CN111803513B

CN111803513B - Gene inhibitor for preparing medicine for inhibiting colon cancer cell proliferation

Info

Publication number: CN111803513B
Application number: CN202010674152.5A
Authority: CN
Inventors: 唐正晓
Original assignee: Zhejiang Shengyan Biotechnology Co ltd
Current assignee: Zhejiang Shengyan Biotechnology Co.,Ltd.
Priority date: 2020-07-14
Filing date: 2020-07-14
Publication date: 2021-10-15
Anticipated expiration: 2040-07-14
Also published as: CN111803513A

Abstract

The invention provides a gene inhibitor for preparing a medicine for inhibiting colon cancer cell proliferation, and belongs to the technical field of biomedicine. The invention proves that the LINC02360 gene inhibitor can inhibit the proliferation rate of colon cancer cells and can regulate and control the expression of proliferation-related proteins Cyclin-D1 and P21, so that the LINC02360 gene inhibitor can be used for preparing medicines for inhibiting the proliferation of the colon cancer cells.

Description

Gene inhibitor for preparing medicine for inhibiting colon cancer cell proliferation

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a gene inhibitor for preparing a medicine for inhibiting colon cancer cell proliferation.

Background

Colon cancer is a common malignancy in the gastrointestinal tract. In recent years, with the change of the dietary structure and the living habits, the morbidity and the mortality of colon cancer in China keep rising. Although the current treatment means such as surgical treatment, adjuvant treatment and targeted treatment of colon cancer have made great progress, the prognosis of patients with advanced colon cancer is still not very optimistic. Currently, specific therapeutic drugs are still lacking.

Non-coding RNA is a class of RNA molecules that are found in living organisms in general in recent years and play important functions in life activities, and unlike mRNA, tRNA, and rRNA, it does not participate in coding proteins. Long non-coding RNAs are a class of RNA molecules greater than 200 nucleotides in length that have no potential to encode proteins. The existing research finds that the long-chain non-coding RNA plays an important role in various regulation and control processes such as X chromosome silencing and genome imprinting. Research shows that lncRNA plays an important role in cell physiology and pathology activities and is involved in the occurrence and development processes of diseases such as tumors and the like. Therefore, the molecular basis of long-chain non-coding in colon cancer is further explored, and the discovery of new long-chain non-coding RNA related to colon cancer is of great significance for searching new therapeutic targets and developing new therapeutic drugs.

At present, the role of the long non-coding RNA LINC02360 in colon cancer and other malignant tumors has not been reported.

Disclosure of Invention

The invention aims to provide a gene inhibitor capable of effectively inhibiting colorectal cancer cell proliferation.

In order to achieve the purpose, the invention provides the following technical scheme:

the invention provides application of a long-chain non-coding RNA LINC02360 gene inhibitor in preparing a medicine for inhibiting colon cancer cell proliferation.

Preferably, the gene inhibitor can inhibit the expression of LINC02360 gene in colon cancer cells.

Preferably, the gene inhibitor is one of siRNA or shRNA.

Preferably, the gene inhibitor is siRNA.

Preferably, the sense strand of the siRNA is GAAUGAUGUGAAUGGUUAACC; the antisense strand of the siRNA is UUAACCAUUCACAUCAUUCAG.

In addition, the invention provides a long-chain non-coding RNA LINC02360, which is characterized in that the LINC02360 is highly expressed in colon cancer cells; inhibiting LINC02360 in colon cancer cells can inhibit colon cancer cell proliferation.

The invention has the beneficial effects that:

experiments prove that the siRNA of the long-chain non-coding RNA LINC02360 can effectively inhibit the proliferation of colon cancer cells by regulating and controlling the colon cancer cell proliferation related protein for the first time, thereby providing possibility for further developing medicines for inhibiting the colon cancer cell proliferation and treating colon cancer.

Drawings

FIG. 1 expression differences of LINC02360 in normal colon epithelial cell lines FHC and colon cancer cells SW480, SW620, HCT116 and HT29

FIG. 2 detection of inhibitory Effect of LINC02360 siRNA

FIG. 3CCK-8 test the effect of LINC02360 siRNA on colon cancer cell proliferation

FIG. 4EDU staining to examine the effect of LINC02360 siRNA on colon cancer cell proliferation

FIG. 5 Effect of LINC02360 siRNA on proliferation-related proteins cyclin-D1 and P21

Detailed Description

The present invention will be further described with reference to specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention.

Example 1

The expression difference of LINC02360 in FHC of normal colon epithelial cell line and SW480, SW620, HCT116 and HT29 of colon cancer cells was examined.

