CN104152451A - Primer and method for molecular identification of new whitebait species in Taihu Lake - Google Patents

Abstract

The invention discloses a primer and a method for molecular identification of new whitebait species in Taihu Lake, which belong to the molecular biology DNA mark field. The primer sequence is ND5L (5'-CTTGGTGCAAATCCAAGCAGGAAC-3), ND5R(5'-GCTTACTCGTGGCCTGAGCCGA-3'); The identification method comprises the following steps: 1)using the primer pair for PCR amplification on total DNA of a new whitebait experiment specimen in Taihu Lake, 2)purifying the PCR products, copying and cloning, and sequencing to obtain a ND5 gene complete sequence; 3)comparing the experiment specimen with the ND5 gene complete sequence of related species to construct a standard flow biological genealogical tree; 4)acquiring the complete sequence of gene of a fish sample to be detected by the above method, adding the sequence in the step 3) to reconstruct a detection flow biological genealogical tree; and 5)analyzing and comparing. The primer and method are used for accurately identifying and classifying species with non morphology, and provide scientific identification basis for artificial culture and hybridization of species as well as genetic research.

Description

A kind of primer and method of neosalanx taihuensis species molecule qualification

Technical field

The invention belongs to molecular biology DNA marker technical field, more particularly, relate to a kind of primer and method of neosalanx taihuensis species molecule qualification.

Background technology

Silverfish (icefishes) is a kind of important economic fish of China.In in 17 kinds, state-owned world silverfish 15 kinds, wherein 6 kinds is Chinese endemic species.Neosalanx taihuensis (Neosalanx taihuensi) is kind of a more common silverfish, is Chinese endemic species, belongs to Salangidae (Salangidae) Neosalanx (Neosalanx).

Silverfish has higher nutritive value and economic worth: the fresh silverfish edible portion of every hectogram is containing 8.2 grams, protein, 0.3 gram, fat, 1.4 grams, carbohydrate, 258 milligrams of calcium etc.Full fish can be used as medicine, and its meat nature and flavor are sweet, flat, have the effect of nourishing kidney tonifying, stomach invigorating qi-restoratives, beneficial lung, sharp water; Can be used for treating diarrhea due to hypofunction of the spleen, nutritive deficiency, maldigestion, children's's sore is amassed and is waited disease.Silverfish is one of important outlet fishery products of China, finds a good sale in Europe, Asia, various countries of U.S., is described as in the international market " soft gold ".

The germ plasm resource qualification necessity of neosalanx taihuensis: the silverfish natural resource of China because reclaiming land from a lake, the impact continuous downturn of the many factors such as overfishing, environmental pollution and Habitat Fragmentation, the natural resource of various silverfishes all decline to some extent, species distribution scope is significantly dwindled, indivedual species are gradually endangered, and the output of neosalanx taihuensis also declines year by year.Therefore the germ plasm resource of neosalanx taihuensis qualification, numerously support, hybridization and genetic diversity conservation become very important.On the other hand, still there are a lot of disputes in the classification of salangids, and the sibship of each Salangidae species of classifying according to morphology and waters is also very chaotic.Especially the close large silverfish of economic fish neosalanx taihuensis species and morphology; the classification qualification of nearly neosalanx taihuensis and few tooth silverfish is very difficult; this cultivates extraordinary silverfish, species hybridization, and the productions such as artificially breeding and genetic diversity conservation and scientific research bring inconvenience.Therefore, utilize Molecular tools qualification and classification Salangidae species very necessary, identification of means is very succinct and science also.

Contriver once participated in the paper " determination and analysis and the sibship research thereof of 2 kinds of silverfish plastosome CO II and flank tRNA gene " that research is delivered, the 38th the 3rd phase of volume of May in 2008, be published in " Chinese Marine University's journal ", 4 kinds of silverfishes and sweetfish mtDNA-COⅡ gene sequence variations and their sibship are inquired into, measure and analyze silverfish mtDNA-COⅡ gene complete sequence and flank tRNA gene order, and and sequence alignment, it is carried out to genealogical tree reconstruction by NJ method and MP method, deduce the sibship between species, for molecule foundation is sought in the phylogenetic systematics of silverfish, in paper, primer used is

YaL(5’-TCAGCCACATAACCGCTCTG-3’)；

YaR (5 '-CTTCTAGGAGGCGGAATTG-3 ') and

YbL(5’-CTGTAATTCTTATCCTCAT-3’)；

YbR(5’-GCTGGGTTGAGTTGAGGCATG-3’)。

Thereby but contriver's later stage find in studying to utilize above-mentioned primer to detect in the process that silverfish mtDNA-COⅡ gene builds biosystem tree, primer amplification is not very stable, PCR product result is enough inaccurate, want to identify accurately silverfish kind, need to redesign a kind of primer that can stablize amplification.

