CN104152470A

CN104152470A - Application of Lilium regale pathogenesis-related protein 10 gene LrPR10-6

Info

Publication number: CN104152470A
Application number: CN201410396644.7A
Authority: CN
Inventors: 刘迪秋; 何华; 韩青; 季博; 葛锋; 陈朝银
Original assignee: Kunming University of Science and Technology
Current assignee: Kunming University of Science and Technology
Priority date: 2014-08-13
Filing date: 2014-08-13
Publication date: 2014-11-19
Anticipated expiration: 2034-08-13

Abstract

The present invention discloses application of a Lilium regale pathogenesis-related protein 10 gene LrPR10-6. LrPR10-6 has nucleotide sequence shown as SEQ ID NO:1 and encodes pathogenesis-related protein 10. Through research on functional genomics related technology, the invention has confirmed that LrPR10-6 gene has the function of improving fungi resistance of plants. The anti-fungal LrPR10-6 gene provided by the invention can be constructed into a plant expression vector and transferred to tobacco for over expression, so thaytthe transgenic tobacco plants gain strong in vitro antifungal activity. The experimental results show that the transgenic tobacco with overexpression of LrPR10-6 has significant inhibitory effect on Botrytis cinerea, Sclerotinia sclerotiorum and Fusarium oxysporum.

Description

The application of a kind of lilium regale wilson pathogenesis-related proteins 10 gene LrPR10-6

Technical field

The present invention relates to molecular biology and genetically engineered correlation technique research field, particularly a kind of lilium regale wilson pathogenesis-related proteins 10 genes with anti-mycotic activity lrPR10-6application.

Background technology

Plant diseases is very stubborn problem, especially a fungal disease in agriculture production, accounts for greatly 80% of the total disease of plant, has a strong impact on the yield and quality of farm crop.Tradition pest control method has been obtained certain effect, and main dependence cultivated resistant variety and use chemical pesticide, or takes the cropping systems such as crop rotation.All there is drawback more or less in these methods, as long in the traditional breeding method cycle, the residual height of chemical pesticide and easily to environment, use and waste time and energy etc., thereby the method that above-mentioned tradition is controlled Plant diseases can not thoroughly solve fungal disease problem.Along with foundation and the development of recombinant DNA technology, utilize the genetic engineering technique disease-resistant varieties that cultivates plants to obtain first-stage success, and be expected to fundamentally solve fungal disease problem.

Plant often suffers coercing of multiple biology and abiotic factor in growth and development process, as arid, cold, fungal infection etc., in evolutionary process, produce a series of defense mechanism and resisted environment stress, wherein the activation of pathogenesis-related proteins (pathogenesis-related protein, PR) and accumulation are the important component parts that plant participates in defensive raction.According to its structure, close source relation and biological activity, PR albumen is mainly divided into 17Ge family (PR1-PR17), is extensively present in single, double cotyledon plant.1988, (Somssich IE since finding PR10 first with exciton processing parsley culturing cell, Schmelzer E, Kawalleck P, et al. Gene structure and in situ transcript localization of pathogenesis-related protein 1 in parsley. Mol Gen Genet, 1988,213:93-98), in the plants such as capsicum, thorn eggplant and peanut, in succession find PR10 family member, but in the tissue of non-plant, do not find this albumen so far.Most of PR albumen is extracellular protein, and PR10 albumen is typical intracellular protein, is arranged in cytosol.In addition, PR10 also has the characteristics such as molecular weight lower (16-19 kDa), iso-electric point slant acidity and tertiary structure high conservative.PR10 and main trees pollen allergens and food allergen are quite similar, and belong to Bet v 1-like superfamily.The aminoacid sequence GXGGXG (X is arbitrary amino acid) that has a high conservative in its secondary structure, is called as " P-loop " motif.This motif is extensively present in nucleic acid binding protein, and its phosphorylation may be relevant with the ribonuclease activity of PR10.

