CN104174016A

CN104174016A - Tuberculosis subunit vaccine containing fusion protein A1D3R1

Info

Publication number: CN104174016A
Application number: CN201410421621.7A
Authority: CN
Inventors: 范雄林; 谭昆
Original assignee: Huazhong University of Science and Technology
Current assignee: Huazhong University of Science and Technology
Priority date: 2014-08-25
Filing date: 2014-08-25
Publication date: 2014-12-03

Abstract

The invention discloses a tuberculosis subunit vaccine containing fusion protein A1D3R1. The tuberculosis subunit vaccine is characterized by containing the fusion protein A1D3R1, wherein the concentration of the tuberculosis subunit vaccine is within 0.1mg/ml to 1mg/ml; the encoding gene of the fusion protein A1D3R1 is formed by connecting genes Rv3407, PhoY2, Ag85A, Rv2626c and RpfB in series according to a sequence of Rv3407, PhoY2, Ag85A, Rv2626c and RpfB. The vaccine adjuvant is characterized in that the vaccine adjuvant is a water-in-oil sample solution which contains 0.4mg/ml to 0.6mg/ml of monophosphoryllipid A, 0.4mg/ml to 0.6mg/ml of mycose, 2v/v% to 8v/v% of squalene oil, 2v/v% to 8v/v% of span-85 and 0.2v/v% to 0.8v/v% of tween-80. The tuberculosis subunit vaccine and the vaccine adjuvant which are provided by the invention are good in immune response effect and low in vaccination risk.

Description

A kind of tuberculosis subunit vaccine containing fusion rotein A1D3R1

Technical field

The invention belongs to biomedicine field, more specifically, relate to a kind of tuberculosis subunit vaccine containing fusion rotein A1D3R1.

Background technology

As the unique prevention of current global range vaccine lungy, bacillus calmette-guerin vaccine (BCG) can effectively prevent the generation of infant millet appearance tuberculosis and tuberculous meningitis; But, for preventing the generation of adult pulmonary tuberculosis disease, the effect of development is limited.Therefore, be badly in need of the enhancing vaccine after a kind of suitable BCG of development just exempts from, to improve it to the preventive effect lungy of being grown up.

With the exception of this, BCG is not suitable for the crowd of hypoimmunity, as the immunodeficiency crowds such as HIV infection inoculate after BCG, causes on the contrary the rising of mortality rate; After BCG just exempts from, injection, strengthens immune effect limited again, recommends clinically only immunity once.Therefore, tuberculosis subunit vaccine, because of definite ingredients, safety and stability, is convenient to produce, in widespread attention in tuberculosis vaccine development.But still there is the undesirable problem of immunne response effect in known tuberculosis subunit vaccine at present.

Summary of the invention

Above defect or Improvement requirement for prior art, the invention provides a kind of tuberculosis subunit vaccine containing fusion rotein A1D3R1, its object is by selecting antigen gene and fusion sequence to produce fusion rotein, coordinate vaccine adjuvant provided by the invention, solve thus existing tuberculosis vaccine, there is inoculation risk, the technical problem that immunne response effect is undesirable.

For achieving the above object, according to one aspect of the present invention, a kind of tuberculosis subunit vaccine is provided, contain fusion rotein A1D3R1, its concentration is 0.1mg/ml to 1mg/ml, and described its encoding gene of fusion rotein A1D3R1 is that Rv3407, PhoY2, Ag85A, Rv2626c and RpfB gene are according to the order series connection of Rv3407-PhoY2-Ag85A-Rv2626c-RpfB.

Preferably, described tuberculosis subunit vaccine, the sequence of its fusion rotein A1D3R1 is:

(1) protein being formed by the aminoacid sequence shown in SEQ ID No.1; Or

(2) amino acid sequence homology limiting with sequence SEQ ID No.1 is at the aminoacid sequence of 80% to 100% coding identical function protein; Or

(3) aminoacid sequence shown in SEQ ID No.1 through increase, lack or replace one or more aminoacid have same isoreactivity by (1) derivative albumen.

Preferably, described tuberculosis subunit vaccine, also contain the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, the Squalene of the trehalose of 0.2mg/ml to 0.3mg/ml, volume fraction 1% to 4% is oily, the sorbester p37 of volume fraction 1% to 4% and the tween 80 of volume fraction 0.1% to 0.4%, described tuberculosis subunit vaccine is Water-In-Oil sample solution.

Preferably, described tuberculosis subunit vaccine, described in it, trehalose is 6,6 '-bis-mycolic acidss.

According to another aspect of the present invention, a kind of vaccine adjuvant is provided, described vaccine adjuvant is Water-In-Oil sample solution, the Squalene oil of the monophosphoryl lipid A that contains 0.4mg/ml to 0.6mg/ml, the trehalose of 0.4mg/ml to 0.6mg/ml, volume fraction 2% to 8%, the tween 80 of the sorbester p37 of volume fraction 2% to 8% and volume fraction 0.2% to 0.8%.

Preferably, described vaccine adjuvant, described in it, trehalose is 6,6 '-bis-mycolic acidss.

In general, the above technical scheme of conceiving by the present invention compared with prior art, can obtain following beneficial effect:

1. cellular immunization is antituberculotic important composition, and wherein the effect of CD4+Th1 type cellullar immunologic response is particularly important.The IFN-γ level producing with fusion rotein A1D3R1 stimulation crowd in a present invention subfraction albumen stimulates separately rear generation level to significantly improve, and level is significantly higher than not infection population in infection population, confirm that the fusion rotein A1D3R1 that tuberculosis subunit vaccine provided by the invention is used is a kind of good Th1 type antigen, there is good immunne response effect;

2. subunit vaccine provided by the invention,, there is not pathogenic ability in the fusion rotein A1D3R1 that it produces immunne response effect, and therefore with respect to existing tuberculosis vaccine, subunit vaccine inoculation risk provided by the invention reduces greatly.

3. immunological adjuvant provided by the invention can be induced to produce and significantly be take IFN-γ and TNF-α as main Th1 type cellullar immunologic response, strengthens vaccine effect; Meanwhile, the monophosphoryl lipid A comprising, trehalose are that the constituents such as 6,6 '-bis-mycolic acidss and Squalene have been applied to human body, safe, cheap and prepare easy.

