CN104164438B - LOC401296 gene, and its application in regulation of cell cycle and cell growth - Google Patents
LOC401296 gene, and its application in regulation of cell cycle and cell growth Download PDFInfo
- Publication number
- CN104164438B CN104164438B CN201410211150.7A CN201410211150A CN104164438B CN 104164438 B CN104164438 B CN 104164438B CN 201410211150 A CN201410211150 A CN 201410211150A CN 104164438 B CN104164438 B CN 104164438B
- Authority
- CN
- China
- Prior art keywords
- seq
- loc401296
- gene
- cell
- sirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses LOC401296 gene and its application in the regulation of cell cycle and cell growth, and belongs to the technical field of gene engineering. The wide expression of imaginary gene LOC401296 gene in various cell lines is found in the invention. Obvious growth inhibition, apoptosis increase and obvious G2M phase arrest of cells appear after the down-regulation of the gene expression, and further studies show that the LOC401296 gene participates in a cell mitosis process and spindle body formation, and is a new cell cycle regulation molecule. Results obtained in the invention lay a foundation for subsequent function studies.
Description
Technical field
The present invention relates to a kind of LOC401296 gene and corresponding albumen are adjusting the cell cycle, are controlling cell growth etc.
The application of aspect, belongs to gene engineering technology field.
Background technology
The cell that cell cycle is by continuously dividing completes once to divide beginning to when division completes next time
One period, it is considered to be the complete life process of cell, is to maintain cell growth, the basic biological event of propagation.Cell
Cycle is a consecutive variations process, is artificially divided into a phase and division stage according to the needs of research, a phase includes G1 phase, S
Phase, G2 phase, division stage, refers to the M phase, in addition, the cell stopping division being considered at the static G0 phase in cycle.Wherein, the M phase refers to contaminate
Colour solid starts aggegation concentration, nuclear membrane disintegration, inhereditary material are redistributed, the division of mother cell forms one section of two daughter cells
Time, is that cell " is given a birth " stage.Cell cycle process, especially m period are in cell growth, apoptosis generation, tumour
The biological processes such as growth play a significant role, and these biological processes are regulated and controled by several genes.
LOC401296 is the imaginary gene of finding in extensive gene order-checking, 194 ammonia of this gene code total length
The imaginary albumen of base acid, does not have any function report at present to this gene.We have discovered that, LOC401296 gene is multiple
Wide expression in clone, lowers LOC401296 expression using siRNA method and cell can be promoted to occur the G2/M phase to block, draw
Play cell and Mitotic abnomality, inducing cell apoptosis occur.Analysis finds further, lowers LOC401296 gene expression permissible
Spindle is caused to form exception, the suppression various kinds of cell such as HeLa, A549, MCF-7 growth.
Content of the invention
The present invention provides a kind of gene of cell cycle regulation：LOC401296 gene.LOC401296 gene or its correspondence
MRNA or its coding albumen can be used for regulating cell propagation and apoptosis speed, adjust the cell cycle, prepare cancer therapy drug, sieve
Choosing identification cancer therapy drug.
The corresponding cDNA sequence of LOC401296 gene in the present invention is as shown in SEQ ID NO.1.Described LOC401296
The amino acid sequence of the protein of gene code is as shown in SEQ ID NO.6.
" inhibitor " in the present invention can be albumen, RNA or micromolecular compound etc..Preferably, inhibitor is a kind of
Albumen, it is highly preferred that inhibitor is a kind of antibody, this antibody can be in conjunction with LOC401296 DNA encoding the protein, thus suppressing
LOC401296 gene and/or its corresponding mRNA and/or its corresponding protein.Preferably, inhibitor is a kind of RNA, permissible
It is interferential RNA molecule, described interferential RNA molecule can be double-stranded RNA, such as siRNA (short interfering
RNA), miRNA (microinterfering RNA) etc., or single stranded RNA, such as shRNA (short hairpinRNA), it
Can by RNA interference effect cause LOC401296 target gene mRNA degraded (situation of such as siRNA or miRNA) or
The molecule (situation of such as shRNA) with this function can be formed.It is highly preferred that inhibitor is a kind of siRNA, described
The nucleotide sequence of two chains of siRNA respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or as SEQ ID NO.4,
Shown in SEQ ID NO.5.
Cancer in the present invention is including but not limited to oophoroma, cancer of pancreas, lung cancer, non-small cell lung cancer, cellule lung
Cancer, adenocarcinoma of lung, liver cancer, melanoma, retinoblastoma, breast cancer, colon cancer, leukaemia, lymthoma, brain tumor, cervix
Cancer, sarcoma, prostate tumor, bladder knurl, reticuloendothellium knurl, WilmShi knurl, astrocytoma, spongioblastoma, one-tenth nerve
Cytoma, osteosarcoma, kidney or head and neck cancer.Preferably, described cancer is cervix cancer, breast cancer, lung cancer.