1. Extraction of RNA

(1) Inoculating FHC cells, SW480, SW620, HCT116 and HT29 into a 6-well plate, culturing for 48h, washing the cells for 2 times by using PBS, adding 1mL of Trizol into each well, repeatedly blowing and beating the cells to fully mix the Trizol and the cells, transferring the mixed solution into an EP (ultraviolet) tube, and standing for 5min at room temperature;

(2) centrifuging at 12000r/min at 4 deg.C for 5min, transferring the supernatant to new RNase-free EP tubes, adding 200 μ L precooled chloroform into each EP tube, mixing, and standing at room temperature for 10 min;

(3) centrifuging at 12000r/min at 4 deg.C for 5min, transferring the supernatant to a new RNase-free EP tube, adding equal volume of precooled isopropanol, mixing, and standing at 4 deg.C for 10 min;

(4) centrifuging at 12000rpm/min at 4 deg.C for 20min, and transferring the upper 500 μ L colorless aqueous phase to a new RNase-free EP tube;

(5) adding 500 μ L of precooled isopropanol, mixing well, and standing on ice for 1 hour;

(6) centrifuging at 4 deg.C and 12000rpm/min for 20min, removing supernatant, retaining RNA precipitate, adding 1ml ethanol water solution prepared from DEPC water, and washing precipitate;

(7) centrifugation at 12000rpm/min at 4 ℃ for 5min removed the supernatant and as much as possible removed the liquid remaining on the tube wall, dried the RNA at room temperature until the pellet was translucent, and 40. mu.L of DEPC water was added.

2. Detection of LINC02360 Gene expression

(1) Reverse transcription reaction

Reaction conditions are as follows: 10min at 25 ℃; 30min at 42 ℃; 5min at 85 ℃.

(2) Fluorescent quantitative PCR reaction

Components	Adding amount of
		2 × SYBR reagent	10μL
cDNA template	1μL
		Upstream primer	0.5μL
Downstream primer	0.5μL
		ddH2O	8μL

Reaction conditions are as follows: 5min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 40s, 40 cycles.

(3) Primer sequences

LINC02360

Forward Primer 5'-GGTAGAGGTGAAGCTTCGCA-3'(SEQ ID NO.1)

Reverse Primer 5'-ACACCACGAGACAGTTTAGGA-3'(SEQ ID NO.2)

GAPDH

Forward Primer 5'-TTCACCACCATGGAGAAGGC-3'(SEQ ID NO.3)

Reverse Primer 5'-CCACCTGGTGCTCAGTGTAG-3'(SEQ ID NO.4)

By using 2^-△△CtThe experimental data were processed by the method and the results are shown in fig. 1.

Example 2

Detection of inhibitory Effect of si-LINC02360 Gene inhibitor on LINC02360

The si-LINC02360 and Control siRNA sequences are as follows:

Control siRNA 5'-UUCUCCGAACGUGUCACGU-3'(SEQ ID NO.5)

5'-ACGUGACACGUUCGGAGAA-3'(SEQ ID NO.6)

si-LINC02360 5'-GAAUGAUGUGAAUGGUUAACC-3'(SEQ ID NO.7)

5'-UUAACCAUUCACAUCAUUCAG-3'(SEQ ID NO.8)

(1) SW480 cells were plated on a cell plate and transfected according to lip2000 instructions, divided into a control group, a control siRNA group, and a si-LINC02360 group, each group was set to 3 replicates;

(2) and (3) removing the transfection medium after 6 hours of transfection, replacing the transfection medium with a normal medium, culturing for 48 hours, extracting RNA, performing reverse transcription, and performing fluorescent quantitative PCR, wherein the specific experimental steps refer to example 1.

The experimental result is shown in figure 2, and it can be seen from the figure that the control siRNA group has no significant influence on the expression of LINC02360 in SW480 cells, and si-LINC02360 can significantly reduce the expression level of LINC02360 in SW480 cells, and the inhibition effect is 82%.

Example 3

CCK-8 measures the Effect of LINC02360 on Colon cancer cell proliferation

(1) SW480 cells transfected with control siRNA and si-LINC02360 respectively are inoculated into a 96-well plate, each well is 90 mu l, and each group is provided with 3 multiple wells;

(2) the absorbance was measured at 0h, 24h, 48h and 72h using 10. mu.l CCK-8 reagent on a 450nm microplate reader.

As shown in FIG. 3, it can be seen that the transfected si-LINC02360 can significantly inhibit the cell proliferation rate of SW480 cells, and the difference of 72h is the most significant (OD value of control si-RNA group is 1.23 + -0.06, OD value of si-LINC02360 group is 0.75 + -0.05, and the difference has statistical significance).