Accompanying drawing explanation

Fig. 1 is that the Western-blotting of embodiment 2 fusion rotein A1D3R1 and each subfraction protein purification product identifies;

Fig. 2 is that embodiment 9 compares fusion rotein A1D3R1 and subfraction albumen stimulates respectively M.tb infection population (rCM-WBIA-positive) and the M.tb IFN-γ level that infection population (rCM-WBIA-negative) does not produce;

Fig. 3 is specific antibody level in embodiment 10 subunit vaccine A1D3R1/MTO immune serums;

Fig. 4 is the level of embodiment 10 subunit vaccine A1D3R1/MTO immune mouse spleen cell secretion A1D3R1 specific cell factor TNF-α and IFN-γ;

Fig. 5 is the total IFN-γ of embodiment 10 subunit vaccine A1D3R1/MTO immune mouse spleen antigenic specificity secretion-type T lymphocyte;

Fig. 6 is the anti-M.tb H37Rv of embodiment 11 subunit vaccine A1D3R1/MTO immune mouse standard strain internal organs lotus bacterium amount after tail Intravenous Infection;

Fig. 7 is embodiment 11M.tb H37Rv infecting mouse lungs pathology figure.

The specific embodiment

In order to make object of the present invention, technical scheme and advantage clearer, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein, only in order to explain the present invention, is not intended to limit the present invention.In addition,, in each embodiment of described the present invention, involved technical characterictic just can not combine mutually as long as do not form each other conflict.

Tuberculosis subunit vaccine provided by the invention, it is characterized in that, contain fusion rotein A1D3R1, its concentration is 0.1mg/ml to 1mg/ml, also containing the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, the Squalene of the trehalose of 0.2mg/ml to 0.3mg/ml, volume fraction 2% to 8% is oily, the sorbester p37 (Span 85) of volume fraction 2% to 8% and the tween 80 of volume fraction 0.2% to 0.8%, is Water-In-Oil sample solution.Described its encoding gene of fusion rotein A1D3R1 is that Rv3407, PhoY2, Ag85A, Rv2626c and RpfB gene are according to the order series connection of Rv3407-PhoY2-Ag85A-Rv2626c-RpfB.Described trehalose is 6,6 '-bis-mycolic acidss of synthetic.

The sequence of described fusion rotein A1D3R1 is:

(1) protein being formed by the aminoacid sequence shown in SEQ ID No.1; Or

Vaccine adjuvant provided by the invention, called after MTO, described vaccine adjuvant is Water-In-Oil sample solution, the Squalene oil of the monophosphoryl lipid A that contains 0.4mg/ml to 0.6mg/ml, the trehalose of 0.4mg/ml to 0.6mg/ml, volume fraction 2% to 8%, the sorbester p37 (Span 85) of volume fraction 2% to 8% and the tween 80 (Tween-80) of volume fraction 0.2% to 0.8%.Described trehalose is 6,6 '-bis-mycolic acidss of synthetic.

M.tb can be divided into the different phases such as primary infection, latent infection and former postoperative infection in infecting human body process, and the gene profile of its metabolism and transcriptional expression also has phase specificity.M.tb, after respiratory tract primary infection body, can suppress phagosome maturation and autophagy (autophagy), apoptosis (apoptosis), to escape body anti-infective innate immune response; Stop DC cell migration to carry out angtigen presentation to regional nodes, (be mainly CD4 thereby delay adaptive immune response simultaneously ⁺th1 cellullar immunologic response), make M.tb massive duplication set up primary infection in vivo.In the primary infection stage, the gene that represents that in body, M.tb expresses is VII type excretory system (ESX-1) and Ag85 complex etc.Once DC cell arrives regional nodes, can sensitization CD4 ⁺th1 cell also makes its infection focus of going back to the nest, and by cytokine activated macrophages such as secretion of gamma-IFN and engulf and kill and wound antibacterial, raises more macrophages infiltration simultaneously and forms granuloma at infection site, forms latent infection.The anaerobic state of in-vitro simulated latent infection, discloses M.tb and is regulated and controled by dormancy regulator gene DosR at latency stage, encodes and expresses 48 genes, comprises HspX, Rv2623 and Rv2626c etc.In addition, there are the regulation and control of the M.tb metabolism in some genes participation latent infection stages, as PhoY2, Rv3407 and Rv2660 etc.In situations such as immunity degradation (particularly concurrent infection HIV), old, diabetes, organ transplantation, auxotrophy and use immunosuppressant, antibacterial in latency in LTBI body may be activated again, form autogenous infection, and then develop into activeness TB patient.In this stage, the Rpf gene of M.tb and Rip A are the key factors that participates in reactivation.Particularly importantly, after BCG immunity to a little less than the characteristic antigen in M.tb latent infection stage or nonreply.This is also to cause BCG to one of latent infection and the poor major reason of adult T B protectiveness.But in the albumen that these different phase characteristics are expressed, which it be unclear that is important protective antigen, is suitable for the development of TB vaccine actually.