The invention provides a kind of method of cell cycle regulation, be by regulate and control the expression of LOC401296 gene or its
The expression of albumen of the expression of corresponding mRNA or its coding and activity.
The present invention also provides a kind of method of regulating cell propagation, is by regulating and controlling the expression of LOC401296 gene or tune
Control LOC401296 gene pairs answers the expression of mRNA or the expression of albumen of regulation and control LOC401296 coding and activity, thus regulating and controlling
Cell proliferation.Further, the invention provides a kind of method of suppression cell proliferation is it is characterised in that be to be pressed down by inhibitor
The expression of albumen of the expression of the expression of LOC401296 gene processed or its corresponding mRNA or its coding and activity, thus suppress
Cell proliferation.
The present invention also provides a kind of method of inhibited apoptosis, be by express or raise LOC401296 gene or its
Corresponding mRNA or the protein active of its coding, thus inhibited apoptosis.
Present invention also offers a kind of method of inducing cell apoptosis, it is that LOC401296 gene is suppressed by inhibitor
Expression or suppression LOC401296 gene pairs answer the expression of mRNA or the expression of albumen of suppression LOC401296 coding and activity.
Present invention also offers a kind of method of identification, screening cancer therapy drug, it is using LOC401296 gene or its correspondence
The protein screening of mRNA or its coding can suppress the thing of the protein active of LOC401296 gene or its corresponding mRNA or its coding
Matter.Preferably, just test agent and cells contacting, detection LOC401296 gene or its corresponding mRNA or its coding further
Albumen, compared with compared with control cells, LOC401296 gene expression dose reduce or its coding protein active reduce when, instruction
Test agent is anticancer or antineoplastic.
Present invention also offers a kind of method preparing cancer therapy drug, it is that anticancer or antineoplastic are prepared using inhibitor
Thing, this inhibitor suppresses LOC401296 gene or the albumen of its corresponding mRNA or its coding.
Present invention also offers a kind of LOC401296 gene and/or its corresponding mRNA sequence and/or its corresponding albumen
Application in inhibited apoptosis for the matter sequence is it is preferable that pass through to raise LOC401296 gene or its corresponding mRNA or its coding
Protein active, thus inhibited apoptosis.
Present invention also offers a kind of LOC401296 gene and/or its corresponding mRNA sequence and/or its corresponding albumen
Matter sequence is being identified and/or is being screened the application in cancer therapy drug, is using LOC401296 gene or its corresponding mRNA or its coding
Protein screening can suppress LOC401296 gene or its corresponding mRNA or its coding protein active material.Preferably, will
By test agent and cells contacting, the albumen of detection LOC401296 gene or its corresponding mRNA or its coding further, and compare
Cell is compared, and when the protein active that LOC401296 gene expression dose reduces or it encodes reduces, instruction test agent is anticancer
Or antineoplastic.
Present invention also offers a kind of LOC401296 gene and/or its corresponding mRNA sequence and/or its corresponding albumen
Application in adjusting the cell cycle for the matter sequence, is the expression by regulating and controlling the expression of LOC401296 gene or its corresponding mRNA
Or its coding the expression of albumen and activity.
Present invention also offers a kind of application in promoting Apoptosis for inhibitor, described inhibitor suppression
The expression of albumen of the expression of the expression of LOC401296 gene or its corresponding mRNA or its coding and activity.
Present invention also offers a kind of application in suppression cell proliferation for inhibitor, described inhibitor suppression
The expression of albumen of the expression of the expression of LOC401296 gene or its corresponding mRNA or its coding and activity.
Present invention also offers a kind of application in preparing antineoplastic for inhibitor, described inhibitor suppression
The expression of albumen of the expression of the expression of LOC401296 gene or its corresponding mRNA or its coding and activity.
Present invention also offers a kind of pharmaceutical composition, this pharmaceutical composition can be used for treating cancer or tumour, this medicine
Compositions can be used for promoting Apoptosis, suppresses cell proliferation, and described pharmaceutical composition comprises a kind of inhibitor, this suppression
Preparation suppresses LOC401296 gene or the albumen of its corresponding mRNA or its coding.This pharmaceutical composition can also comprise further
Other materials, it is preferable that pharmaceutically acceptable carrier, excipient can be comprised, can comprise other antineoplastics, have
Part of tumor-targeting function etc..
Invention further provides a kind of prevention, treatment or alleviation LOC401296 gene-associated diseases or illness, such as tumour
Method, it include to individuals in need apply a kind of inhibitor, this inhibitor suppression LOC401296 gene or its correspondence
MRNA or the albumen of its coding.Preferably, one or more interferential RNA, the medicine of the present invention is applied to individuals in need
Compositions.