As the induced component in plant defense system, PR10 is subject to the abduction delivering of multiple pathogenic bacteria.Capsicum caPR-10after inoculation tobacco mosaic virus (TMV), start great expression accumulation (Park CJ, Kim KJ, Shin R, et al. Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J, 2004,37:186-198).Peanut ahPR-10be subject to pathogeny evoked expression, pathogenic bacteria is had to selectivity simultaneously, its fusion rotein has and suppresses significantly (Chadha P the growth of Fusarium oxysporum and sheath blight fungus in vitro, Das R. A pathogenesis related protein, AhPR10 from peanut:an insight of its mode of antifungal activity. Planta, 2006,225:213-222).Thorn eggplant SsPR10 albumen also can suppress activity (Liu XJ, Huang BB, Lin J, et al. A novel pathogenesis-related protein (SsPR10) from of Pyricularia oryzae in vitro solanum surattensewith ribonucleolytic and antimicrobial activity is stress and pathogen-inducible. J Plant Physiol, 2006,163:546-555).Grape vrPR10.2the expression of gene can obviously suppress growth (He MY, Xu Y, Cao JL, the et al. Subcellular localization and functional analyses of a PR10 protein gene from of Plasmopara viticola vitis pseudoreticulatainresponse to plasmopara viticolainfection. Protoplasma, 2013,250:129-140).Pears PR-10.1 is imported to overexpression in potato, transgenic Rhizoma Solani tuber osi shows the resistance of verticillium wilt pathogen and pratylenchus (Chang MM, Chiang CC, Martin MW, et al. Expression of a pea disease resistance response gene in the potato cultivar shepody. Am Potato J, 1993,70:635-647).

Plant hormone and disease-resistant signaling molecule affect the expression pattern of PR10 gene.As Whitfield's ointment (salicylic acid, SA), jasmonic (jasmonic acid, JA), Plant hormones regulators,gibberellins (gibberellic acid, GA3), methyl jasmonate (Methyl jasmonate, MeJA), dormin (abscicis acid, ABA), ethene etc. all work in plant defense is replied.ABA mainly works in cold, high salt and drought stress, and JA to be plant be mechanically damaged and pathogen infection after main defensive substance.Paddy rice PR10 mRNA is subject to SA, JA and H ₂o ₂induction, but be not subject to induction (the Jwa NS of ABA and ethene, Kumar Agrawal G, Rakwal R, et al. Molecular cloning and characterization of a novel jasmonate inducible pathogenesis-related class 10 protein gene jIOsPR10, from rice ( oryza satival.) seedling leaves. Biochem Biophys Res Commun, 2001,286:973-983).

PR10 plays an important role when pathogenic bacteria is invaded, and PR10 has In Vitro Bacteriostatic, but its disease-resistant mechanism unintelligible.The antibacterial mechanism of most of PR10 is all considered to relevant with its nuclease.The expression of tobacco mosaic virus (TMV) induction CaPR-10, and the phosphorylation of CaPR-10 makes the ribonuclease activity of its lytic virus RNA increase (Park CJ, Kim KJ, Shin R, et al. Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J, 2004,37:186-198).The ginseng of ribonuclease activity will be there is pgPR10-2import in tobacco, find that transgene tobacco has improved the resistance of tomato early blight bacterium and anthrax bacteria (Pulla RK, Lee OR, In JG, et al. Expression and functional characterization of pathogenesisrelated protein family 10 gene pgPR10-2, from panax ginsengc.A. Meyer. Physiol Mol Plant P, 2010,74:323-329).Therefore, the ribonuclease activity of plant PR10 is relevant to anti-mycotic activity, and plays an important role in defense response.

Pathogenesis-related proteins 10 genes of the present invention lrPR10-6from lilium regale wilson ( lilium regalewilson).Lilium regale wilson has another name called regallity, per nnial herb, the lily endemic species of China.Only be distributed in the river valley of river western Minjiang River Basin height above sea level 800～2700m in the rock seam on hill-side, there is extremely strong disease resistance.