Therefore, we first Prokaryotic expression, purification the interim a series of antigens of expressing of M.tb, from these antigens, through whole blood interferon, discharge analytical technology (WBIA), screening can be by the antigen of the T cell recognition of Chinese M.tb infection population.Due to Chinese population more than 99% all by BCG immunity inoculation mistake, BCG immunity can affect the result that whole blood interferon discharges analysis.In our early-stage Study, set up a kind of whole blood interferon based on the distinctive RD2 of M.tb district PROTEIN C FP21 and MPT64 and discharged analytical technology detection method (rCM-WBIA), because RD2 district lacks in BCG strain in China, its specificity is not subject to the impact of BCG strain in China on Chinese population immunity.Based on to health infection population, two kinds of crowds' of tuberculosis infection crowd (comprising latent infection crowd and tuberculosis patient) clinical diagnosis result not, associating rCM-WBIA checks technology, can get rid of the impact of BCG immunity on two kinds of crowds.Collection M.tb infection population and not the periphery whole blood of infection population, tested detection and compared the IFN-γ level producing after two kinds of crowd's peripheral bloods of M.tb different phase antigenic stimulus by WBIA.In the present invention, filter out M.tb and infect the specific target antigen of expressing in different phase after body, include fast breeding phase secretion antigen Ag85A, incubation period related antigen Rv2626c, PhoY2, Rv3407 and recovery related antigen RpfB, all can inductive infection crowd produce high-caliber IFN-γ, all can be identified by the T cell of Chinese M.tb infection population, be the effective candidate antigens that can targeting prevents Chinese M.tb infection population.These antigens that we filter out, part was confirmed by former institute, as: Ag85A comes from the middle molecular weight protein that a molecular weight of Ag85 complex is 32kDa, in M.tb, BCG and other mycobacteria, all there is this albumen, in mycobacteria cell wall structure forming process, play a significant role, there is stronger immunogenicity simultaneously.In the vaccine of the different carriers such as the adenovirus that enters clinical trial that the Ag85A of take builds as target antigen, poxvirus; all confirm that Ag85A can induce strong cellular immunization and humoral immunity level at human body, and the protection effect of significant anti-M.tb infection can be provided for immune animal.Although Rv3407 is present in the genome of BCG, expression during In vitro culture is extremely low, and its function may regulate relevant to the metabolism of M.tb latent infection.Mollenkopf strengthens immunity by just exempt from-DNA vaccination of BCG and confirms that Rv3407 can produce high-caliber specificity IFN-γ by inducing mouse, and has strengthened the protection effect of BCG induction.By anoxia and low concentration of NO induction M.tb, enter latency, cause 48 gene expressions to be raised, and controlled by DosR, thereby DosR is considered to relevant to the latency of M.tb.Rv2626c belongs to one of gene of DosR regulation and control.By animal model and different crowd test, the immunogenicity of DosR encoding proteins and the important regulative in latent infection thereof have all been confirmed; In latent infection crowd, confirmed that in addition DosR part up-regulated gene product can induce body to produce the reaction of high-caliber specific T-cells.Resuscitation-promoting Factor (resuscitation-promoting factor, rpf) be at Micrococcus luteus, find may be relevant to antibacterial reactivation gene, and RpfA-E is five genes that confirm in M.tb with its homology.By finding that in the test of M.tb infection model and BCG immune model RpfB and RpfD are two the strongest antigens of antigenicity wherein; The DNA vaccination that carries RpfB is verified its immunogenicity and protectiveness through mouse model, and result demonstration vaccine can be induced and be produced obvious cellular immunization, but the sick protection of its tuberculosis effect is still weaker than BCG., as the homologous genes of E.coli PhoU, in the metainfective long-term hungry model of M.tb, there is high expressed in PhoY2; And suppress after the expression of PhoY2, in body, holding of resting state stays bacterium to enliven once again, and therefore, PhoY2 is considered to stay bacterium survival in vivo relevant with holding.By us, study discovery, PhoY2 is also an important antigen.

In the present invention, we take these antigens of filtering out is basis, by artificial method for designing, built the fusion rotein A1D3R1 that expresses above-mentioned antigen, and through whole blood interferon, discharge analytical technology and confirmed that the T cell of Chinese M.tb infection population can identify this fusion rotein, its peripheral blood produces the specific IFN-γ of A1D3R1 level, be significantly higher than not infection population, indicated that this fusion rotein has the ability that targeting prevention M.tb infects.

Independent protein immunization is proved to induce and produces enough immunne response; subunit protein vaccine must be combined a kind of and even several adjuvants and be become to assign to improve its immunogenicity; can not only save antigen dose; all right targeted induction T cells with antigenic specificity subgroup (Th1; Th2 or Th17 etc.), thus desirable protectiveness obtained.Therefore need to seek a kind of can induction and produce the adjuvant that strong Th1 type reacts.At present at present conventional adjuvant form has: aluminum salt, water-in-oil emulsion, immunostimulation complex and TLR part etc., and wherein aluminium porcelain enamelling, MF59, AS03, AS04 and liposome are five kinds and have obtained approval and be applied to clinical adjuvant; In addition still there is other multiple adjuvant to confirm in animal body its safety and efficacy.The adjuvant component that can induce Th1 type cellullar immunologic response as single phosphide lipid A (MPL) be typical TLR-4 agonist, the effective ingredient of WeiGSK company 3 kinds of compound adjuvant AS01, AS02 and AS04.Wherein AS01 is liposome form; AS02 is water in oil form, as the adjuvant of M.tb subunit vaccine M72, has entered 2 phases of clinical trial; AS04 is aluminum salt form, and approved is for the vaccine of the anti-HBV of the mankind and HPV.TDB is M.tb cord factor composition trehalose 6, the synthetic material of 6 '-bis-mycolic acidss (TDM), its receptor is C type agglutinin (Mincle), be the important component that has entered adjuvant CAF01 in the subunit vaccine Hybrid-1 of clinicalⅰstage, can induce the generation of Th1, Th2, Th17 cell and antibody.In addition, the Squalene of take can be induced humoral immunoresponse(HI) as main water in oil form adjuvant MF59 adjuvant, improves the stability in the large of adjuvant and promotes antigen by DCs, processed and offer, and has been approved for the adjuvant composition of commercialization influenza vaccines.

The active ingredient of combining MPL, TDB and MF59 in the present invention, makes novel Water-In-Oil adjuvant MTO, and assisting building subunit vaccine A1D3R1/MTO is to induce the strong reaction of Th1 type and immune protective.Through mouse infection model, confirm that subunit vaccine A1D3R1/MTO can produce the protective effect of the anti-M.tb actute infection that is better than PBS group and independent MTO adjuvant group.And, the antigenicity specific C D4 that in vaccine-induced protective effect and immune mouse body, induction produces ⁺the reaction of Th1 type is closely related.