The present invention studies to Unknown Function gene LOC401296.It has been investigated that LOC401296 gene is multiple thin
Born of the same parents are (cell such as HEK293, U937, Hela, Lo2, HepG2, K562, NB4, Molt4, A549, MCF7) wide expression.Suppression
LOC401296 gene expression can cause HeLa, A549, MCF-7 growth of tumour cell to suppress it means that can suppress
The material of LOC401296 gene expression is all possible to the effect with suppression growth of tumour cell, and LOC401296 gene can conduct
The target molecule of antitumor medicine screening.After lowering this gene expression, cell growth is subject to obvious suppression, apoptosis to increase, occur in that
The significantly G2/M phase blocks, and research further has shown that LOC401296 gene cell mitotic progression and spindle forming process,
It is a kind of new cell cycle regulatory molecules.Achievement of the present invention is laid a good foundation for follow-up function research offer.
Brief description
Fig. 1 is expression in different clones for the LOC401296mRNA.
Fig. 2 is the inhibitory action to LOC401296mRNA and protein expression for the siRNA of targeting LOC401296.
Fig. 3 is to lower LOC401296 HEK293 cellular morphology is affected.
Fig. 4 is that cellular morphology change is saved in revolution LOC401296 expression.
Fig. 5 is the impact lowering LOC401296 expression to various kinds of cell growth.(siRNA-NC represents transfection siRNA-NC
Control group；SiRNA-LOC401296 represents the LOC401296 expression downward group of transfection siRNA-2#).
Fig. 6 is to lower LOC401296 to express on apoptotic impact.(A:2 after siRNA-2# transfected HEK 293
My god, 3 days, detection Apoptosis and statistical analysis；B:SiRNA-2# transfection Hela cell after 2 days, 3 days, detection Apoptosis and
Statistical analysis).
Fig. 7 is to lower LOC401296 HEK293 and HeLa cell cycle distribution is affected.
Fig. 8 is to lower the impact that LOC401296 blocks to HeLa cell mitogen.
Fig. 9 is that the retardance of HeLa cell mitogen is saved in revolution LOC401296 expression.
Figure 10 is to lower the impact to HeLa cell mitogen process for the LOC401296.
Figure 11 is to lower the impact that LOC401296 is formed to HeLa cell spindle.
Specific embodiment
With reference to embodiment, the present invention will be further described, but the present invention should not be limited by the examples.If no special
Different explanation, instrument of the present invention, reagent and material all can be obtained by conventional route or means.
The acquisition of embodiment 1 LOC401296 gene
Extract human peripheral total serum IgE, peripheral blood cDNA is obtained using Reverse Transcriptase kit.There is provided according to NCBI
LOC401296 gene (GenBank:BC132760.1) corresponding cDNA full length sequence designs primer (upstream primer 5
' atggactggggaggagg 3 ' and downstream primer 5 ' tcagaaagtgcccgattccaag3 ').Using this primer pair, in addition
All blood cDNA enter performing PCR amplification for template.PCR primer is connected to carrier T, the sequence being provided with NCBI after sequencing is compared
Right, result shows that we obtain the full length cDNA sequence of LOC401296 gene.
Embodiment 2 LOC401296 gene is expressed in various kinds of cell
Thin using conventional method culture HEK293, U937, Hela, Lo2, HepG2, K562, NB4, Molt4, A549, MCF7
Born of the same parents.Treat that cell is in exponential phase of growth and collects cell respectively, extract total serum IgE, obtain the cDNA of above-mentioned cell through reverse transcription reaction.
With above-mentioned cDNA as template, using the primer pair (upstream of LOC401296：5 ' acctgctctggggttgccat3 ', downstream：5
' acgtagccttgctgggtgtg3 ') enter performing PCR amplification, the expression in above-mentioned cell for the mRNA of analysis LOC401296 gene
Situation.Result shows all to examine in HEK293, U937, Hela, Lo2, HepG2, K562, NB4, Molt4, A549, MCF7 cell
Measure the mRNA expression of LOC401296 gene, show that LOC401296 is the gene (Fig. 1) of a wide expression.
Embodiment 3 LOC401296 specific siRNA suppresses the mRNA expression of LOC401296
LOC401296 specific siRNA sequence (siRNA-1# and siRNA-2#) and the random siRNA sequence for control group
Row (siRNA-NC) are as shown in table 1.According to Lipofectamine2000 transfection reagent specification, siRNA is transfected respectively
HEK293 cell, the final concentration of 100nM of siRNA.Transfect latter 48 hours and collect cell, extract total serum IgE, carry out RT-PCR detection,
The inhibitory action that analysis siRNA sequence is expressed to LOC401296.As shown in Fig. 2 compared with siRNA-NC, siRNA-1# and
SiRNA-2# all can effectively suppress the expression of the mRNA of LOC401296.
