distilled water in dish and add silver-colored dye liquor, mild shake 20 minutes under room temperature;

5) rinsing: pour out silver-colored dye liquor in dish, 250mL distilled water cleans 2 times, all at room temperature shakes gently 1 minute at every turn;

6) colour developing: pour out distilled water in dish and add nitrite ion, under room temperature, mild shake is seen band to knowing;

7) stop: pour out nitrite ion and add stop buffer, room temperature is shaken 10 minutes gently;

8) rinsing: pour out stop buffer, add 250mL distilled water and clean 3 times, the mild shake of each room temperature 5 minutes.Now just can carry out imaging to gel.

3.3.4.4SDS-PAGE electrophoresis

1) clean sheet glass: dip in a liquid detergent and cleaned gently, rear with tap water flushing, airing.

2) encapsulating and loading: with reference to molecular cloning experiment guide (Pehanorm Brooker etc., 2002)

3) electrophoresis: electrophoresis has just been run out of and can have been stopped electrophoresis to bromjophenol blue, carries out transferring film

The transferring film 3.3.4.5 slot type wets

1) glue is dipped in transfering buffering liquid to balance 10 minutes.Attention: as detected small molecular protein, can omit this step, because small molecular protein easily spreads plastic emitting.

2) according to film of big or small clip and 6 filter paper of glue, put into transfering buffering liquid balance 10 minutes.Pvdf membrane need first soak 3-5 second with pure methyl alcohol.

3) sandwich is shifted in assembling in order: sponge, 3 metafiltration paper, glue, pvdf membrane, 3 metafiltration paper, sponge, every layer put well after, with the glass rod bubble of rushing.Make sure to keep in mind: glue is near negative pole face (black side).

4) transfer groove is placed in to ice bath, puts into sandwich (black side is to black side).Add transfering buffering liquid, plug electrode, 100V, 57 minutes (electric current is about 0.3A).Attention: should again check whether sandwich and electrode assemble correctly, and whether power supply is connected.

5) after transferring film finishes, cut off the electricity supply, take out Hybond membrane

3.3.4.6 immuning hybridization and colour developing

1) 25mLTBS washes Hybond membrane 5 minutes, room temperature shake.

2) abandon TBST, put film in 25mL skimmed milk sealing damping fluid 1 hour, room temperature is shaken gently.

3) abandon confining liquid, 15mL TBST washes (5 minutes/time) 3 times, and room temperature is shaken gently.

4) abandon TBST, (primary antibodie of Csp1 is 1: 4000 to add suitable dilution primary antibodie; The primary antibodie of Csp2 is 1: 1000), within incubated at room 1-2 hour or 4 DEG C, spend the night, slowly shake.

5) abandon primary antibodie, 15mL TBST washes (5 minutes/time) 3 times, room temperature shake.

6) abandon TBST, add two of suitable dilution alkaline phosphatase (AP) (1: 3000) mark to resist, incubated at room 1h, slowly shake.

7) abandon two and resist, 15mL TBST washes (5 minutes/time) 3 times.

8) 15mL TBST washes 1 time.

9) BCIP colour developing, distilled water termination reaction is put in lucifuge colour developing when there is band.

10) take pictures.

3.3.5 the greater wax moth larva of transformant infects

3.3.5.1PPDA solid medium preparation

Peeled potatoes 200g, poach 15 minutes after chopping, decon adds respectively glucose 20g, peptone 10g, KH ₂pO ₄3g, MgSO ₄7H ₂o1.5g, VB0.02g, adds water to 1L.Every liter of solid medium adds 15g agarose.121 DEG C of sterilizings 30 minutes.

3.3.5.2 inoculation

By dull and stereotyped following bacterial strain access: wild-type JM4; Turn No. 2, No. 34, No. 35 of JM4 Cordyceps militaris (L.) Link. of pkg empty carrier; Turn the transformant No. 10, No. 31, No. 41 of csp1; Turn No. 18, No. 29, No. 33 of csp2 transformant; Turn the transformant No. 3, No. 17, No. 21 of c0c2.At 23 DEG C, cultivate 10 days results conidiums.