Be below embodiment:

The design of embodiment 1 fusion gene and primer and synthetic

By NCBI website, obtain the sequence of Rv3407, PhoY2, Ag85A, Rv2626c and RpfB gene, use each sequence restriction enzyme site of DNAman software analysis, for specific site, carry out homeotic mutation, to guarantee that protein transcribes the correctness of translation process.Sequence assembly principle comprises: 1) if having a signal peptide to remove signal peptide, comprise original start codon, remove termination codon simultaneously, add TAA after splicing last complete gene order; 2) gene order of no signal peptide retains initiation codon subsequence.If start codon is GTG, because its original expression product is Met but not Val, in the time of should be using GTG as non-initial code, must also be expressed as Met, therefore GTG need be proofreaied and correct as ATG.The sequence series connection the called after A1D3R1 sequence that comparison are completed according to the order of Rv3407-PhoY2-Ag85A-Rv2626c-RpfB.

This fusion sequence is synthesized by Shanghai Ying Jun biotech firm and is implemented in pDC316 plasmid, errorless through order-checking comparison.Sequencing result part sequence table SEQ ID No.2, its aminoacid sequence is shown in sequence table SEQ ID No.1.

Structure and the protein purification of embodiment 2 fusion protein prokaryotic expression carriers

1, genes of interest obtains:

According to the multiple clone site design primer on the complete sequence of fusion gene and prokaryotic expression carrier pET30b (+), primer sequence is synthetic by Shanghai Ying Jun biotech firm, and according to explanation, primer is diluted to 100pmol/ μ l, and-20 ℃ save backup.Underscore in following primer sequence represents enzyme recognition site.

A1D3R1-Fwd：(Nde?I)-TTC CATATGCGTGCTACCGTTGGGCTTGTGGAGG

A1D3R1-Rev：(Xho?I)-ATC CTCGAGGCGCGCACCCGCTCGTGCAGCAC

Take synthetic gene as template, set up PCR reaction system, the performing PCR of going forward side by side amplification.PCR reaction system is as follows:

1.PCR reaction condition: 98 ℃ 8 seconds; 70 ℃ 20 seconds; 2 ℃ 55 seconds, circulate 35 times; 4 ℃ of insulations.Pcr amplification product is identified through 1% agarose gel electrophoresis, and is reclaimed PCR product.

2, the structure of recombiant plasmid:

The genes of interest A1D3R1 with Nde I and Xho I restriction enzyme site and the empty carrier pET30b (+) that through DNA gel electrophoresis, reclaim are carried out respectively to double digestion, and enzyme action system is:

The genes of interest A1D3R1 fragment reclaiming through enzyme action and carrier pET30b (+) are carried out to coupled reaction according to following condition:

3, the evaluation of conversion and recombinant bacterium

By recombiant plasmid through CaCl ₂proceed to E.coli DH5 α and E.coli BL21 (DE3) with heat shock method, after resistance screening, obtain positive colony.

4, the purification of fusion rotein, evaluation:

According to solubility qualification result, A1D3R1 is present in bacterial body with inclusion body form, therefore with Denaturing purifying protein, and the results are shown in Figure shown in 1 through correction and the activity of Western-blotting checking albumen.The fusion rotein obtaining according to the Ni-NTA of GEHealth company affinity column operation instruction step purification, use Endotoxin Removal Solution test kit to remove remaining endotoxin in prokaryotic expression protein product and, also with the filter filtration sterilization of 0.22 μ m, make described fusion rotein A1D3R1.

From experimental result: due to pET30b (+) C end carry 6 histidine-tagged, and identify and confirm that the former nucleoprotein of A1D3R1 exists with inclusion body form in E.coli body by solubility, therefore thalline ultrasonication liquid is combined with Ni affinity column by after urea-denatured, and completes protein purification under Denaturing.Protein purification process is carried out confirming after SDS-PAGE electrophoresis, and A1D3R1 protein expression and size are about 121kDa, conform to expection.Fusion rotein A1D3R1 and each subfraction albumen are carried out to SDS-PAGE electrophoresis simultaneously, confirm that each albumen size meets expection, only the existence form of Rv3407 albumen is polymer and dimer.After transferring film, with the anti-A1D3R1 specific serum (anti-A1D3R1sera) that anti-His Tag mouse monoclonal antibody or A1D3R1 associating incomplete Freund's adjuvant injection mice obtain, carry out Western-blotting, confirm respectively the specificity of fusion rotein A1D3R1, confirmed all successful expression there is biological activity in fusion rotein of each subfraction albumen simultaneously.

Embodiment 3

Vaccine adjuvant provided by the invention, is Water-In-Oil sample solution, Squalene oil, the sorbester p37 of volume fraction 2% and the tween 80 of volume fraction 0.2% of the monophosphoryl lipid A that contains 0.4mg/ml, the trehalose of 0.4mg/ml, volume fraction 2%.Described trehalose is 6,6 '-bis-mycolic acidss of synthetic.

Its preparation method is as follows:

Trehalose 6,6 ˊ-bis-mycolic acids (TDB) 0.4mg that accurately take monophosphoryl lipid A (MPL) 0.4mg, synthetic, add in the aseptic PBS of 1ml.Separately add 2% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 2% and 0.2% Tween-80 (v/v), vibration or stirring, after fully mixing, be rendered as uniform Water-In-Oil sample solution, be prepared into described vaccine adjuvant, called after MTO.

Embodiment 4

Vaccine adjuvant provided by the invention, is Water-In-Oil sample solution, Squalene oil, the sorbester p37 of volume fraction 5% and the tween 80 of volume fraction 0.6% of the monophosphoryl lipid A that contains 0.5mg/ml, the trehalose of 0.5mg/ml, volume fraction 3%.Described trehalose is 6,6 '-bis-mycolic acidss of synthetic.

Its preparation method is as follows:

Trehalose 6,6 ˊ-bis-mycolic acids (TDB) 0.5mg that accurately take monophosphoryl lipid A (MPL) 0.5mg, synthetic, add in the aseptic PBS of 1ml.Separately add 3% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 5% and 0.6% Tween-80 (v/v), vibration or stirring, after fully mixing, be rendered as uniform Water-In-Oil sample solution, be prepared into described vaccine adjuvant, called after MTO.