Table 1 siRNA sequence
Embodiment 4 LOC401296 Functional identification of genes
Hela cell cultivates complete liquid (containing 10%FBS, penicillin, streptomysin) culture, 5%CO with 16402Saturated humidity,
37 DEG C of incubator cultures, pass on when rear cell 90%-100% merges and pass on again.HEK293, A549, MCF7 cell DMEM
Complete culture solution (containing 10%FBS, penicillin, streptomysin) is cultivated.
1st, siRNA transfectional cell
, to Tissue Culture Plate (nutrient solution contains 10%FBS, without antibiotic), 24h transfection after inoculation, during transfection for inoculating cell
Cell about 40% merges.(2) transfection working solution is prepared：SiRNA is 20 μM of solution with DEPC water dissolves, by lucky agate RNA oligo
Synthesis the every 1 OD siRNA of report operation instruction add 150 μ l DEPC water dissolves, after dissolving immediately using or often pipe 20 μ l packing
Frozen in -80 DEG C；When transfecting in 24 orifice plates, siRNA solution and Lipofectamine2000 reagent are all with antibiotic-free, serum-free
DMEM nutrient solution or RPMI-1640 dilution, siRNA solution 2.5 μ l is diluted to 25 μ l (working concentration 100nM),
Lipofectamine2000 reagent 2 μ l is diluted to 25 μ l, incubated at room 5min after two kinds of dilution equal-volumes mixings.(3) turn
Dye.Every hole takes 50 μ l transfection working solutions to be added dropwise in 500ul nutrient solution gently vibration and mixes, and cell is placed in 37 DEG C, and 5%
CO2Culture in saturated humidity incubator.96 in orifice plates during transfection, and reagent dosage is with 24 orifice plate consumptions for radix divided by 5；6 orifice plates
During interior transfection, reagent dosage is multiplied by 5 with 24 orifice plate consumptions for radix, and reagent working concentration is constant.
2nd, analyze cellular morphology under microscope
According to siRNA transfection method above, HEK293 cell transfects siRNA-1#, siRNA-2# and siRNA- respectively
NC.Transfect latter 48 hours and 72 hours basis of microscopic observation HEK293 cellular morphologies.It was found that transfection siRNA-1# and
The cellular morphology of siRNA-2# occurs substantially to change, and is mainly shown as that cell attachment ability declines, cellular morphology becomes round, and occurs
Dead cell (Fig. 3).In order to exclude the non-target effect of siRNA, we are turned round using by pCMV-Myc-LOC401296
Experiment.It was found that HEK293 cellular morphology is extremely existing after revolution LOC401296 expression in the HEK293 of transfection siRNA-2#
As be clearly better (Fig. 4).It is to lower that these results show the HEK293 cellular morphology that transfection siRNA-2# leads to change really
The specific biological effect that LOC401296 expression causes.
3rd, CCK-8 method detection cell proliferation
According to siRNA transfection method above, lower LOC401296 gene expression with siRNA transfection method in 96 orifice plates, even
0,1,2,3,4 days living cells quantities after continuous detection transfection, if LOC401296 downward group (siRNA-2#) and control group (siRNA-
NC), every group of each 5 Duplicate Samples.By Dojindo company CCK-8 reagent operation instruction, add in every 100 μ l cell culture fluids
CCK-8 reagent fresh cell medium first can be pressed 1 during use by CCK-8 solution 10 μ l:10 dilutions, abandon old nutrient solution, every hole
Add 110 μ l CCK-8 dilute solutions, 37 DEG C of 5%CO2Colour developing situation is observed after incubation 15-30min in saturated humidity incubator,
Every 30min ELIASA 450nm wavelength detecting absorbance in the incubation 30min-4h time, test every time is all provided with zeroing hole.
Cell proliferative conditions are analyzed according to each group absorbance.
Lower 1,2,3,4 days after LOC401296 gene expression, HEK293, Hela, MCF7, A549 are detected using CCK-8 method
Deng cell quantity, matching cell growth curve analyzes cell proliferative conditions：Propagation from 1st day after discovery HEK293 cell self-interference
Start to be suppressed, extend that this inhibitory action is more obvious in time, proliferation inhibition rate reaches as high as 48%；Additionally, Hela,
The tumor cell proliferations such as MCF7, A549 are all by obvious suppression (Fig. 5).Illustrate that suppression LOC401296 gene expression can be notable
Cell growth inhibition, effectively inhibits the growth of tumour cell it is seen that this siRNA has antineoplastic action.