3.3.5.3 conidium is collected

10mL sterilized water is washed lower conidium from flat board, and three layers of aseptic lens wiping paper filter after 2 times, count with blood counting chamber.The mother liquor that obtains is diluted to different concns with sterilized water, is respectively 2 × 10 ⁷individual/mL, 2 × 10 ⁶individual/mL, 2 × 10 ⁵individual/mL, 2 × 10 ⁴individual/mL, 2 × 10 ³individual/mL.Clear water contrast.

3.3.5.4 greater wax moth larva biological assay

The upper two-layer aseptic filter paper of pad in the culture dish of diameter 9cm, 121 DEG C of moist heat sterilizations 1 hour.Each plate is put 10 greater wax moth end instar larvaes, the bacterium liquid that adds respectively 1mL to dilute.Contrast adds 1mL sterilized water.Each processing repeats 3 times.Plate is put in 23 DEG C of culturing room, and larva is fed food no longer.

3.3.5.5 data analysis

Within every 2 days, record greater wax moth mortality ratio.All percent value, after arcsine transformation, are carried out ONE-WAY variance analysis with SPSS software.Multiple comparisons adopts Duncan method.The same letter of histogram top represents that variance analysis difference is not remarkable, and different letters represent significant difference (P<5%).

3.4 results and analysis

3.4.1 the JM4 sudden change word bank that turns serine hydrolase gene builds

3.4.1.1pKgcsp1, pKgcsp2, pKgc0c2 vector construction

First pcr amplification csp1, csp2, c0 and c2 gene fragment.As seen from Figure 2, the clip size of pcr amplification conforms to expection, and product carries out glue and reclaims purifying.

The c0 and the c2 fragment that reclaim, get respectively 50ng and be mixed into template, is combined into primer pair with the upstream primer of csp1 and the downstream primer of csp2, amplifies c0c2 fragment.The c0c2 clip size of expection is about 2300bp.Fig. 2 shows that the result of PCR is consistent with expection, and glue reclaims c0c2 product.

The purified product of pKHt-gfp plasmid and csp1, csp2, c0c2 carries out respectively (Kpn I and Xba I) double digestion, glue reclaims after purified product, get respectively appropriate carrier and fragment and carry out external connection, transform bacillus coli DH 5 alpha competent cell and be coated on the LB flat board containing kantlex.Bacterium colony longer on flat board is carried out to PCR calibrating, the order-checking of positive colony sample presentation.

1, PCR detects bacillus coli DH 5 alpha/pKgc0c2 bacterium colony

As can be seen from Figure 3, the PCR product size of 4 and 6 swimming lanes is close with c0c2, and the clone of gained may be correct, sample presentation order-checking.

2, PCR detects the bacterium colony of bacillus coli DH 5 alpha/pKgcsp1 and pKgcsp2

Fig. 4 demonstration, the clone 1,5 and 6 of pKgcsp1 in place pcr amplification, to band, may be correct clone, can sample presentation order-checking.The clone of pKgcsp2 is except 7, and other 5 have the band of suitable size, can sample presentation order-checking.

3, the double digestion of pKgcsp1 and pKgcsp2 plasmid (Hind III and kpn I) qualification

Hind III and Kpn I enzyme are cut pKgcsp1 and pKgcsp2 plasmid, can obtain in theory two bands: the fragment of carrier, another comprises the approximately 3.3kb band of gpd and csp1 (or csp2).Show from Fig. 5, swimming lane 1 and 5 has suitable band, illustrates that these two clones may be correct, then sequence verification.

4, double digestion (Hind III and Kpn I) qualification pKgc0c2 plasmid

The expected results of Hind III and Kpn I double digestion pKgc0c2 plasmid should be two bands: one is carrier, and other one comprises gpd and the about 4.4kb band of c0c2 fragment.Shown in Fig. 6, enzyme is cut result and is shown, has correct pKgc0c2 positive colony.

The sample sample presentation order-checking that result is correct.Correct positive colony, will extract corresponding plasmid and transform Agrobacterium AGL-1.

3.4.1.2ATMT method acquisition JM4 turns the transformant of serine hydrolase gene

This experiment utilizes ATMT method, and the element between the border, left and right of several plasmid pKg, pKgcsp1, pKgcsp2, pKgc0c2 is inserted in Cordyceps militaris (L.) Link. JM4 genomic dna.The transformant that this experiment is preserved is as follows: 64 of pKg transformants, 76 of pKgcsp1 transformants, 67 of pKgcsp2 transformants, 63 of pKgc0c2 transformants.

3.4.2 the qualification of transformant

3.4.2.1RT-PCR detect the expression of goal gene in each transformant

Fig. 7 is the extraction of total RNA of wild-type JM4 and several mutons.

Turn in the transformant of pKg empty carrier (pKHt-gfp) and contain Gfp albumen, can be with this gene as selection markers, the about 1000bp of the clip size of lac-gfp; The transformant that turns pKg csp1, pKg csp2 and pKgc0c2 can screen with csp1 and csp2 gene respectively, the about 1100bp of clip size; With the negative contrast of wild-type Cordyceps militaris (L.) Link. JM4.Each transformant extracts total RNA after cultivating, and uses the DNase I processing without RNA enzyme, then reverse transcription cDNA the first chain.Taking cDNA as template, carry out pcr amplification qualification.

As can be seen from Figure 8: in the JM4 muton of 4 pkg, only have 1 there is no signal, other gfp expression amounts of 3 are very high; In the muton of pkgcsp1, have 2 there is no object band, 2 bands a little less than, 3 bands are very strong; 5 mutons of pkgcsp2 all detect csp2 gene, and express all very strong.

As can be seen from Figure 9: in the JM4 muton of 4 pkgc0c2, insert situation with the primer qualification T-DNA of csp1 gene or csp2 gene, the result obtaining is basically identical, 4 have and weak or strong signal detected.1 and 6 is respectively the csp1 of wild-type JM4 and the pcr amplification product of csp2 gene.

3.4.2.2 the Gfp albumen in the each transformant of fluoroscopic examination

As seen from Figure 10, in wild-type JM4, substantially there is no the accumulation of green fluorescent protein, so do not send fluorescence under the effect of exciting light.And positive transgenosis muton can send bright green fluorescence under the exciting of certain wavelength light.

In solid PPDA flat board, cultivate after 10 days, under fluorescent microscope, can see, the situation (Figure 10) of Gfp albumen a large amount of accumulations in transformant mycelia.

3.4.2.3 the sporophore of Cordyceps militaris (L.) Link. muton is cultivated

In sporophore culturing process, all normal mutons of screening mycelial growth, annesl and the differentiation of former base, proceed sporophore and cultivate.What the output of chooser entity and form were close with wild-type Cordyceps militaris (L.) Link. JM4 turn serine hydrolase muton (Figure 11) carries out next step experiment.

3.4.3 the Southern blot of transformant analyzes

3.4.3.1 the extracting genome DNA of muton

The cell walls of fungi is thicker, and secondary metabolite can adsorb with genomic dna, causes the more difficult extraction of DNA.This experiment adopts fungal genomic DNA large scale extracting method, can effectively extract the genomic dna of more complete pupa aweto bacterium ball.

Detect DNA concentration and quality with agarose gel electrophoresis method and ultraviolet spectrophotometry.As shown in figure 12, the quality of genomic dna and concentration are all better, meet the requirement of subsequent experimental.In experiment, find, the Cordyceps militaris (L.) Link. mycelia that solid PPDA cultivates is more difficultly to extract genomic dna complete and that concentration is high, within 7 days, just can extract the measured genomic dna of matter but liquid PPDA cultivates mycelium pellet.Bacterium ball incubation time also can affect extraction effect, general cultivates that to exceed the genomic integrity that the bacterium ball of 10 days extracts not good.

3.4.3.2 probe preparation and susceptibility test

Figure 13 is the PCR purified product of 3 genes.

The method providing according to the DIG High Prime DNA labeling and Detection Starter Kit I of Roche operates.The prepared probe solution of three is diluted to 1ng/L, then gets successively 1ng/L stoste and be diluted to 10pg/L, 3pg/L, 1pg/L, 0.1pg/L, these 5 gradients of 0.3pg/L.Also good by these 5 gradient dilutions the control DNA that in test kit, mark is good.Get the control DNA having diluted and put in order on film, concentration is put from high to low at pvdf membrane from left to right.Put from top to bottom three rows, for three probe gfp, csp1, the detection of csp2.

Probe points film on the identical position of control DNA of getting respectively respective concentration is put in UV-crosslinked instrument crosslinked 3 times.First row is gfp, and second row is csp1, and the 3rd row is csp2.Figure 14 shows, gfp, and csp1, the susceptibility of csp2 probe is fine, can see spot after diluting 300,000 times.In test, can do Southern hybrid experiment with 30000 of probe or 100000 diluents.

3.4.3.3Southern blot detects the insertion situation of goal gene in transformant

Analyze the insertion sequence in each transformant, only hold with a Hind III property processed restriction enzyme site at promotor gpd, the enzyme of genomic dna is cut and can be selected Hind III so.All positive transformants all should be with gfp gene, so the gfp gene of crossing with mark is as probe.According to screening experiment above, select pKgfp transformant 2,34, No. 35; 10,31, No. 41 of pKgcsp1 transformant; The transformant of 18,29, No. 33 of pKgcsp2 transformant and pKgc0c2 carry out Southern blot 3,17, No. 21.

According to the concentration of total DNA, set up the genomic dna endonuclease reaction system of wild-type and transgenosis JM4, each DNA amount of samples is 2-5 μ g.

Figure 15 shows, the swimming lane of wild-type JM4 genomic dna does not have band, illustrates and in wild-type JM4, there is no gfp gene; No. 2 clones of transgenosis pKgfp and No. 10 clones of transgenosis pKgc1 have outside two hybrid belts, and the swimming lane of other transformants all only has a band.Single copy insertion rate that T-DNA is described is about 83%, and multiple copied rate is about 17%, these similar with the result of reporting (Zheng et al., 2011).3.4.4 the flanking sequence analysis of transformant

Each transformant is normal cultivation after 7 days in liquid PPDA substratum, and the bacterium ball of getting about 0.1g cleans 3 times with ultrapure water, centrifugation.After bacterium ball precipitation is freezing rapidly with liquid N, can be kept at-70 DEG C or directly extract genomic dna.The DNA that integrity is good is used for Tail-PCR amplification flanking fragment.Attention: the first round PCR system of 50 μ L adds templet gene group DNA and do not exceed 100 μ g, general consumption is 50 μ g left and right.

The third round product (>500bp) of Tail-PCR amplification carries out glue recovery (Figure 16), and Cloning and sequencing.Correct sequencing result is analyzed.

On NCBI website, 9 flanking sequences that obtain are carried out to BLASTn and BLASTx comparison.Wherein the T-DNA of 33% transformant is the gene inside that is inserted into Cordyceps militaris (L.) Link., as the inside of α-Isosorbide-5-Nitrae-glycan glycogen phosphorylase, monooxygenase, C-8 sterol isomerase.The T-DNA of one of them transformant is inserted into an intron inside of α-Isosorbide-5-Nitrae-glycan glycogen phosphorylase gene; The T-DNA of a transformant is inserted into the 52nd base place of inverse of certain exon of C-8 sterol isomerase; Monooxygenase is interrupted at the 148th base place of inverse of certain exon.These genes are interrupted the growth that does not affect Cordyccps-militaris-(L.)-link. Sporophore.

Having there is pKHt carrier sequence in the flanking sequence of 33% transformant, finds that there is to read over inverted repeat insert this two kinds of phenomenons by comparison.Comparison result finds, 33% survey wing sequence homology is very low or there is no a homology (in table 3).

The T-DNA flanking sequence BLAST comparison result of table 3 part muton

3.4.5 prokaryotic expression Csp1 and Csp2 albumen and antibody preparation

3.4.5.1 serine protease gene Prokaryotic expression vector construction

Utilizing the N terminal sequence of DNAstar software analysis Csp2 albumen is MKLYVILAILPVALAAP.This protein sequence meets the N end principle not being readily expressible: remove outside first methionine(Met), after several amino acid make whole albumen unstable, as K (Lys) L (Leu) Y (Tyr); The hydrophobic structure of N end has also affected the expression of albumen.Csp2 albumen n end sequence mostly is hydrophobic amino acid, as: A, I, L, P, V, F, W, Y.In addition, utilize http://nihserver.mbi.ucla.edu/RACC/ to analyze the base feature of csp2 gene, find that the N of csp2 gene holds with multiple rare codons, can affect its prokaryotic expression.

By analysis, after the 93bp of csp2 gene N end, have a BamH I restriction enzyme site, 93 bases removing above do not affect Dispersal risk (in natural situation, hydrophobic amino acid is to be all embedded in active site of protein, does not produce epitope cluster).Cut several amino acid of csp2 gene N end, just possibility can prokaryotic expression for remaining gene.The csp2 unnamed gene of removing 93 bases of N end is scsp2.

As seen from Figure 17, csp1 and scsp2 (removing 93 bases of N end) difference exact connect ion is in expression vector pET-28a.Can extract respectively plasmid and forward in Transetta (DE3) competent cell, and IPTG abduction delivering.

3.4.5.2 prokaryotic expression Csp1 and Csp2 albumen

Show from the prokaryotic expression result of Figure 18, the target protein that csp1 expresses has great expression in the position of about 50kD.The scsp2 gene that cuts 93bp base also obtains great expression in Transetta (DE3) bacterium, and expressed albumen size is slightly less than csp1's.Transetta (DE3) is the transformation bacterial strain of coming from BL21 (DE3), and it can provide the expression of rare codon, is " omnipotent expression bacterium " substantially.

3.4.5.3 cut in a large number two serine stretch proteins of glue purification

As seen from Figure 19, cutting glue product and having the assorted band of minute quantity in the position of about 200kD of two genes, does not affect as antigen Dispersal risk.With quantitative BSA comparison, the Csp1 protein concentration guestimate of cutting glue purification is 6 μ g/L, and the concentration of the Scsp2 albumen of purifying is approximately 10 μ g/L.The purifying protein obtaining respectively sample presentation 1mL, to Wen Yuange company, is prepared multi-clone rabbit antibody.

3.4.6 the Western blot of transformant detects

3.4.6.1 the whole protein extracting of Cordyceps militaris (L.) Link. JM4

The processing ease of extracting Cordyceps militaris (L.) Link. whole protein, but the albumen obtaining is impure many, easily carries out next step test.In addition, in the transformant of this experiment, add serine hydrolase gene, further impelled the albumen of institute's extracting to be hydrolyzed.Therefore, all to note adding proteinase inhibitor in the whole process of extracting albumen, in case degraded.The protein content that Cordyceps militaris (L.) Link. is extracted is little, examines the result of dying undesirable, so the method that silver dyes dyeing SDS-PAGE glue just can be seen band.In the time carrying out Western blot, applied sample amount will enough just can detect goal gene.Specifically as shown in figure 20.

3.4.6.2ELISE detect tiring of csp1 and csp2 primary antibodie

Test according to ELISE detection method, at colour developing result reading under OD492nm.When the antigen applied sample amount of csp1 is 0.5 μ g, the OD492nm value of 1/6000 primary antibodie diluent reaches 1.228; When the antigen applied sample amount of csp1 is 1 μ g, the OD492nm value of 1/6000 primary antibodie diluent reaches 1.4.

When the antigen applied sample amount of Scsp2 is 0.5 μ g, the OD492nm value of 1/500 primary antibodie diluent reaches 0.773; When Scsp2 antigen applied sample amount is 1 μ g, the OD492nm value of 1/4000 primary antibodie diluent reaches 1.023.

The antibody titer that can find out csp1 from experimental result is very high, very high by the data of 0.5ug/uL antigen gained, and the highly sensitive of this antibody is described.The data that BSA obtains as negative control are lower, illustrate that the single-minded of antibody of csp1 might as well.Can be by the concentration of 1:4000 or 1:6000 in the time being further western blot.

Tiring of scsp2 antibody is more general, but its sensitivity and specificity can meet experiment.Can be by the concentration of 1:500 or 1:1000 in the time being further western blot.Can see from above-mentioned result: the antibodies specific of csp1 is better than scsp2, tire also high.May be because of csp2 cut the declines that cause specificity and sensitivity to have of several amino acid whose reasons.

3.4.6.3csp1 the expression of gene in transgenosis pupa weeds JM4

As seen from Figure 21: the transgenosis JM4 of wild-type JM4 and insertion gfp, without any band, illustrates that these two does not all have Csp1 albumen, has an obvious and unique band and turn gcsp1 with the JM4 muton that turns gc0c2 in the position of 30-40kD.The Csp1 size of prokaryotic expression is the position at about 50kD, in possible Csp1 albumen works in fungi, degraded has occurred.