Summary of the invention

1. the technical problem that invention will solve

The present invention, for improving existing silverfish classification and authenticate technology, provides a kind of primer and method of neosalanx taihuensis species molecule qualification.Adopt technical scheme of the present invention, by measuring and analyze the mitochondrial ND5 gene sequence of silverfish, deduce the sibship between species, and then obtain the classification appraisal basis of its science.

2. technical scheme

For achieving the above object, technical scheme provided by the invention is:

Primer and the method for a kind of neosalanx taihuensis species molecule qualification of the present invention, contriver chooses neosalanx taihuensis mitochondrial ND5 gene design primer, and primer sequence is as follows:

ND5L：5’-CTTGGTGCAAATCCAAGCAGGAAC-3’(SEQ?ID?NO.1)

ND5R：5’-GCTTACTCGTGGCCTGAGCCGA-3’(SEQ?ID?NO.2)。

Utilize the method for the primer pair neosalanx taihuensis species molecule qualification of above-mentioned mitochondrial ND5 gene, as following step:

Step 1, structure normal stream biosystem tree

(1) carry out pcr amplification with total DNA of primer pair neosalanx taihuensis experimental specimen described in claim 1, obtain PCR product;

(2) by PCR product purification, proceed to plasmid vector and copy clone, bacterium liquid is checked order, obtain ND5 gene complete sequence;

(3) neosalanx taihuensis experimental specimen is compared to the ND5 gene complete sequence of relevant nearly edge species, utilize MEGA6.0 software building NJ method normal stream biosystem tree;

Step 2, structure detect stream biosystem tree

(4) according to step 1 method, obtain the mitochondrial ND5 gene complete sequence of fish sample to be measured, this sequence is added to step (3), rebuild and detect stream biosystem tree;

(5) analysis and comparison normal stream biosystem tree is set with detecting stream biosystem, identifies whether sample to be tested is neosalanx taihuensis.

Preferably, pcr amplification reaction volume is 25 μ l, template DNA 1 μ l (containing 10～50ng); PCR cycle annealing temperature: 55 DEG C.

The mitochondrial ND5 gene primer of the present invention's design obtains as follows:

A, obtains 3 of the plastosome complete sequences of the nearly edge species of neosalanx taihuensis from NCBI; Utilize ClustalXv1.83 to do the comparison of ND5 two terminal sequences, find out the conservative section about the 200bp of two ends, as primer candidate regions;

B, utilize OLIGO v6 software to analyze candidate regions sequence, primer sequence selection condition: select length in 20bp left and right, GC content 50% left and right, the primer annealing temperature of software prediction is at 50-55 degree Celsius, between primer, do not form hairpin structure, primer may increase the primer efficiency of the sequence of other positions in complete sequence lower than 200.Meet after these requirements, we select 1 pair, and upstream and downstream primer, as the final primer of pcr amplification, is ND5L of the present invention, ND5R sequence.

The principle of authentication method of the present invention is:

Choose the moderate mitochondrial ND5 gene design primer of evolutionary rate in neosalanx taihuensis and carry out pcr amplification, by the PCR product purification of acquisition, proceed to plasmid vector and copy clone, and bacterium liquid is checked order, obtain ND5 gene complete sequence; Then according to gene sequencing result, the gene order of neosalanx taihuensis, relevant nearly edge species and sample to be measured is constructed to biosystem tree, thereby determine whether sample to be measured is neosalanx taihuensis, with other silverfishes or the sibship of neosalanx taihuensis.

3. beneficial effect

Adopt technical scheme provided by the invention, compared with prior art, there is following unusual effect:

(1) primer and the method for a kind of neosalanx taihuensis species molecule qualification of the present invention; compared with learning with traditional form; molecular assay method science, accurate; easy handling; biological specimen is identified to have ubiquity; scientific and repeatable, the sibship of Fast Measurement fish sample to be measured and neosalanx taihuensis, for the qualification of sibship data judging between the species of neosalanx taihuensis and resource, numerously support, hybridization and genetic diversity conservation provide foundation.

(2) primer and the method for a kind of neosalanx taihuensis species molecule qualification of the present invention, choose the mitochondrial ND5 gene of neosalanx taihuensis, compared with the mtDNA-COⅡ gene of choosing in contriver's paper before, the result obtaining is more stable, the primer PCR of design, can stablize amplification, PCR is long-PCR, and PCR product is accurately reliable.

(3) primer and the method for a kind of neosalanx taihuensis species molecule qualification of the present invention, by building normal stream biosystem tree and increase testing sample gene the method that rebuilds biosystem tree, not only identifying and inferring whether species to be measured are neosalanx taihuensis, there is more accurate advantage with the sibship aspect of other silverfishes or neosalanx taihuensis, can also can carry out the reproduction of sibship for the silverfish of any unknown kind, and being further used for their classification, the scope of application is wide.

Brief description of the drawings

Fig. 1 is the schematic flow sheet of neosalanx taihuensis species molecule authentication method in the present invention;

Fig. 2 is the general flow chart of neosalanx taihuensis species molecule authentication method in the present invention;

Fig. 3 is the biosystem tree design of graphics of embodiment 1 in the present invention.

Embodiment

For further understanding content of the present invention, by reference to the accompanying drawings and embodiment the present invention is described in detail.

Embodiment 1

As shown in Figure 1, the method steps that a kind of neosalanx taihuensis species molecule of the present invention is identified is:

Step 1, structure normal stream biosystem tree

Acquisition neosalanx taihuensis is complete, fresh individual specimen, with the indoor sample contrast of Huainan Normal University's zoological specimens qualification, tentatively confirm as neosalanx taihuensis sample, again according to neosalanx taihuensis morphological feature (tongue and tooth quantity and position, the position of fin and fin ray number), utilize anatomical lens and microscope to carry out Morphological Identification, confirm species, and set it as neosalanx taihuensis standard sample, this fresh muscle tissue of laboratory label taking, adopt SDS/ protease cracking, the total DNA of phenol chloroform extraction, agarose gel electrophoresis detects, with the total DNA content of spectrophotometric determination.

(1) with reference to nearly edge species correlated series, design neosalanx taihuensis mitochondrial ND5 gene primer, sequence is as follows:

ND5L：5’-CTTGGTGCAAATCCAAGCAGGAAC-3’(SEQ?ID?NO.1)

ND5R：5’-GCTTACTCGTGGCCTGAGCCGA-3’(SEQ?ID?NO.2)。

Carry out pcr amplification with total DNA of above-mentioned primer pair neosalanx taihuensis experimental specimen, obtain PCR product; Pcr amplification reaction volume is 25 μ l, template DNA 1 μ l (containing 10～50ng); PCR cycle annealing temperature: 55 DEG C.

(2) by PCR product process biotinylation kit purifying, proceed to plasmid vector and copy clone, bacterium liquid is checked order, specifically in the present embodiment, give Shanghai biotech firm to the examining order of bacterium liquid gene, obtain ND5 gene complete sequence.

The concrete Nucleotide of ND5 gene complete sequence of neosalanx taihuensis is as follows: 1824bp

//atgtaccccctcaccaccattttaaactcctcgctagtactgatcttcgctcttctcctcttccccttgttcaccacggc