3rd, Annexin V-FITC detection apoptosis
According to siRNA transfection method above, in 6 orifice plates, HEK293, Hela cell is lowered using siRNA transfection method
LOC401296 gene expression, if LOC401296 downward group (siRNA-2#) and control group (siRNA-NC), every group 3 parallel
Sample, collects cell through flow cytometry analysis Apoptosis ratio in 2,3 days after interfering.Apoptosis detection sample preparation is made by reagent
Carried out with explanation, method is as follows：(1) cell is digested with 0.25% pancreatin (without EDTA), and digestion time is unsuitable long, treats cell
Change bowlder is gently blown and beaten and so that it is come off, and 3000rpm centrifugation 5min collects (1-5) × 105Individual cell.(2) use PBS washed cell 2
Secondary, each 3000rpm is centrifuged 5min.(3) 500 μ l Binding Buffer suspension cells are added.(4) 5 μ l Annexin are added
After V-FITC mixes, add 5 μ l PI, mix.(5) through flow cytomery after room temperature lucifuge reaction 5-15min.
Result shows：By lowering Hela cell, HEK293 intracellular LOC401296 gene expression dose, compare interference
Group and control group apoptotic cell ratio all lead to cell it has been found that lowering LOC401296 gene expression in both clone
Apoptosis ratio increases：2nd day interference group apoptosis 7.90% after the interference of HEK293 cell, control group apoptosis 2.98%；The 3rd after interference
Its interference group apoptosis 7.06%, control group apoptosis 3.28% (Fig. 6 A)；2nd day interference group apoptosis after the interference of Hela cell
9.88%, control group apoptosis 6.21%；3rd day interference group apoptosis 16.53% after interference, control group apoptosis 9.26% (Fig. 6 B).
Statistical analysis shows, compared with corresponding control group, experimental group apoptotic cell ratio increase has statistical significance (p<0.05).
4th, Flow cytometry period profile
Cell cycle change after LOC401296 gene expression is lowered using flow cytometry HEK293, Hela cell,
If LOC401296 downward group (siRNA-2#) and control group (siRNA-NC), every group of 3 Duplicate Samples, collect carefully in interfering latter 2 days
Born of the same parents are analyzed.Flow cytometry cell cycle sample preparation methods：(1) HEK293 cell (is not contained with 0.25% pancreatin
EDTA) digest, Hela cell is digested with 0.25% pancreatin (containing 0.02%EDTA), gently blow and beat when cell rounding and so that it is taken off
Fall, collect cell about (1-5) × 105 with 1.5ml EP pipe 3000rpm centrifugation 5min.(2) 300 μ l are added to contain 10% peptide ox blood
Cell precipitation is made single cell suspension by clear PBS solution, reduces cellular adhesion.(3) 700 μ l absolute ethyl alcohols are added resuspended thin
Born of the same parents, put -20 DEG C of fixing more than 24h.(4) after cell is fixing, 3000rpm centrifugation 5min, abandons fixer, with PBS, cell is washed 2
Secondary, each 3000rpm is centrifuged 5min.(5) RNase A is prepared with PBS solution, concentration 1mg/ml, and every solencyte sample adds
100ul RNase A, 37 DEG C of incubation 30min.(6) often pipe sample adds concentration is 100 μ g/ml PI 200 μ l, and room temperature lucifuge dyes
Upper machine testing after 15-20min.
Lower the detection of LOC401296 gene expression laggard line period, it is found that：The 2nd day after siRNA-2# transfection
All the G2/M phase and block in HEK293 cell, HeLa cell.Fig. 7 shows the data of single experiment, and three repeat samples are carried out
Statistical analysis shows, compared with corresponding control group, the cell proportion increase of experimental group G2/M phase has statistical significance (p<
0.05).
5th, Flow cytometry cell mitogen retardance
Cell cycle change after LOC401296 gene expression is lowered using flow cytometry Hela cell, if
LOC401296 downward group (siRNA-2#) and control group (siRNA-NC), every group of 3 Duplicate Samples, collect in interfering latter 2 days, 3 days
Cell is analyzed.Flow cytometry cell mitogen proportional sample preparation method：(1) cell is collected and fixing and all
Phase sample preparation methods are identical.(2) after cell is fixing, 3000rpm centrifugation 5min, abandons fixer, is washed cell 2 times with PBS,
3000rpm centrifugation 5min, exhausts residual liquid every time.(3) 100 μ l 0.3%TritonX-100 room temperature rupture of membranes 15min are added.
(4) the anti-human p-H3 of rabbit (S10) antibody (m period Specific marker) presses 1 with 0.3%TritonX-100:1000 dilutions,
Gently mix rear 37 DEG C of incubation 30min.(5) cell is washed 1 time by PBS, and 3000rpm is centrifuged 5min, exhausts residual liquid.(6)
Goat anti-rabbit igg/FITC labelled antibody presses 1 with PBS:100 dilutions, 37 DEG C of incubation 30min.(7) with PBS, cell is washed 1 time,
3000rpm is centrifuged 5min, exhausts residual liquid.Add 1mg/ml RNaseA 100 μ l suspension cell, 37 DEG C of incubation 30min.