Embodiment 5

Vaccine adjuvant provided by the invention, is Water-In-Oil sample solution, Squalene oil, the sorbester p37 of volume fraction 8% and the tween 80 of volume fraction 0.8% of the monophosphoryl lipid A that contains 0.6mg/ml, the trehalose of 0.6mg/ml, volume fraction 8%.Described trehalose is 6,6 '-bis-mycolic acidss of synthetic.

Its preparation method is as follows:

Trehalose 6,6 ˊ-bis-mycolic acids (TDB) 0.6mg that accurately take monophosphoryl lipid A (MPL) 0.6mg, synthetic, add in the aseptic PBS of 1ml.Separately add 8% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 8% and 0.8% Tween-80 (v/v), vibration or stirring, after fully mixing, be rendered as uniform Water-In-Oil sample solution, be prepared into described vaccine adjuvant, called after MTO.

Embodiment 6

A kind of tuberculosis subunit vaccine, it is characterized in that, the fusion rotein A1D3R1 that contains embodiment 2 preparations, its concentration is 0.1mg/ml, also containing the monophosphoryl lipid A of 0.2mg/ml, the Squalene of the trehalose of 0.2mg/ml, volume fraction 1% is oily, the sorbester p37 of volume fraction 1% and the tween 80 of volume fraction 0.1%, is Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw respectively the adjuvant MTO of preparation in fusion rotein solution that 100 μ l concentration are 0.2mg/ml and 100 μ l embodiment 3 in aseptic EP pipe, cover tightly after pipe lid on vortex oscillation device interval concussion 2 to 3 minutes, the uniform emulsion of final formation, is prepared into described tuberculosis subunit vaccine.

Embodiment 7

A kind of tuberculosis subunit vaccine, it is characterized in that, the fusion rotein A1D3R1 that contains embodiment 2 preparations, its concentration is 0.5mg/ml, also containing the monophosphoryl lipid A of 0.25mg/ml, the Squalene of the trehalose of 0.25mg/ml, volume fraction 1.5% is oily, the sorbester p37 of volume fraction 2.5% and the tween 80 of volume fraction 0.3%, is Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw respectively the adjuvant MTO of preparation in fusion rotein solution that 100 μ l concentration are 1mg/ml and 100 μ l embodiment 4 in aseptic EP pipe, cover tightly after pipe lid on vortex oscillation device interval concussion 2 to 3 minutes, the uniform emulsion of final formation, is prepared into described tuberculosis subunit vaccine.

Embodiment 8

A kind of tuberculosis subunit vaccine, it is characterized in that, the fusion rotein A1D3R1 that contains embodiment 2 preparations, its concentration is 1mg/ml, also containing the monophosphoryl lipid A of 0.3mg/ml, the Squalene of the trehalose of 0.3mg/ml, volume fraction 4% is oily, the sorbester p37 of volume fraction 4% and the tween 80 of volume fraction 0.4%, is Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw respectively the adjuvant MTO of preparation in fusion rotein solution that 100 μ l concentration are 2mg/ml and 100 μ l embodiment 5 in aseptic EP pipe, cover tightly after pipe lid on vortex oscillation device interval concussion 2 to 3 minutes, the uniform emulsion of final formation, is prepared into described tuberculosis subunit vaccine.

Embodiment 9

1. the diagnostic criteria of tested crowd's recruitment and M.tb infection population:

This tests selected crowd from the outpatient service crowd of Xinxiang City, Henan Province tuberculosis prevention and treatment institute.Altogether selecting crowd's quantity is 44 examples (the range of age 40.4 ± 17.1, sex ratios 24/20), male's 24 examples (the range of age 36.6 ± 16.9) wherein, women's 20 examples (the range of age 42.8 ± 16.7).The equal informed consent of all persons under inspection is also accepted questionnaire survey (relevant medical history, contact history and cardinal symptom etc.), and all carry out TST, rabat and expectorant smear (or cultivation) and check, do not merge dysimmunity disease and HIV (human immunodeficiency virus) (HIV) simultaneously and infect.

By M.tb the infected of clinical confirmation and infection population not, the diagnostic criteria (specificity IFN-γ concentration 398.5pg/ml) of in earlier stage setting up rCM-WBIA technology with us, is further divided into crowd rCM-WBIA positive and negative.M.tb the infected's (comprising M.tb latent infection crowd and patient) and rCM-WBIA that final selection crowd is clinical confirmation are positive; The M.tb of clinical confirmation is the infected and rCM-WBIA feminine gender not.

2. experimenter's blood collection and stimulation:

Aseptic collection two class crowds' whole blood, anticoagulant heparin, and be inoculated in 24 orifice plates according to the mode in 500 μ l/ holes; Get the albumen of 20 μ l after quantitatively and add respectively in corresponding experimental port, make final concentration reach 5 μ g/ml; RCM and PHA are respectively as positive control, and concentration is 20 μ g/ml; PBS, as negative control, is hatched 18-24h for 37 ℃.Collect supernatant ,-20 ℃ save backup.

3. IFN-γ concentration determination in experimenter's whole blood culture supernatant:

1) the pre-coated ELISA Kit of Human IFN-γ of Shenzhen Dakewe company is selected in this experiment, according to test kit description, measures cytokine concentrations in sample;

2), with after blank well zeroing, adopt dual wavelength to read plate (detecting wavelength 450nm, reference wavelength 630nm) simultaneously;

3) according to OD value, establishing criteria curve can draw experimenter's whole blood IFN-gamma concentration, deducts and is the IFN-γ concentration that the induction of differential stimulus thing produces after negative control hole numerical value.Different stimulated group is calculated respectively median and interquartile range, and uses the nonparametric U method of inspection to carry out statistical analysis.The results are shown in Figure 2.

From experimental result: stimulate and detect IFN-γ level in culture supernatant after crowd's whole blood and find with each subfraction albumen, the IFN-γ level (median) that each albumen produces at rCM Positive Populations moderate stimulation, all apparently higher than Population with Negative, and all there is statistical significance.After fusion rotein A1D3R1 stimulates, rCM-WBIA Positive Populations produces IFN-γ level and also obviously rises, and has compared remarkable statistical significance with Population with Negative.