Summary of the invention

The object of this invention is to provide a kind of lilium regale wilson pathogenesis-related proteins 10 genes lrPR10-6application, improving tobacco to the application in Botrytis cinerea, Fusarium oxysporum, sclerotinite resistance, anti-fungal gene lrPR10-6nucleotide sequence as described in SEQ ID NO:1, this gene cDNA full length sequence is 696bp, 5 ' the non-translational region of the open reading frame that comprises a 474bp, 55bp, the 3 ' non-translational region of 167bp, the protein of coding aminoacid sequence as shown in SEQ ID NO:2.

Gene in the present invention lrPR10-6coding region be the nucleotide sequence shown in 56-529 position in sequence table SEQ ID NO:1.

The global cDNA fragment of an antimycotic genes involved of separating clone lilium regale wilson of the present invention, utilize and Agrobacterium tumefaciens mediated goal gene is proceeded in recipient plant and overexpression, by further experiment, verify whether this gene has antimycotic activity, the ability of resisting fungal disease for this improvement of genes tobacco of later-stage utilization and other plant lays the foundation, and contriver by this unnamed gene is lrPR10-6.

PR10 is that plant is subject to induce the class protein that produces and accumulate after biology or abiotic stress, is the important component part of plant defense system.When infected by phytopathogen, the expression amount of some PR10 genes significantly increases.In addition, plant hormone and signaling molecule also can make some PR10 gene up-regulated expressions, such as jasmonic, Whitfield's ointment, hydrogen peroxide, ethene, Plant hormones regulators,gibberellins etc.The bacteriostatic activity that the ribonuclease activity of plant PR10 has with it is closely related.

The present invention relates to separation comprises lrPR10-6dNA fragmentation and identify its function, the plant with this gene fragment has the phenotype of one or more fungal infections of opposing to a certain extent, wherein said DNA fragmentation, as shown in sequence table SEQ ID NO:1, carries out sequential analysis to this gene, finds lrPR10-6full-length cDNA is 696bp, the 3 ' UTR of the 5 ' non-translational region of the open reading frame that comprises a 474bp (ORF), 55bp (untranslated region, UTR) and 167bp, and wherein one of ORF coding has 157 amino acid whose protein. lrPR10-6proteins encoded has the conserved domain of PR10 albumen, and BLASTp result for retrieval shows lrPR10-6the protein of coding and the similarity of white trumpet lily PR10 (AAD17336.1) are 99%, similar to the PR10 albumen height of goatweed, wheat, jacinthe, Chinese sorghum, corn and other species, show that it belongs to the pathogenesis-related proteins 10 in lilium regale wilson.Protein shown in overexpression sequence table SEQ ID NO:2 can strengthen the resistance of tobacco to Botrytis cinerea, sclerotinite, Fusarium oxysporum.

Another object of the present invention is by lilium regale wilson pathogenesis-related proteins 10 genes lrPR10-6be applied in and improve tobacco in Botrytis cinerea, sclerotinite, Fusarium oxysporum resistance, concrete operations are as follows:

(1) adopt amplification lrPR10-6special primer, in the lilium regale wilson root from inoculation Fusarium oxysporum, extract total RNA, by reverse transcription-polymerase chain reaction (reverse transcription-polymerase chain reaction, RT-PCR), amplify lrPR10-6full length coding region, be then connected on pMD-18T carrier, through order-checking, obtain the clone with goal gene;

(2) use restriction enzyme bamhI and ecorI enzyme is cut pMD-18T- lrPR10-6carrier, is reclaimed and is obtained goal gene fragment by glue, and with same endonuclease digestion plant expression vector pCAMBIA2300s, glue reclaim to obtain required carrier large fragment, then by obtain lrPR10-6gene fragment is connected with pCAMBIA2300s fragment, builds plant overexpression vector, afterwards constructed recombinant vectors is expressed by Agrobacterium tumefaciens mediated proceeding in tobacco;

(3) the resistance marker screening transformant to have on recombinant vectors T-DNA, and detect and obtain real transfer-gen plant by PCR and RT-PCR, analyze transgenic plant albumen active to the inhibition of fungal growth, finally filter out the transfer-gen plant that fungus resistant is obviously strengthened.