taacaaacactgggccctaacgcacgtcaacaccgcaatcaaagccgcattcctcgtcagccttatccccctctctgttt

tcctcgactctggggttgaaacagttgtctgtgcctgacaatgaatctgcacccgcacctttgacattagcatcagcttt

aaatttgacctttactccctcatcttcacccccgtcgctctttatgtaacatgagcaatcttagaattcgcccgctgata

tatacatgcagaccccaacatgaaccgattcttcaaatgccttctcctcttcctagtggcaatgattattatggtaacag

ccaacaacatgttccaactctttattggctgggaaggcattggtatcatgtcttttctactcatcgactgatgagacggg

cgagcagatgccggcgccgctgcccttcaggccgtcctatacaaccgagttggagacatcggacttgttcttagcatagc

ttgattcgctgtaaatctaaactcttgagacatagagcaaatatctgtgtcttcccaagaccttgacctcaccctccccc

tcataggcctaatcctggcagccactgcaaaatccgcgcaattcggcctccacccctgactccccgcggctatagaaggc

cctactcctgtctccgccctgcttcactccagcacaatggtggtcgcaggagtattccttctagtccggactagccctat

aatagaaaacaaccccatagcccttactacctgcttatgcctgggggccctcaccactctctttgccgccacctgcgctc

tgacccaaaacgacattaaaaaaatcgtcgccttctccacctcaagccagctcggactaatgatagtcgctgtcggtctt

aaccaaccacagctcgctttcctccatatctgcacacacgcatttttcaaagccatactgttcttgtgctcaggatcaat

tatccacagcctaaatgatgaacaggacattcggaagatgggaggcctaagcaacctcgcccccttcacctcctcttgcc

tcgctatcggcagcctcgccctcacagggacccccttcctggcaggcttcttctcaaaagacgccatcatggaagcttta

aacacatcttacctgaacgcctgagccctggccctcaccctcctagccacctccttcaccgcaatctatagccttcgtgt

ggcctactttgtagccatgggccacccccgatccccagccctctcccccatcaacgaaaataacccctgcgttattaacc

ccattaaacgcctcgccttaggaagcatcattgccggcctcctaatcacctccaacctcctcccctccaaaacccctgtc

ttaactatgccccccctcctcaaacttagcgcccttgtagtaactgtcatcggccttctcacagccctagaactcgcctc

cttgacttccaaacaatttaagacctccccctctctcaccccccacaacttctctaacatgctaggatttttccccgcaa

tcatccatcgatcaatcccctactgaagcctcttcctcggacaaacagttgcgagccaaatgcttgacaaaacatgattc

gagaaagtcggccccaaggcaatatccactatcaacctgcctgcagcttccaccactgccgaccttcaccagggcataat

caaaacctatctgtccctattccttctgacagtcgtcttggctattatcctgcccctcatctaa//(SEQ?ID?NO.3)

(3) utilize biometric database NCBI to obtain the corresponding sequence of relevant nearly edge species, utilize biosoftware clusterW that neosalanx taihuensis experimental specimen is compared to the ND5 gene complete sequence of relevant nearly edge species, based on mitochondrial ND5 gene nucleotide sequence, utilize MEGA6.0 software building NJ method normal stream biosystem tree; Determine the classification position of neosalanx taihuensis.

Step 2, structure detect stream biosystem tree

(4) the muscle sample of 2 definite species X of unknown silverfish of acquisition and Y, according to step 1 method, extract respectively their DNA, utilize above-mentioned ND5L and their mitochondrial ND5 gene of ND5R primer amplification, after order-checking, obtain 2 mitochondrial ND5 gene complete sequences.This sequence is added to step (3), rebuild and detect stream biosystem tree, (as shown in Figure 3).

(5) analysis and comparison normal stream biosystem tree and the tree-like difference of detection stream biosystem, identify whether sample to be tested is neosalanx taihuensis, muscle sample X and known neosalanx taihuensis form a monosystem group, can be judged as neosalanx taihuensis, muscle sample Y and known neosalanx taihuensis can not form a monosystem group, be not neosalanx taihuensis, but it form a monosystem group with large silverfish, is large silverfish.

A kind of neosalanx taihuensis species molecule authentication method of the present invention, all there is variation in species and between planting in the mitochondrial ND5 gene of neosalanx taihuensis and other species, by sequence alignment, checks mutation frequency, can build biosystem tree, qualification species.And comparatively reliable according to the primer ND5L of its design and ND5R, can stablize amplification at neosalanx taihuensis and in about the colony of nearly edge species fish, PCR is long-PCR, the PCR product obtaining is stable, make the species discriminating of neosalanx taihuensis more accurate, and the structure of setting by biosystem determine that the sibship of species is more accurately apparent.

Below schematically the present invention and embodiment thereof are described, this description does not have restricted, and shown in accompanying drawing is also one of embodiments of the present invention, and actual situation is not limited to this.So, if those of ordinary skill in the art is enlightened by it, in the situation that not departing from the invention aim, without the creationary frame mode similar to this technical scheme and the embodiment of designing, all should belong to protection scope of the present invention.

Claims (3)

1. a primer for neosalanx taihuensis species molecule qualification, its feature exists: described primer sequence is as follows:

ND5L：5’-CTTGGTGCAAATCCAAGCAGGAAC-3’

ND5R：5’-GCTTACTCGTGGCCTGAGCCGA-3’。

2. a method for neosalanx taihuensis species molecule qualification, is characterized in that: comprise the steps:

Step 1, structure normal stream biosystem tree

(1) carry out pcr amplification with the total DNA of primer pair neosalanx taihuensis experimental specimen described in claim 1, obtain PCR product;

(2) by PCR product purification, proceed to plasmid vector and copy clone, bacterium liquid is checked order, obtain ND5 gene complete sequence;

(3) neosalanx taihuensis experimental specimen is compared to the ND5 gene complete sequence of relevant nearly edge species, utilize MEGA6.0 software building NJ method normal stream biosystem tree;

Step 2, structure detect stream biosystem tree

(4) according to step 1 method, obtain the mitochondrial ND5 gene complete sequence of fish sample to be measured, this sequence is added to step (3), rebuild and detect stream biosystem tree;

(5) analysis and comparison normal stream biosystem tree is set with detecting stream biosystem, identifies whether sample to be tested is neosalanx taihuensis.

3. the method for a kind of neosalanx taihuensis species molecule qualification according to claim 2, is characterized in that: pcr amplification reaction volume is 25 μ l, template DNA 1 μ l, and template DNA is containing 10～50ng; PCR cycle annealing temperature: 55 DEG C.