Embodiment 10 tuberculosis subunit vaccine immunological evaluations

1. the grouping of laboratory animal and immunity

Vaccine adjuvant adopts the vaccine adjuvant MTO of preparation in embodiment 3.

Tuberculosis subunit vaccine (A1D3R1/MTO vaccine) adopts the tuberculosis subunit vaccine of preparation in embodiment 6.

1) laboratory animal grouping:

Select 6 week age, female C57BL/6 mice, SPF level, purchased from Wuhan University's Experimental Animal Center, lot number is No.4200593074.Commodity in use feedstuff and distilled water are fed.

According to experiment needs, laboratory animal is divided into following four groups: negative control group---PBS group; Positive controls---BCG group; Adjuvant matched group---MTO group; Experimental group---A1D3R1/MTO group.Every group 3.Experiment repeats 1 time.

(2) laboratory animal immunity:

All adopt subcutaneous injection mode to carry out immunity, volume injected is 200 μ l, wherein: BCG group volume injected 200 μ l, the bacterium amount containing is 1.67 * 10 ⁶cFU, the fusion rotein content of the actual immunity of A1D3R1/MTO experimental group is 10 μ g.

PBS group, MTO group and BCG group are single immunization, and A1D3R1/MTO experimental group need repeat immunity three times, every minor tick 3 weeks.

2.ELISA detects immune serum specific antibody:

1) mice after immune 9 weeks is collected serum after eyeball is got blood, and frozen in-20 ℃ after subpackage;

2) fusion rotein A1D3R1 is diluted according to working concentration 5 μ g/ml, coated 96 hollow plates of routine are carried out in 100 μ l/ holes;

3) respectively organizing mice serum sample doubly dilutes by 1:400 with the aseptic 1 * PBS after filtering, 200 μ l/ holes add to every row the first hole, every row the second hole to the octal adds respectively 100 μ l PBS, each sample is done multiple hole, then from the first hole, carry out doubling dilution to 1:51200, blank hole adds PBS 100 μ l;

4) the anti-dilution factor of HRP labelling sheep anti mouse two is respectively: IgG1:5000, IgG11:10000, IgG2a1:10000;

5) result treatment: each each sample OD value is deducted after the OD value of blank hole, be averaged OD value with the multiple hole of a blood serum sample.Wherein, with the negative contrast of OD value (N) of PBS negative control group, immune group is sample (P), when blood-serum P/N value >=2.1 can be judged as the positive.Antibody titer represents there is the inverse of the highly diluted multiple of positive findings;

6) result is calculated: each sample result is expressed as log10 (antibody titer), between the multiple hole of each sample, averages and is the actual value of this mice, and calculating mean value and standard error in same group, carry out statistical analysis; IgG2a:IgG1 compares with the antibody titer of every mice, and same group of interior result represents with meansigma methods ± standard error.

Experimental result is shown in Fig. 3.

From experimental result: conform to expected results, do not produce specific antibody and subclass in MTO adjuvant matched group; In A1D3R1/MTO group Mice Body, produce the dissimilar antibody titer of top level, be respectively IgG (1:21333), IgG1 (1:4267), IgG2a (1:12800): all BCG group significantly improves (P<0.05) relatively.The ratio of IgG2a/IgG1 is the not highest in immune serum Ig2a/IgG1 level: A1D3R1/MTO group mice serum more on the same group, is 3.33 ± 0.67; And BCG group ratio is 0.83 ± 0.17.

3.ELISA detects immune mouse spleen cell culture supernatant antigenic specificity cytokine:

1) extracting spleen cell suspension 100 μ l are inoculated in (cell number 2.5 * 10 in 96 orifice plates ⁶);

2) stimulus object is as follows: experimental port fusion rotein A1D3R120 μ l, final concentration 10 μ g/ holes; Positive control hole PPD working solution 20 μ l (10 μ l PPD stock solution+10 μ l RPMI1640 complete medium), final concentration 10 μ g/ holes; Negative control hole RPMI1640 complete medium 20 μ l;

3) cultivate after 72 hours, liquid carry out labelling in collection hole respectively, 2000rpm, centrifugal 10min, collects supernatant and is also sub-packed in EP pipe, frozen stand-by in-80 ℃ after labelling;

4) according to the content of cytokine TNF-α and IFN-γ in Mouse ELISA kit workbook detection supernatant:

5) after cessation reaction in 10min, with the zeroing of blank hole, use microplate reader to read dual wavelength and detect light absorption value: 450nm for detecting wavelength, 630nm is reference wavelength;

6) establishing criteria product hole data drawing standard curve, surveys per sample OD value and records corresponding cytokine concentrations.Every the multiple hole of mice results averaged, deducts after RPMI1640 values of control groups, and same group of interior calculating mean value and standard deviation respectively, carry out statistical analysis.

Experimental result is shown in Fig. 4.

From experimental result: consistent with expection, after immunity 9 weeks, no matter with PPD or A1D3R1, stimulate, PBS matched group is only secreted very low-level TNF-α and IFN-γ, all significantly lower than other experimental group (P<0.05).Meaningfully, MTO matched group is also secreted generation TNF-α and IFN-γ for PPD and A1D3R1, is all significantly higher than PBS group, but still significantly lower than A1D3R1/MTO group (P<0.05).After it should be noted that PPD stimulates, the level that the secretion of BCG group splenocyte produces TNF-α and IFN-γ is all higher than A1D3R1/MTO group (P<0.001); And after A1D3R1 differential stimulus, A1D3R1/MTO component is secreted the TNF-alpha levels of generation and is compared the obviously raising (P<0.001) of BCG group, although A1D3R1/MTO component is secreted the IFN-γ level of generation, compare BCG group and be slightly improved, no difference of science of statistics.

4. the T lymphocyte of intracellular cytokine dyeing and Flow cytometry immune mouse spleen cell antigenic specificity secretion of gamma-IFN:

1) draw the cell suspension 100 μ l adjust concentration and be inoculated in 24 orifice plates, making spleens cell number in every hole is 2.5 * 10 ⁶;

2) specifically to add sample loading mode as follows for different stimulated thing:

Experimental port: every hole adds 20 μ l fusion rotein A1D3R1, final concentration 10 μ g/ holes; Separately add anti-CD28mcAb20 μ l;

Positive control hole: every hole adds 20 μ l PPD working solutions, i.e. 10 μ l PPD stock solution+10 μ l RPMI1640 complete mediums, PPD final concentration 10 μ g/ holes; Separately add anti-CD28mcAb 20 μ l;

Negative control hole: every hole adds RPMI1640 complete medium 20 μ l; Separately add anti-CD28mcAb 20 μ l;

Blank hole: add Cocktail working solution 40 μ l;

Positive experimental port: add Cocktail working solution 40 μ l;

Single mark pipe: add Cocktail working solution 40 μ l;

3) every hole adds 840 μ l RPMI1640 complete mediums, is placed in 37 ℃ and cultivates 16h;

4) add stimulus object to cultivate after 4h, every hole adds blocker Brefeldin A+Monensin mixed liquor 20 μ l;

5) cultivate and to finish rear collection and with pipettor, liquid in hole and cell are moved in streaming pipe, 500 * g, centrifugal 5min, abandons supernatant standby.

6) add pre-configured dyeing liquor, specific as follows:

Experimental port, positive control hole, negative control hole and positive experimental port: every hole adds 0.5 μ l Anti-Mouse CD3FITC, 1.25 μ l APC/Cy7anti-mouse CD4Antibody, 1.25 μ l Anti-Mouse CD8a PE and 97 μ l PBS;

Blank hole: do not add any antibody;

Single mark pipe: surface marker list mark pipe adds respectively corresponding antibodies according to antibody corresponding to every pipe, and cytokine list mark pipe does not add any antibody;

After mix homogeneously, 4 ℃ of lucifuges are hatched 30min;

7) every pipe adds 1 * PBS 2ml to wash away antibody staining liquid, and 4 ℃, the centrifugal 5min of 500 * g, abandons supernatant;

8) repeating step 2;

9) every pipe adds the Intracellular Fixation 100 μ l of pre-cooling, and piping and druming mixes so that fully fixing, and room temperature lucifuge is hatched 30min;

10) every pipe adds 1ml 1 * Permeabilization Buffer, and the centrifugal 5min of 500 * g, abandons supernatant;

11) repeating step 5;

12) through cell fixing and that wear after film, add respectively corresponding cytokine antibodies, concrete mode is as follows:

Experimental port, positive control hole, negative control hole and positive experimental port: every hole adds 1.25 μ l Anti-Mouse IFN-gamma PerCP-Cy5.5,98.25 μ l 1 * Permeabilization Buffer.

Blank hole: do not add any antibody;

Single mark pipe: the corresponding single mark pipe of cytokine adds respectively corresponding antibodies according to antibody corresponding to every pipe, and surface marker list mark pipe does not add any antibody;

After mix homogeneously, room temperature lucifuge is hatched 30min;

13) every pipe adds 1ml 1 * Permeabilization Buffer to wash away antibody staining liquid, and the centrifugal 5min of 500 * g, abandons supernatant;

14) every pipe adds 1ml 1 * PBS to wash away antibody staining liquid and to wear film liquid, and the centrifugal 5min of 500 * g, abandons supernatant;

15) every pipe adds 300 μ l 1 * PBS re-suspended cells, and 4 ℃ keep in Dark Place to be checked;

16) first go up machine-readable each single mark pipe data of getting, according to result, regulate parameter to complete fluorescence associated compensation; Each test all needs to prepare blank hole and positive experimental port to get rid of reagent difference;

17) sorting strategy is: take lymphocyte populations as P1 door, then with CD3+CD4+ and CD3+CD8+ sorting CD4+ and CD8+ cell, analyze respectively secretion of gamma-IFN+percentage of lymphocyte;

18), according to dissimilar T lymphocyte proportion and mouse boosting cell count results in total cell number of upper machine testing, calculate respectively every lymphocytic quantity of mouse spleen cytokine IFN-γ secretion-type T.Every group of data are calculating mean value and standard deviation respectively, uses one factor analysis of variance to not carrying out statistical evaluation between on the same group.

Experimental result is shown in Fig. 5.

From experimental result: BCG group immune mouse spleen cell, after PPD stimulates, IFN-γ+CD4+ or CD8+T cell quantity that induction produces are significantly higher than PBS group (P<0.05).It should be noted that in A1D3R1/MTO immune group mouse spleen that IFN-γ+CD4+ or CD8+T cell number compare PBS group, BCG group and MTO adjuvant group all significantly rise (P<0.05); Yet, IFN-γ+CD4+T cell number and PBS there was no significant difference that adjuvant MTO group produces, CD8+T cell number is significantly higher than PBS group (P<0.05), but all lower than BCG group.After A1D3R1 differential stimulus, similar after BCG group and A1D3R1/MTO group mice result stimulate to PPD; Meanwhile, the specific C D4+ that MTO adjuvant group produces and CD8+T cell number are compared with all significantly risings (P<0.05) of PBS group.

The short-term protectiveness effect assessment of embodiment 11 subunit vaccines

Vaccine adjuvant adopts the vaccine adjuvant MTO of preparation in embodiment 4.

1. the grouping of laboratory animal and immunity:

(1) laboratory animal grouping and immunization ways:

Select 6 week age, female C57BL/6 mice, SPF level, purchased from Wuhan University's Experimental Animal Center, lot number is No.4200593074.Raise in Wuhan University's zoopery center ABSL-3 laboratory, and commodity in use feedstuff and distilled water nursing.All operations all strictly observes Wuhan University's zoopery workbook.

According to experiment needs, laboratory animal is divided into following four groups: negative control group---PBS group; Positive controls---BCG group; Adjuvant matched group---MTO group; Experimental group---A1D3R1/MTO group.Every group 5.

Animal immune method and dosage are the same.

Zoogenetic infection approach: after last immunity 3 weeks, mice infected M.tb H37Rv through tail vein injection mode, and injected dose is 100 μ l, and actual bacterium amount is 1.2 * 10 ⁶cFU.