The present invention provides a kind of new method for improving plant to the resistance of fungal disease, by genetic engineering means, cultivates the deficiency that disease-resistant plants can overcome traditional breeding method, and not only breeding cycle shortens, and simple to operate, easily obtains high resistance material.The present invention is from lilium regale wilson lrPR10-6gene can strengthen the resistance of plant to fungi, and this gene is imported in tobacco, can produce new variety and the novel material with fungus resistant.The importance of utilizing genetic engineering technique cultivation resistance plant kind and material to there is obvious advantage and do not replace.It not only can be provided convenience for scale operation crop, flowers etc., reduces in a large number the use of chemical pesticide, can also be cost-saving for agriculture production, reduce environmental pollution, so the present invention has wide market application foreground.

Accompanying drawing explanation

Fig. 1 is the present invention lrPR10-6the PCR detected result of transgene tobacco genomic dna, in figure: Marker is DL2000 DNA Marker (Dalian is precious biological); Positive control is plasmid pMD-18T- lrPR10-6pCR product for template; WT is that the total DNA of non-transgenic tobacco (wild-type) is the product of template PCR;

Fig. 2 is that the present invention is positive lrPR10-6in transgene tobacco lrPR10-6the expression analysis result figure of transcriptional level; In figure: Marker is DL2000 DNA Marker (Dalian is precious biological); WT is the PCR product that the total RNA reverse transcription of non-transgene tobacco cDNA is template; Positive control is plasmid pMD-18T- lrPR10-6pCR product for template;

Fig. 3 is the present invention lrPR10-6the fungistatic effect schematic diagram of transgene tobacco extracorporeal antifungal activity; A, b in figure, c, in fungi be respectively Botrytis cinerea, Fusarium oxysporum, sclerotinite; WT is the total protein of wild-type tobacco; CK is blank, without albumen contrast (for extracting the damping fluid of albumen).

Embodiment

Below by embodiment, the present invention is described in further detail, but content of the present invention is not limited to this, method all operations according to a conventional method if no special instructions in the present embodiment, the conventional reagent of agents useful for same employing if no special instructions or the according to a conventional method reagent of configuration.

Embodiment 1: lrPR10-6full-length gene clone and sequential analysis

With Fusarium oxysporum, inoculate lilium regale wilson, with the root after inoculation 24 h, extract total RNA, with liquid nitrogen by the root grind into powder of the lilium regale wilson of processing, then proceed in centrifuge tube, adopt guanidine isothiocyanate method to extract total RNA, adopt reversed transcriptive enzyme M-MLV (promega) to take total RNA as synthetic cDNA the first chain of template, reaction system and operating process are: get 5 μ g Total RNA, add successively 50 ng oligo (dT), 2 μ L dNTP (2.5mM each), DEPC water to reaction volume are 14.5 μ L; After mixing, after 70 ℃ of heat denatured 5min rapidly at cooled on ice 5min, then add successively 4 μ L 5 * First-stand buffer, 0.5 μ L RNasin (200U), 1 μ L M-MLV (200U), mix and centrifugal in short-term, 42 ℃ of temperature are bathed 1.5 h, take out rear 70 ℃ of heating 10 min, termination reaction.CDNA the first chain is synthetic to be placed on-20 ℃ and to save backup.

The the first chain cDNA synthesizing of take is template, amplifying target genes lrPR10-6, upstream and downstream primer sequence used is respectively 5 ' CCTCAGTCTATTCATAAACAATCATGTC3 ' and 5 ' CTCATCAACACACACAAACAC TCCA3 '.Adopt Advantage ^tM2 PCR Enzyme (Clontech) amplify goal gene; PCR reaction conditions: 95 ℃ of 2 min; 94 ℃ of 30 s, 58 ℃ of 30 s, 72 ℃ of 50 s, 30 circulations; 72 ℃ of 5 min; Reaction system (10 μ L) is 1 μ L cDNA, 1 μ L 10 * Advantage 2 PCR Buffer, 0.5 μ L 50 * dNTP Mix (10mM each), 0.2 μ L forward primer (10 μ M), 0.2 μ L reverse primer (10 μ M), 0.2 μ L Advantage 2 PCR Polymerase Mix, 6.9 μ L PCR-Grade water; After PCR finishes, get 5 μ L for agarose gel electrophoresis, in order to detect specificity and the size of amplified production.