3.4.6.4csp2 the expression of gene in transgenosis pupa weeds JM4

Western blot detects the expression (Figure 22) of csp2 gene in several transgenosis JM4, and the transgenosis JM4 muton that can see the JM4 of wild-type and insert gfp, without any band, illustrates that these two does not all have Csp2 albumen.There is an obvious and unique band and turn gcsp2 in the position of 30-40kD with the JM4 muton that turns gc0c2.Possible Csp2 is the same with Csp1, and change has occurred in action time.

3.4.7 the greater wax moth infection experiment of transformant

Each genetically modified JM4 transformant is got respectively 3 mutons for greater wax moth infection experiment, and when data analysis, finding does not have difference in 3 of range gene sudden change subgroups.While analysis between group, various transgenosis mutons are just got 1 group of data.Infect as contrast taking water and JM4 wild-type.

3.4.7.1 greater wax moth larva infects the death condition of 7 days

The contrast of water treatment, all greater wax moths all survive.Infect greater wax moth after 7 days various Cordyceps militaris (L.) Link., it is few that the death condition of greater wax moth turns; Wherein 2 × 10 ³all processing of infection level all do not have greater wax moth death condition; Wild-type JM4 and (pKg-34) muton that only turns gfp all do not have significant difference under any spore amount disposition; With the comparison of wild-type JM4, turn serine hydrolase gene (csp1, csp2 or c0c2) muton 2 × 10 ⁷, 2 × 10 ⁶, 2 × 10 ⁵spore level all significantly improves the lethal ability of greater wax moth larva; 2 × 10 ⁷, 2 × 10 ⁶, 2 × 10 ⁵under spore level, the muton that turns csp1, csp2 or c0c2 does not have difference (Figure 23) to the lethal ability of greater wax moth larva.

3.4.7.2 greater wax moth larva infects the death condition of 14 days

Cordyceps militaris (L.) Link. infects greater wax moth after 14 days, 2 × 10 ⁷, 2 × 10 ⁶under spore level, the greater wax moth death condition of various transgenosis Cordyceps militaris (L.) Link. processing reaches maximum dead value substantially; Under any spore amount disposition, wild-type JM4 and the bacterial strain that only turns empty carrier (pKg-34) all do not have significant difference to the lethal ability of greater wax moth larva; 2 × 10 ⁷, 2 × 10 ⁶, 2 × 10 ⁵, 2 × 10 ⁴under spore horizontal processing, with wild-type comparison, turn serine hydrolase transgenation the lethal ability of greater wax moth is all significantly improved; 2 × 10 ⁷, 2 × 10 ⁶under spore horizontal processing, the muton that turns csp1, csp2, c0c2 is had any different to the lethal ability of greater wax moth, but all significantly improves with contrast ratio pathogenecity; 2 × 10 ⁵, 2 × 10 ⁴under spore horizontal processing, the muton that turns csp1, csp2, c0c2 is as broad as long to the lethal ability of greater wax moth.Illustrate that the c0c2 that merges csp1 and two genes of csp2 does not significantly improve the lethal ability (Figure 24) of Cordyceps militaris (L.) Link. to insect.

3.4.7.3 greater wax moth larva infects the death condition of 21 days

Infect greater wax moth after 21 days, except spore concentration is 2 × 10 ⁵outside this group of individual/mL, the greater wax moth death condition of all processing is constant, and the lethal ability of each group does not all have significant difference.

In a word, turn csp1, csp2, c0c2 gene and really can improve Cordyceps militaris (L.) Link. to the lethal ability of greater wax moth.

Claims

1. one kind can be improved the Cordyceps militaris (L.) Link. engineering bacteria of Cordyceps militaris (L.) Link. infection host insect ability, it is characterized in that, it is to turn to have Cordyceps sinensis serine hydrolase gene csp1 or csp2, and can express the Cordyceps militaris (L.) Link. of serine hydrolase Csp1 or Csp2, described serine hydrolase gene csp1, its nucleotide sequence as shown in SEQ ID NO.1, described serine hydrolase gene csp2, its nucleotide sequence is as shown in SEQ ID NO.2.