2. internal organs lotus bacterium component analysis:

1) infect after 4 weeks, eyeball get blood and collect blood after cervical vertebra dislocation put to death mice, and be soaked in and in 75% ethanol, carry out surface sterilization;

2) sterile working obtains mice lungs and spleen, is placed in imaging after aseptic plate;

3) picking internal organs are in 5ml glass homogenizer, add to start to be ground to after the aseptic 1 * PBS of 2ml to form even troubled liquor;

4) by after lapping liquid concussion evenly, draw the aseptic 1 * PBS of 100 μ l to 900 μ l, and carry out according to this doubling dilution to 10-7 gradient;

5) from each gradient dilution liquid, drawing 100 μ l liquid adds in the 7H11 flat board that contains antifungal drug and TCH preparing and carries out labelling;

6) flat board coating being completed is placed in 37 ℃ of incubators, after Liquid Absorption is complete, is inverted and cultivates 3 weeks;

7) after 3 weeks, record each dull and stereotyped upper colony counts.According to dilution factor, convert and obtain the total plate count that each internal organs comprises.The lotus bacterium amount of every mice represents with log10 (CFU), calculates meansigma methods and the standard error of each experimental group, and carry out statistical analysis.

Experimental result is shown in Fig. 6.

From experimental result: be consistent with expection, the lotus bacterium amount of PBS negative control group lungs and spleen is the highest.Although the lotus bacterium amount of MTO group lungs and spleen has slight decline with respect to PBS group, no difference of science of statistics between two groups.Compare with PBS group, the internal organs lotus bacterium amount of A1D3R1/MTO group and BCG group all significantly reduces (P<0.05), wherein: A1D3R1/MTO group lungs lotus bacterium amount is compared PBS group and reduced 0.83Log, and spleen reduces 0.84Log than PBS group.It should be noted that with MTO group and compare, the lungs lotus bacterium amount decline 0.69Log (P<0.05) of A1D3R1/MTO group mice, spleen lotus bacterium amount decline 0.31Log.Explanation thus, A1D3R1/MTO subunit vaccine can effectively suppress M.tb and breed in immune mouse internal organs.

3. lungs histopathology is evaluated:

Each putting to death in mice collection internal organs process, after the superior lobe of left lung of two mices of every group of random clip, be soaked in 10% formalin solution and fix 1 week, through paraffin embedding and section, make respectively HE dyeing and acid-fast stain Pathologic specimen sheet, and observe destruction and the inflammatory cell infiltration situation that lungs are organized inner structure under micro imaging system, and m tuberculosis infection situation.

Experimental result is shown in Fig. 7.

From experimental result: M.tb challenge infection, after 4 weeks, is drawn materials in process for every group, and spleen and lungs surface have no abscess and tuberosity, do not observe obvious general pathology and change.But respectively organize spleen and show slightly enlargement.The lung tissue that every group of lungs of getting two mices carry out histopathology evaluation: PBS group mice be take epithelioid cell, inflammatory cell hypertrophy and is main Tuberculous nodular lesion, and merges in flakes; In local alveolar, there are the exudative inflammatory backgrounds such as the epithelial cell coming off, the inflammatory cell oozing out and pulmonary edema.Tuberculous pathological changes area accounts for 40% of lung tissue.After lung tissue section's acid-fast stain, the acid-fast bacilli of a large amount of agglomerating gatherings of visible PBS group (++～+++).MTO group group is compared PBS group and is slightly alleviated, and pathological tissue accounts for 35% of lung tissue; The acid-fast bacilli being dispersed in a large number as seen in tissue after acid-fast stain (+～++).The A1D3R1/MTO group relative PBS group of pathological change and MTO group alleviate, and take macrophage hypertrophy as main tuberculosis under mirror, and interstitial inflammation is background, and part has exudative inflammation to change, and is dispersed in as seen the lesser tubercle of distribution, and pathological changes area accounts for 30% of lung tissue.The interior accidental a small amount of acid-fast bacilli of tissue after acid-fast stain (a little～+).In four groups, the Pulmonary lesions of BCG group mice is the lightest, rarely seen less tuberculosis tuberosity, and alveolar space is clear, oozes out less, and pathological changes area accounts for 10% of lung tissue.In BCG group lung tissue, have no acid-fast bacilli.

Those skilled in the art will readily understand; the foregoing is only preferred embodiment of the present invention; not in order to limit the present invention, all any modifications of doing within the spirit and principles in the present invention, be equal to and replace and improvement etc., within all should being included in protection scope of the present invention.

Claims

1. a tuberculosis subunit vaccine, it is characterized in that, contain fusion rotein A1D3R1, its concentration is 0.1mg/ml to 1mg/ml, and described its encoding gene of fusion rotein A1D3R1 is that Rv3407, PhoY2, Ag85A, Rv2626c and RpfB gene are according to the order series connection of Rv3407-PhoY2-Ag85A-Rv2626c-RpfB.

2. tuberculosis subunit vaccine as claimed in claim 1, is characterized in that, the sequence of described fusion rotein A1D3R1 is:

(1) protein being formed by the aminoacid sequence shown in SEQ ID No.1; Or

3. tuberculosis subunit vaccine as claimed in claim 1 or 2, it is characterized in that, also contain the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, the Squalene of the trehalose of 0.2mg/ml to 0.3mg/ml, volume fraction 1% to 4% is oily, the sorbester p37 of volume fraction 1% to 4% and the tween 80 of volume fraction 0.1% to 0.4%, described tuberculosis subunit vaccine is Water-In-Oil sample solution.

4. tuberculosis subunit vaccine as claimed in claim 3, is characterized in that, described trehalose is 6,6 '-bis-mycolic acidss.

5. a vaccine adjuvant, it is characterized in that, described vaccine adjuvant is Water-In-Oil sample solution, the Squalene oil of the monophosphoryl lipid A that contains 0.4mg/ml to 0.6mg/ml, the trehalose of 0.4mg/ml to 0.6mg/ml, volume fraction 2% to 8%, the tween 80 of the sorbester p37 of volume fraction 2% to 8% and volume fraction 0.2% to 0.8%.

6. vaccine adjuvant as claimed in claim 5, is characterized in that, described trehalose is 6,6 '-bis-mycolic acidss.