Resulting PCR product only has a DNA band, therefore directly PCR product is carried out to TA clone, the test kit using is pMD18-T vector kit (Dalian is precious biological), reaction system and operating process are: get 1.5 μ L PCR products, add successively 1 μ L pMD18-T vector (50 ng/ μ L) and 2.5 μ L 2 * Ligation solution I, mix and be placed on 16 ℃ of reaction overnight.Adopt heat shock conversion method that connection product is proceeded in bacillus coli DH 5 alpha.The LB solid medium screening positive clone that use contains penbritin (ampicillin, Amp), selects several single bacterium colonies, shakes after bacterium with amplification lrPR10-6special primer identify multiple clone site and insert lrPR10-6clone, identified clone is checked order, final obtain lrPR10-6full-length cDNA is 696bp, by NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), analyzes and finds its opening code-reading frame that comprises a 474bp (seeing sequence table), lrPR10-6encode one and contain 157 amino acid whose Protein L rPR10-6, its molecular weight is about 16.7 KDa, and iso-electric point is about 5.31, contain 1 cysteine residues, be positioned at the 79th, so monomeric protein forms without disulfide linkage, by bioinformatics software SignalP 4.1, analyze lrPR10-6the protein sequence of coding does not detect N end signal peptide in LrPR10-6.

Embodiment 2: plant overexpression vector builds

Adopt extraction agent box (the raw work in Shanghai) the extraction insertion in a small amount of SanPrep pillar plasmid DNA lrPR10-6escherichia coli plasmid pMD-18T- lrPR10-6and the plasmid of plant expression vector pCAMBIA2300s, get 1 μ L for agarose gel electrophoresis to detect the integrity of the plasmid that extracted and concentration just; Use restriction enzyme ecorI (TaKaRa) and bamhI (TaKaRa) is respectively to plasmid pMD-18T- lrPR10-6carry out double digestion (100 μ L system) with pCAMBIA2300s, reaction system and operating process are: get 20 μ L pMD-18T- lrPR10-6with pCAMBIA2300s plasmid, add 10 μ L 10 * K buffer, 5 μ L successively ecorI, 5 μ L bamhI, 60 μ L ddH ₂o, centrifugal in short-term after mixing, be placed in 37 ℃ of reaction overnight; All enzymes are cut to product point and in sepharose, carry out electrophoresis, then right lrPR10-6fragment and pCAMBIA2300s carrier large fragment are carried out respectively glue recovery, and whole process is used SanPrep pillar DNA glue to reclaim test kit (the raw work in Shanghai); Get 1 μ L recovery product and by agarose gel electrophoresis, detect size and the concentration that reclaims fragment, all the other recovery products are placed in-20 ℃ and save backup.

Utilize T4 DNA Ligase (TaKaRa), by what reclaim lrPR10-6dNA fragmentation and pCAMBIA2300s carrier segments couple together, and reaction system (20 μ L) and operating process are: get 10 μ L lrPR10-6dNA fragmentation adds 2 μ L pCAMBIA2300s carrier DNAs, 2 μ L 10 * T4 DNA Ligase Buffer, 1 μ L T4 DNA Ligase, 5 μ L ddH successively ₂o, centrifugal in short-term after mixing, 16 ℃ of water-bath reaction overnight then.Then adopt heat shock conversion method that connection product is proceeded in bacillus coli DH 5 alpha, with the solid medium screening positive clone that contains 50 mg/L kantlex (kanamycin, Km).Select single bacterium colony and shake bacterium, take bacterium liquid as amplification for template lrPR10-6special primer carry out PCR, pick out lrPR10-6the clone who is successfully connected with pCAMBIA2300s, if the bacterial strain detecting is positive, adds glycerine and is placed in-80 ℃ to save backup.

Adopt the pCAMBIA2300s-in (the raw work in the Shanghai) extraction of SanPrep pillar plasmid extraction test kit the above-mentioned intestinal bacteria of purifying lrPR10-6plasmid.Use subsequently frozen-thawed method by the plant expression vector pCAMBIA2300s-of above-mentioned structure lrPR10-6proceed in agrobacterium tumefaciens lba4404 competent cell.Operation steps is: get 2 μ g pCAMBIA2300s- lrPR10-6plasmid adds in the centrifuge tube that contains 200 μ L competent cells, mix gently rear ice bath 5 min, proceed to subsequently freezing 1 min in liquid nitrogen, be then placed in rapidly 37 ℃ of water-bath 5 min, ice bath 2 min immediately, add 800 μ L LB liquid culture based on 28 ℃ of shaking culture 4 h afterwards.Agrobacterium after activation is applied on the LB solid medium that contains 50 mg/L Km to 28 ℃ of static cultivations.Select single bacterium colony and shake bacterium, then with increasing lrPR10-6auele Specific Primer carry out PCR, detect pCAMBIA2300s- lrPR10-6whether proceed in Agrobacterium, for positive colony, add glycerine to be placed on-80 ℃ and save backup.

Embodiment 3: agriculture bacillus mediated Genetic Transformation in Higher Plants and transgenic plant screening

The transgene receptor of this experiment is tobacco, by 75% alcohol-pickled 30 s for tobacco seed, with after sterilized water washing with the HgCl of 0.1 % ₂soak 8 min, and then wash several times with sterilized water, be seeded on 1/2 MS substratum, 28 ℃ of dark 6 d that cultivate, go to illumination box (25 ℃, 16h/d illumination) after germination, monthly use MS substratum subculture once later.

From-80 ℃ of refrigerators, take out the pCAMBIA2300s-that contains preserving lrPR10-6the Agrobacterium LBA4404 bacterial classification of plasmid, is inoculated in the LB liquid nutrient medium that 5 mL contain 50 mg/L Km and 20 mg/L Rifampins, and 28 ℃ are cultured to substratum muddiness.Draw the bacterium liquid of 1 mL muddiness to the LB solid medium that contains 50mg/L Km, cultivate 48 h for 28 ℃; Subsequently the Agrobacterium on LB solid medium is scraped in the MGL liquid nutrient medium that is inoculated in right amount the Syringylethanone that is attached with 20 mg/L, 28 ℃ of shaking culture 2-3 h are with activation Agrobacterium.

Get tobacco aseptic seedling leaf and be cut into 1 cm ²the leaf dish of left and right, be soaked in above-mentioned containing in the MGL liquid nutrient medium that activates Agrobacterium completely, immerged time is 15 min, with aseptic filter paper, blot the bacterium liquid of blade surface, leaf dish is placed in and on common substratum, carries out incubated at room temperature, the common substratum of Transformation of tobacco is MS+0.02 mg/L 6-BA+2.1 mg/L NAA+30 g/L sucrose+6 g/L agar, and 22 ℃ without cultivating altogether under optical condition 2 days.

Leaf dish after common cultivation is forwarded to and is added with seedling differentiation in antibiotic MS screening culture medium, simultaneously screening transgenic plant.Tobacco screening culture medium is g/L agar+50, MS+0.5 mg/L 6-BA+0.1 mg/L NAA+30 g/L sucrose+6 mg/L Km+200 mg/L cephamycins (cefotaxime sodium salt, Cef); During screening and culturing, culturing bottle is transferred to illumination box and cultivates (25 ℃, 16 h/d illumination, 8 h/d are dark), after growing bud, tobacco uses the MS substratum succeeding transfer culture that contains 50 mg/L Km and 200 mg/L Cef, because of tobacco callus differentiation rate higher, therefore need to further screen regeneration plant, tobacco regrowth is moved on the MS substratum that contains 50 mg/L Km it is taken root, finally select the good regrowth of taking root to carry out positive strain screening.