Example 4

Edu staining to examine the effect of LINC02360 on cell proliferation of colon cancer cells

(1) SW480 cells transfected with Control siRNA and si-LINC02360 respectively are inoculated into a 96-well plate and cultured for 24 h;

(2) adding 100 μ l of culture medium containing 10 μ M EDU into each well, incubating the cells for 2h, and discarding the culture medium;

(3) PBS washed cells 2 times for 5 minutes each;

(4) adding 100 μ l of 4% paraformaldehyde cell fixing solution into each well, standing at room temperature for 30min, and discarding the fixing solution;

(5) adding 100 μ l 2mg/ml glycine to each well, and incubating for 5min in a shaker to neutralize excess paraformaldehyde;

(6) discarding glycine, adding PBS to clean cells for 5min, adding 100 μ l of 0.5% Triton X-100 cell permeation solution into each well, allowing permeation at room temperature for 10min, and discarding the permeation solution;

(7) washing the cells with PBS for 5min, adding 100 μ l of the prepared detection mixed solution into each hole, keeping out of the sun, and incubating at room temperature for 30 min;

(8) discarding the reaction solution, adding 100 μ l of 0.5% TritonX-100 cell permeation solution, washing for 2-3 times (10 min each time), discarding the cell permeation solution, and washing with PBS for 2 times (5 min each time);

(9) adding 100 mul Hoechst staining solution into each hole, incubating for 20min at room temperature in a dark place, and discarding the staining solution;

(10) the cells were washed 2 times with PBS and photographed under a microscope.

The experimental results are shown in FIG. 4, and it can be seen from FIG. 4 that Edu staining number of LINC02360 group is significantly lower than that of Control si-RNA group, further proving that inhibiting LINC02360 can inhibit proliferation of colon cancer cells.

Example 5

Western Blot to test the influence of LINC02360 on colon cancer cell proliferation related protein

(1) SW480 cells were seeded in 6-well cell plates and transfected according to lip2000 protocol, divided into control siRNA group, si-LINC02360 group, each set of 3 replicates;

(2) after transfection for 48h, adding 100 μ L RIPA cell lysate into each well, after sufficient lysis, scraping the cells with a cell scraper, collecting the cells with a pipette into an EP tube, and standing on ice at 4 ℃ for 30 min;

(3) centrifuging at 4 ℃ and 12000rpm/min for 30 minutes, sucking a supernatant, determining the protein concentration by using a BCA method, adding an SDS loading buffer solution to adjust the protein concentration to 2 mu g/mu L, and boiling in water bath at 100 ℃ for 5 minutes to obtain a protein sample;

(4) preparing 5% of upper layer glue and 12% of lower layer glue, and adding 10 mu L of protein sample into each hole to start electrophoresis after the preparation is finished;

(5) after electrophoresis, the membrane is rotated for 1.5 hours at 250 mA;

(6) after the membrane conversion is finished, taking out the NC membrane, and putting the NC membrane into 5% skimmed milk powder prepared by TBST for sealing for 1 h;

(7) incubate Cyclin D1 and P21, β -actin according to antibody instructions, overnight at 4 ℃;

(8) after the incubation is finished, the membrane is washed 3 times by using PBST, 5 minutes each time, and a secondary antibody is incubated for 1 h;

(9) after the incubation was completed, the membrane was washed 3 times for 5 minutes each with PBST and subjected to development exposure.

As can be seen from FIG. 5, the inhibition of LINC02360 can promote the expression of the antiproliferative protein P21 and can inhibit the expression of the antiproliferative protein cyclin-D1, which indicates that the inhibition of LINC02360 can inhibit the proliferation of colon cancer cells by regulating proliferation-related proteins.

Sequence listing

<110> Jinan Paswed Biotech Ltd

<120> a gene inhibitor for the preparation of a drug for inhibiting colon cancer cell proliferation

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggtagaggtg aagcttcgca 20

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acaccacgag acagtttagg a 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttcaccacca tggagaaggc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccacctggtg ctcagtgtag 20

<210> 5

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uucuccgaac gugucacgu 19

<210> 6

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acgugacacg uucggagaa 19

<210> 7

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaaugaugug aaugguuaac c 21

<210> 8

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

uuaaccauuc acaucauuca g 21

Claims

1. The application of the long-chain non-coding RNA LINC02360 gene inhibitor in preparing the medicine for inhibiting the proliferation of colon cancer cells is characterized in that the gene inhibitor is siRNA, the sequence of the sense strand of the siRNA is shown as SEQ ID NO.7, and the sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 8.