(8) often pipe adds 100 μ g/ml PI 200 μ l, upper machine testing after room temperature lucifuge dyeing 15-20min.
Result shows, lower LOC401296 expression after the 2nd day, in HeLa cell p-H3 positive cell ratio apparently higher than
Control group (Fig. 8), statistical analysis show with statistical significance, point out LOC401296 expression downward can improve HeLa thin
Born of the same parents' cell mitogen phase blocks.Subsequently, in order to confirm that lowering LOC401296 causes the special of cell mitogen phase retardance
Property, we adopt LOC401296 to turn round this biological effect of experimental verification.Result is turned round after proving to lower LOC401296
LOC401296 expression plasmid, successfully reversed LOC401296 to lower expression induced m period retardance (Fig. 9) it was demonstrated that
Lowering LOC401296 gene expression causes the retardance of cell mitogen phase to increase the specificity being to lower LOC401296 expression
Biological effect.
In addition, after lowering LOC401296 expression, adopting the nutrient solution containing final concentration of 100ng/ml Nocodazole
Cell is cultivated, continuous action 16h, m period cell is collected by succusion, is then discharged into and does not contain
The nutrient solution of Nocodazole.Different time collects cell upon discharge, detects the cell cycle, and analysis LOC401296 lowers to M
The impact of phase cycle progression.It was found that LOC401296 downward group cell M phase process is suppressed (Figure 10).
6th, immunofluorescence technique observes spindle volume morphing
After siRNA lowers Hela cell LOC401296 gene expression, IIF marks beta-Tubulin observes
Spindle metamorphosis during cell mitogen.If LOC401296 downward group (siRNA-2#) and control group (siRNA-
NC).Experimental technique is as follows：(1) cover glass is with, after concentrated sulfuric acid soaked overnight, flowing water is rinsed well, then by cover glass 95%
Soak 2h in ethanol, dry standby after autoclaving.(2) cover glass sterilizing was soaked with 100 μ g/ml Poly-L-Lysine Solutions
At night, secondary daily 1ml PBS dries 3-4h after rinsing 3 times.(3) cover glass processing through poly-D-lysine is placed in 6 orifice plates, connects
Planting Hela cell makes creep plate grow.(4) transfection in 24h after inoculating, during transfection, cell about 50% merges, and enters by previous experiments condition
Row transfection siRNA sequence.(5) after transfecting, 48h removes nutrient solution, and cell fixes 10min with 4% paraformaldehyde room temperature.(6) cell
It is placed in and rinsed 3 times with PBS in minimum speed (40rpm) on shaking table, each 5min.(7) use 0.3%TritonX-100 ice bath bar
Rupture of membranes 10min under part.(8) the PBS solution room temperature containing 3% bovine serum albumin(BSA) (BSA) and 0.3%TritonX-100 for the cell
Closing 1h.(9) marks beta-Tubulin：Dilute antibody, rabbit anti-human β-Tubulin antibody 1 with 3%BSA:25 dilutions, 4 DEG C of incubations
Overnight.(10) cell is placed in and is rinsed 3 times with PBS in minimum speed (40rpm) on shaking table, each 5min.(11) goat anti-rabbit igg/
FITC labelled antibody 3%BSA 1:50 dilutions, room temperature lucifuge is incubated 2h.(12) cell is placed in minimum speed on shaking table
(40rpm) rinsed 3 times with PBS, each 5min.(13) contaminate core.1 μ g/ml DAPI PBS 1：500 dilutions, room temperature lucifuge dyes
8min.(14) cell is placed in minimum speed on shaking table (40rpm) PBS and rinses 3 times, each 5min.(15) take clean glass slide,
Drip 50% glycerine 15-20 μ l mounting on the cover slip, by cover glass left-hand thread on glycerine (the one of attached cell faces down), keep away
Bubble in light, exhausts excessive liquid with filter paper.
Experimental result shows：Lowering LOC401296 gene expression causes cell that obvious spindle paramophia occurs, including
Spindle solid offsetting, spindle are asymmetric, spindle solid offsetting and asymmetric, multipolar spindle, single-stage spindle, spindle disorderly or
Multiple abnormal morphologies (Figure 11) such as disappearance.200 m period cells of stochastic analysis carry out statistical analysis, and result shows, right
It is spindle abnormal cell ratio in 10.5%, LOC401296 downward group cell according to spindle abnormal cell ratio in group cell
For 73%.Spindle can be led to be formed and dysfunction it is demonstrated experimentally that lowering LOC401296 gene expression, impact chromosome divides
From important physiology courses such as, cell divisions, suppress cell normal growth further.This result further demonstrate that LOC gene
Expression is related to mitosis, suppresses this gene or its protein product, can block mitotic progression, and then suppresses cell life
Long, can be used for suppressing tumour growth, there is antineoplastic application prospect.