Adopt CTAB method to extract the genomic dna of transgenic tobacco plant blade, the genomic dna of extraction is got to 1 μ L and by agarose gel electrophoresis, detect its integrity and concentration, the genomic dna of transfer-gen plant of take is amplification for template lrPR10-6special primer carry out PCR, after PCR finishes, get 8 μ L products for agarose gel electrophoresis to detect positive transfer-gen plant, the amplification of Partial Tobacco transfer-gen plant as shown in Figure 1, lrPR10-6transgene tobacco screens the positive transfer-gen plant of 32 strains altogether.

Embodiment 4: in transgene tobacco lrPR10-6expression analysis and transfer-gen plant anti-mycotic activity analyze

The tender leaf of getting positive transgenosis individual plant and non-transgenic tobacco (wild-type) extracts total RNA, and reverse transcription generates cDNA the first chain, and as amplification for template lrPR10-6special primer carry out PCR, analyze in each transgenosis individual plant lrPR10-6the expression of transcriptional level, the method for total RNA extraction and RT-PCR is in the same manner as in Example 1, after PCR finishes, gets 5 μ L for agarose gel electrophoresis, and the detected result of part individual plant as shown in Figure 2, detects in 21 transgenosis individual plants altogether lrPR10-6in transcriptional level great expression, these individual plants be numbered 1～21.

Several fungies that laboratory is preserved are inoculated in PDA solid medium (200 g/L potatos, 15 g/L agar, 20 g/L glucose) on, 28 ℃ of dark cultivations, until colony growth, when being about 2 ~ 3cm, adds diameter albumen, analyze transfer-gen plant extracorporeal antifungal activity, for examination fungi, have 7 kinds: grape seat chamber bacterium ( botrosphaeria dothidea), Fusarium oxysporum ( fusarium oxysporum), the pathogen of Botrytis cinerea ( botrytis cinerea), chain lattice spore ( alternaria alternata), sclerotinite ( sclerotinia sclerotiorum), dry thread Pyrenomycetes ( rhizoctonia solani), colyliform sickle-like bacteria ( fusarium verticillioides).

For the albumen that prevents that other living contaminants from extracting, whole vegetable-protein leaching process is all aseptic techniques, first get 1 g transgene tobacco individual plant (numbering is respectively 2,5,8) and wild-type blade and put into mortar, add 1 mL protein extract (1M NaCl, 0.1M sodium acetate, 1% PVP, pH6), fully grind; Proceed in 1.5 mL centrifuge tubes, mix rear 4 ℃ of standing over night, 4 ℃ of centrifugal 30 min (12,000 g/min), get supernatant in 1.5 new mL centrifuge tubes, and get appropriate with uv-spectrophotometric instrument mensuration total protein concentration.The total protein concentration of transgenosis and wild-type plant is adjusted to 0.2 μ g/ μ L, then getting respectively 20 μ L drips on the aseptic filter paper of each fungi culture medium, on the flat board of each fungi except adding the total protein of different transgenic tobacco plants, the total protein of parallel interpolation wild-type tobacco of while and blank (extracting albumen solution used), 28 ℃ cultivate several days afterwards observation respectively process the situation of fungal growth, and evaluate accordingly lrPR10-6the extracorporeal antifungal activity of transgene tobacco, result as shown in Figure 3, lrPR10-6transgene tobacco albumen has very strong restraining effect to the growth of Botrytis cinerea, Fusarium oxysporum, sclerotinite.

Sequence table (SEQ ID)

<110> Kunming University of Science and Technology

<120> lilium regale wilson pathogenesis-related proteins 10 genes lrPR10-6application

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 696

<212> DNA

<213> Lilium regaleWilson

<220>

<221> mRNA

<222> (1)..(696)

<220>

<221> 5'UTR

<222> (1)..(55)

<220>

<221> CDS

<222> (56)..(529)

<220>

<221> 3'UTR

<222> (530)..(696)

<400> 1

acatggggac acctccctct tcttctaaat cacctcagtc tattcataaa caatcatgtc 60

ttggtctgtt gtgatcgagt ctccggtgtc agcacctagg ctctacaggg cggccatcct 120

cgactggcac accctcggcc ccaagcttgt accggagatc atctccagcg gtacaggcga 180

aagtggagat ggtggcgccg ggagtgtcag gcagctcaac ttcacctcag tgatgccatt 240

tagctacgtg aaggaacgct tggactttgt cgaccatgag aagtttgaat gccagtcgac 300

cattattgaa ggtggtcact tggggacgag gcttgagtct gcctccgccc acttcaaggt 360

ggaaccaaca agtgctggcg ggagcatcgt cacggtcact accagcaata agcccctccc 420

gggtattgag gctgatgaag gagtcattgc cgcttcaaag ggggcaatgg agaaacattt 480

cagggctgct gaagcctacc tcctcgccaa ccctgatgca tatgtttagt gccgtgtgtt 540

tggggtcttt tggagtgttt gtgtgtgttg atgagaagct tgtgaaattg taccttgctt 600

gtgttttccc ttgtcaagac tgtcgaagta tttggcagct tgaatcaaca ggaataatca 660

aagtgtgtga gtgttcttaa aaaaaaaaaa aaaaaa 696

<210> 2

<211> 157

<212> PRT

<213> Lilium regaleWilson

<400> 2

Met Ser Trp Ser Val Val Ile Glu Ser Pro Val Ser Ala Pro Arg Leu

1 5 10 15

Tyr Arg Ala Ala Ile Leu Asp Trp His Thr Leu Gly Pro Lys Leu Val

20 25 30

Pro Glu Ile Ile Ser Ser Gly Thr Gly Glu Ser Gly Asp Gly Gly Ala

35 40 45

Gly Ser Val Arg Gln Leu Asn Phe Thr Ser Val Met Pro Phe Ser Tyr

50 55 60

Val Lys Glu Arg Leu Asp Phe Val Asp His Glu Lys Phe Glu Cys Gln

65 70 75 80

Ser Thr Ile Ile Glu Gly Gly His Leu Gly Thr Arg Leu Glu Ser Ala

85 90 95

Ser Ala His Phe Lys Val Glu Pro Thr Ser Ala Gly Gly Ser Ile Val

100 105 110

Thr Val Thr Thr Ser Asn Lys Pro Leu Pro Gly Ile Glu Ala Asp Glu

115 120 125

Gly Val Ile Ala Ala Ser Lys Gly Ala Met Glu Lys His Phe Arg Ala

130 135 140

Ala Glu Ala Tyr Leu Leu Ala Asn Pro Asp Ala Tyr Val

145 150 155

<210> 3

<211> 28

<212> DNA

<213> artificial sequence

<400> 3

cctcagtcta ttcataaaca atcatgtc 28

<210> 4

<211> 25

<212> DNA

<213> artificial sequence

<400> 4

ctcatcaaca cacacaaaca ctcca 25

Claims

1. lilium regale wilson pathogenesis-related proteins 10 genes lrPR10-6improving tobacco to the application in Botrytis cinerea, Fusarium oxysporum, sclerotinite resistance, wherein said lilium regale wilson anti-fungal gene lrPR10-6nucleotide sequence as shown in SEQ ID NO:1.

2. lilium regale wilson pathogenesis-related proteins 10 genes according to claim 1 lrPR10-6application, the concrete operations of fungus resistant that it is characterized in that improving tobacco are as follows:

(1) by said gene lrPR10-6pCAMBIA2300s is connected with plant expression vector, builds plant overexpression vector;

(2) recombinant vectors of above-mentioned structure is proceeded in tobacco by Agrobacterium tumefaciens mediated;

(3) with the resistance marker having on recombinant vectors T-DNA, screen transformant, and obtain positive transfer-gen plant by polymerase chain reaction, analyze transgene tobacco albumen active to the inhibition of fungal growth, finally filter out the transgenic tobacco plant that fungus resistant is obviously strengthened.