Although the present invention is open as above with preferred embodiment, it is not limited to the present invention, any is familiar with this skill
The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention
Enclosing should be by being defined that claims are defined.
Claims (8)
1. a kind of method of external cell cycle regulation it is characterised in that be by regulate and control LOC401296 gene expression, from
And cell cycle regulation, the corresponding cDNA sequence of described LOC401296 gene is as shown in SEQ ID NO.1；Pressed down by inhibitor
The expression of LOC401296 gene processed, thus cause cell-cycle arrest；Described inhibitor is siRNA, two chains of siRNA
Nucleotide sequence respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or as shown in SEQ ID NO.4, SEQ ID NO.5.
2. a kind of method of vitro induction of apoptosis is it is characterised in that be the table suppressing LOC401296 gene by inhibitor
Reach, thus inducing cell apoptosis, the corresponding cDNA sequence of described LOC401296 gene as shown in SEQ ID NO.1, described suppression
Agent is siRNA, and the nucleotide sequence of two chains of siRNA is respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or such as SEQ
Shown in ID NO.4, SEQ ID NO.5.
3. a kind of method of external suppression cell proliferation is it is characterised in that be the table suppressing LOC401296 gene by inhibitor
Reach, thus suppressing cell proliferation, the corresponding cDNA sequence of described LOC401296 gene as shown in SEQ ID NO.1, described suppression
Agent is siRNA, and the nucleotide sequence of two chains of siRNA is respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or such as SEQ
Shown in ID NO.4, SEQ ID NO.5.
4. a kind of method preparing treating cancer medicine is it is characterised in that being to prepare treating cancer medicine using inhibitor, described
Inhibitor is siRNA, the nucleotide sequence of two chains of siRNA respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or such as
Shown in SEQ ID NO.4, SEQ ID NO.5；The cDNA sequence of described LOC401296 gene is as shown in SEQ ID NO.1, described
Cancer be including selected from oophoroma, cancer of pancreas, lung cancer, liver cancer, melanoma, retinoblastoma, breast cancer, colon cancer,
Leukaemia, lymthoma, brain tumor, cervix cancer, prostate tumor, bladder knurl, reticuloendothellium knurl, astrocytoma, collagen are thin
Born of the same parents' knurl, neuroblastoma, osteosarcoma, kidney or head and neck cancer.
5. a kind of application in preparing antineoplastic for inhibitor is it is characterised in that described inhibitor is siRNA, siRNA's
Article two, the nucleotide sequence of chain is respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or as SEQ ID NO.4, SEQ ID
Shown in NO.5.
6. a kind of prevention or treating cancer medicine it is characterised in that comprising a kind of siRNA, the nucleotides of two chains of siRNA
Sequence respectively as shown in SEQ ID NO.2, SEQ ID NO.3, or as shown in SEQ ID NO.4, SEQ ID NO.5.
7. medicine according to claim 6 is it is characterised in that described medicine also includes other pharmaceutically acceptable loads
Body.
8. a kind of siRNA is it is characterised in that the nucleotide sequence of two chains of siRNA is respectively as SEQ ID NO.2, SEQ ID
Shown in NO.3, or as shown in SEQ ID NO.4, SEQ ID NO.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410211150.7A CN104164438B (en) | 2014-05-19 | 2014-05-19 | LOC401296 gene, and its application in regulation of cell cycle and cell growth |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410211150.7A CN104164438B (en) | 2014-05-19 | 2014-05-19 | LOC401296 gene, and its application in regulation of cell cycle and cell growth |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104164438A CN104164438A (en) | 2014-11-26 |
| CN104164438B true CN104164438B (en) | 2017-02-22 |
Family
ID=51908419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410211150.7A Active CN104164438B (en) | 2014-05-19 | 2014-05-19 | LOC401296 gene, and its application in regulation of cell cycle and cell growth |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104164438B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251523A (en) * | 2016-12-27 | 2018-07-06 | 山东省医学科学院基础医学研究所 | A kind of non-small cell lung cancer molecular marker and its application |
| CN109735622A (en) * | 2019-03-07 | 2019-05-10 | 天津市第三中心医院 | LncRNA relevant to colorectal cancer and its application |
| CN111803513B (en) * | 2020-07-14 | 2021-10-15 | 浙江生研生物科技有限公司 | Gene inhibitor for preparing medicine for inhibiting colon cancer cell proliferation |
| CN113249382B (en) * | 2021-04-12 | 2023-05-12 | 右江民族医学院 | SiRNA for down regulating TRIM56 gene expression and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1440981A2 (en) * | 2003-01-21 | 2004-07-28 | Research Association for Biotechnology | Full-length human cdna |
| CN101801419A (en) * | 2007-06-08 | 2010-08-11 | 米尔纳疗法公司 | Gene and path as the miR-34 regulation and control for the treatment of the target of intervening |
-
2014
- 2014-05-19 CN CN201410211150.7A patent/CN104164438B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1440981A2 (en) * | 2003-01-21 | 2004-07-28 | Research Association for Biotechnology | Full-length human cdna |
| CN101801419A (en) * | 2007-06-08 | 2010-08-11 | 米尔纳疗法公司 | Gene and path as the miR-34 regulation and control for the treatment of the target of intervening |
Non-Patent Citations (4)
| Title |
|---|
| Homo sapiens BAC clone RP11-510K8 from 7, complete sequence;AC074389.8;《GenBank》;20031008;序列 * |
| Homo sapiens hypothetical LOC401296, Mrna(cDNA clone MGC:164391 IMAGE:40146782), complete cds;GenBank：BC132760.1;《GenBank》;20090318;序列 * |
| PREDICTED: Homo sapiens uncharacterized LOC401296 (LOC401296), transcript variant X3, ncRNA;XR_171619.2;《NCBI》;20121030;序列 * |
| 未知功能基因LOC410296的表达载体构建及小鼠抗血清制备;沈丽萍 等;《军事医学》;20140331;第38卷(第3期);212-215 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104164438A (en) | 2014-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yao et al. | Knockdown of long non-coding RNA XIST exerts tumor-suppressive functions in human glioblastoma stem cells by up-regulating miR-152 | |
| Fujiwara et al. | Silencing hypoxia-inducible factor-1α inhibits cell migration and invasion under hypoxic environment in malignant gliomas | |
| CN104164438B (en) | LOC401296 gene, and its application in regulation of cell cycle and cell growth | |
| Zhang et al. | Astragaloside IV inhibits the invasion and metastasis of SiHa cervical cancer cells via the TGF‑β1‑mediated PI3K and MAPK pathways | |
| CN104383559B (en) | The expression vector of long-chain non-coding RNA LOC401317, tumor suppression reagent and application thereof | |
| CN109985243A (en) | Target application of the microRNA of PCSK9 in treatment LDLC correlated metabolism diseases | |
| Huang et al. | MiR-4673 modulates paclitaxel-induced oxidative stress and loss of mitochondrial membrane potential by targeting 8-oxoguanine-DNA glycosylase-1 | |
| Wang et al. | Triptonide inhibits the pathological functions of gastric cancer-associated fibroblasts | |
| Santerre et al. | HIV-1 Nef promotes cell proliferation and microRNA dysregulation in lung cells | |
| Wang et al. | RETRACTED ARTICLE: Kaempferol promotes proliferation, migration and differentiation of MC3T3-E1 cells via up-regulation of microRNA-101 | |
| Liu et al. | RETRACTED ARTICLE: Long non-coding RNA SNHG16 reduces hydrogen peroxide-induced cell injury in PC-12 cells by up-regulating microRNA-423-5p | |
| JP6886012B2 (en) | miRNA pharmaceutical compositions and their therapeutic use | |
| CN111658655A (en) | Application of cucurbitacin B in preparation of iron death inducer and anti-nasopharyngeal carcinoma drug | |
| CN108066748A (en) | New application of the excretion body in skin injury | |
| Yu et al. | GLIDR promotes the progression of glioma by regulating the MiR-4677-3p/MAGI2 axis | |
| Iliev et al. | Cotinus coggygria non-volatile fraction affects the survival of human cultured cells | |
| CN110013480A (en) | Amlexanox causes the application in induced lung injury protective agents in preparation ionising radiation | |
| CN112891354A (en) | Application of MDM2 inhibitor Nutlin-3a in preparation of medicine for activating endoplasmic reticulum stress-induced cancer cell apoptosis | |
| Bi et al. | MicroRNA-184 promotes proliferation and inhibits apoptosis in HaCaT cells: an in vitro study | |
| CN107523566A (en) | A kind of targeted inhibition agent of MCM3AP AS1 genes and application thereof | |
| CN111529690A (en) | New application of human CD133 protein 1-108 peptide fragment | |
| CN103937801A (en) | Multi-targeted siRNA (Small Interfering Ribose Nucleic Acid) molecule and application thereof to resisting tumor | |
| Wei et al. | ATPIF1 alleviates oxygen glucose deprivation/reoxygenation-induced astrocyte injury in vitro: A rat model of ischemic brain injury | |
| Romani et al. | The ciliary proteins Meckelin and Jouberin are required for retinoic acid-dependent neural differentiation of mouse embryonic stem cells | |
| CN103122350B (en) | siRNA molecule for restraining Omgp gene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |