CN104131099B - The method of Fast Monitoring miscegenation Yeast proliferation - Google Patents
The method of Fast Monitoring miscegenation Yeast proliferation Download PDFInfo
- Publication number
- CN104131099B CN104131099B CN201410362636.0A CN201410362636A CN104131099B CN 104131099 B CN104131099 B CN 104131099B CN 201410362636 A CN201410362636 A CN 201410362636A CN 104131099 B CN104131099 B CN 104131099B
- Authority
- CN
- China
- Prior art keywords
- yeast
- miscegenation
- capillary electrophoresis
- peak
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 240000004808 Saccharomyces cerevisiae Species 0.000 title claims abstract description 161
- 238000000034 method Methods 0.000 title claims abstract description 26
- 230000035755 proliferation Effects 0.000 title claims abstract description 21
- 238000012544 monitoring process Methods 0.000 title claims abstract description 18
- 238000005251 capillar electrophoresis Methods 0.000 claims abstract description 42
- 238000001514 detection method Methods 0.000 claims abstract description 36
- 238000000855 fermentation Methods 0.000 claims abstract description 34
- 230000004151 fermentation Effects 0.000 claims abstract description 34
- 238000004519 manufacturing process Methods 0.000 claims abstract description 27
- 238000013461 design Methods 0.000 claims abstract description 25
- 239000007788 liquid Substances 0.000 claims abstract description 22
- 238000012408 PCR amplification Methods 0.000 claims abstract description 13
- 235000014680 Saccharomyces cerevisiae Nutrition 0.000 claims description 108
- 239000012634 fragment Substances 0.000 claims description 27
- 238000002156 mixing Methods 0.000 claims description 27
- 244000285963 Kluyveromyces fragilis Species 0.000 claims description 24
- 235000014663 Kluyveromyces fragilis Nutrition 0.000 claims description 24
- 238000010790 dilution Methods 0.000 claims description 14
- 239000012895 dilution Substances 0.000 claims description 14
- 239000012530 fluid Substances 0.000 claims description 8
- 108020004707 nucleic acids Proteins 0.000 claims description 7
- 150000007523 nucleic acids Chemical class 0.000 claims description 7
- 102000039446 nucleic acids Human genes 0.000 claims description 7
- 230000003321 amplification Effects 0.000 claims description 6
- 239000000284 extract Substances 0.000 claims description 6
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 108090000623 proteins and genes Proteins 0.000 claims description 5
- 238000003860 storage Methods 0.000 claims description 5
- 239000000872 buffer Substances 0.000 claims description 3
- 238000013016 damping Methods 0.000 claims description 3
- 239000011259 mixed solution Substances 0.000 claims description 3
- 235000013405 beer Nutrition 0.000 abstract description 11
- 238000012252 genetic analysis Methods 0.000 abstract description 3
- 230000008569 process Effects 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 11
- 241001123227 Saccharomyces pastorianus Species 0.000 description 6
- 239000000203 mixture Substances 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 4
- 241000209140 Triticum Species 0.000 description 3
- 235000021307 Triticum Nutrition 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 235000011389 fruit/vegetable juice Nutrition 0.000 description 3
- 238000011002 quantification Methods 0.000 description 3
- TVZRAEYQIKYCPH-UHFFFAOYSA-N 3-(trimethylsilyl)propane-1-sulfonic acid Chemical compound C[Si](C)(C)CCCS(O)(=O)=O TVZRAEYQIKYCPH-UHFFFAOYSA-N 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 230000001419 dependent effect Effects 0.000 description 2
- 239000000796 flavoring agent Substances 0.000 description 2
- 235000019634 flavors Nutrition 0.000 description 2
- 239000012160 loading buffer Substances 0.000 description 2
- VNWKTOKETHGBQD-UHFFFAOYSA-N methane Natural products C VNWKTOKETHGBQD-UHFFFAOYSA-N 0.000 description 2
- -1 methane amide Chemical class 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 240000005979 Hordeum vulgare Species 0.000 description 1
- 235000007340 Hordeum vulgare Nutrition 0.000 description 1
- 235000008694 Humulus lupulus Nutrition 0.000 description 1
- 108091092878 Microsatellite Proteins 0.000 description 1
- 229920002472 Starch Polymers 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 235000015095 lager Nutrition 0.000 description 1
- 238000012423 maintenance Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000008558 metabolic pathway by substance Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000004064 recycling Methods 0.000 description 1
- 235000019698 starch Nutrition 0.000 description 1
- 239000008107 starch Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the detection method based on GeXP genetic analysis systems (principle is capillary electrophoresis technique) platform, for rule of proliferation and the miscegenation ratio of the miscegenation yeast of beer.The method of Fast Monitoring miscegenation Yeast proliferation, comprises design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve, in real time monitor fermentation liquid and optimizes miscegenation yeast ratio.According to this method, researchist can understand influencing each other between the growth curve of different yeast in miscegenation fermenting process and rule of proliferation and different yeast, thus further for regulation and control miscegenation ratio with keep best leavening property to provide technical guarantee.
Description
Technical field
The invention belongs to detection method, be specifically related to the detection method of yeast, particularly relate to a kind of rule of proliferation of the miscegenation yeast for beer and the detection method of miscegenation ratio.
Background technology
Beer be with barley through the Fructus Hordei Germinatus made of germinateing for main raw material, through saccharification, add hops, beer yeast fermenting brew, carbonated, low ethanol concn, the brewing wine that bubbles.Beer brewing, be actually starch converted to be called as " wheat juice " containing sugar liquors, wort fermentation becomes containing spirituous beer by recycling yeast.Beer fermentation process be cereuisiae fermentum under certain conditions, utilize the fermentability material in wheat juice and the normal activities of carrying out, the product of its metabolism is exactly desired product---beer.But common beer utilizes purebred cereuisiae fermentum to be carried out fermenting making by wheat juice, and taste is comparatively single, and nourishing function is also limited.
In order to promote the mouthfeel of beer, research staff uses miscegenation yeast to carry out the research of beer fermentation.Study the impact of miscegenation yeast fermentation for the quality of beer brewing, need the exploitation monitoring rule of proliferation of different yeast and the change of miscegenation ratio.This will contribute to understanding influencing each other between the growth curve of different yeast in miscegenation fermenting process and rule of proliferation and different yeast, thus further for regulation and control miscegenation ratio and the best leavening property of maintenance provide technical guarantee, but, also there is no so a kind of detection method at present.
Summary of the invention
The invention provides the detection method based on GeXP genetic analysis systems (principle is capillary electrophoresis technique) platform, for rule of proliferation and the miscegenation ratio of the miscegenation yeast of beer.
Technical scheme of the present invention:
The method of Fast Monitoring miscegenation Yeast proliferation, comprises design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve, in real time monitor fermentation liquid and optimizes miscegenation yeast ratio.Concrete detecting step is as follows:
1. design of primers: the differential fragment in search Lager beer yeast gene group sequence, and the primer of different yeast is distinguished according to differential fragment design; The amplified fragments of the amplified production that designed upstream and downstream primer pair is answered has total fragment and the characteristic fragment of different yeast simultaneously; Ensure that amplified fragments reaches the requirement of GeXP capillary electrophoresis detection and has total peak and characteristic peak simultaneously; Every bar primer is mixed with the storage liquid of 100 μMs respectively, is diluted to the working fluid of 200nM during use;
2. pcr amplification reaction: respectively by the primer preparation PCR reaction system that 1. the pure species yeast DNA extracted and step design, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer, to be checked after PCR primer being diluted 50 times;
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast; Concrete steps comprise:
A. get DSS400 (in molecular weight mark-400), add 80 times of volume SLS (sample-loading buffer, methane amide), vortex oscillator shakes 30S, is transferred in the hole of model;
B. get 0.6 μ lPCR product dilution to be added to and point to be equipped with in the hole of the upper model of SLS and the DSS mixed solution of 40 μ l, cover a dropstone wax oil with after liquid-transfering gun mixing;
C. in each hole of damping fluid plate, add the dissociating buffer of 250 μ l;
D. machine of going up carries out GeXP capillary electrophoresis detection (using Freg-3 separation method), utilizes GeXP system parameter to analyze capillary electrophoresis result, record result;
4. production standard curve: (a) extracts the DNA of pure species yeast respectively, detect nucleic acid concentration and be diluted to same concentrations, by different volumes than mixing, the mass percent namely obtaining the pure species yeast possessing characteristic peak is followed successively by the miscegenation cerevisiae dna of 0,20%, 40%, 60%, 80%, 100%; B () miscegenation yeast to different mixing proportion carries out the detection of GeXP capillary electrophoresis, obtain the peak height H of characteristic peak
tand two primary yeast have the peak height H at peak
b; C () is according to blending ratio and H
t/ H
bratio, production standard curve;
5. real-time monitor fermentation liquid: the yeast samples DNA extracting miscegenation fermentation, carries out PCR reaction, the PCR primer after dilution is carried out the detection of GeXP capillary electrophoresis, obtains the H detecting sample
t/ H
bratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts.
Preferably, described two kinds of pure species yeast are yeast L830 and yeast L053, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
Preferably, described two kinds of pure species yeast are yeast L830 and yeast L820, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
Preferably, described two kinds of pure species yeast are yeast L830 and yeast WP3470, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
Wherein, the Latin name of L830 is called Saccharomycespastorianus, buys from U.S. WhiteLabs, is numbered WLP830GERMANLAGERYEAST.The Latin name of L053 is called Saccharomycespastorianus, buys from VTT Teknologian Tutkimuskeskus of Finland, is numbered A-78053.The Latin name of L820 is called Saccharomycespastorianus, buys from U.S. WhiteLabs, is numbered WLP820OKTOBERFEST/
lAGERYEAST.The Latin name of WP3470 is called Saccharomycespastorianus, buys the fragrant high professional college of the base of a fruit of bestowing favour certainly German Wei, is numbered Weihenstephan34/70.
Beneficial effect of the present invention: a kind of method that the invention provides rule of proliferation of Fast Monitoring miscegenation yeast and the change of miscegenation ratio.According to this method, researchist can understand influencing each other between the growth curve of different yeast in miscegenation fermenting process and rule of proliferation and different yeast, thus further for regulation and control miscegenation ratio with keep best leavening property to provide technical guarantee.
Accompanying drawing explanation
Fig. 1 is the detected peaks figure of pure species yeast L830;
Fig. 2 is the detected peaks figure of pure species yeast L053;
Fig. 3 is the detected peaks figure of pure species yeast L820;
Fig. 4 is the detected peaks figure of pure species yeast WP3470;
Fig. 5 is miscegenation ratio according to L830 and L053 and characteristic peak ratios H
289/ H
286the typical curve made;
Fig. 6 be the ratio of yeast in L830-L053 miscegenation system over time;
Fig. 7 is miscegenation ratio according to L830 and L820 and characteristic peak ratios H
289/ H
286the typical curve made;
Fig. 8 be the ratio of yeast in L830-L820 miscegenation system over time;
Fig. 9 is miscegenation ratio according to L830 and WP3470 and characteristic peak ratios H
289/ H
286the typical curve made;
Figure 10 be the ratio of yeast in L830-WP3470 miscegenation system over time.
Embodiment
Below in conjunction with accompanying drawing, the present invention is described further.
Embodiment 1:
Select L830 yeast and L053 yeast to carry out the 10L fermenting experiment of miscegenation fermentation, after fermentation starts, 64h, 70.5h, 92h, 160h, 280h get fermented liquid and carry out miscegenation yeast detection respectively.
1. design of primers: use the microsatellite sequence (SSR) in SSRHunter software search Lager cereuisiae fermentum (Saccharomycespastorianus) genome sequence and design corresponding primer, its partial sequence is:
AGCTCGCGCAGCAAAACCCGCTGCCAGAGCCACTGCTAGCGCCAACACCAAATCGGAAGACATGAAATACCTGTTGTCCGGCTACGATTACTTCGACGTGAGCGTGTCCGGTTGAGTTTATGCTGAGTTTTTGCGCATCAATATTATTTTTACTACTACTACTACTACTACTACTACTACTACTACATACTATTAAATATACTAAATAAGAGGAAAACGCTTTGGAAGTGACTGGCGCCGCCGCTGGCTACTATAATAGCAGCGACTGTAATTTAATCTCATCCCGTCATTTGGATTACCTCTTTTACTCGC……
In sequence, italic overstriking place is design primer position, and after two ends add GeXP special joint separately, total length primer sequence is:
Upstream primer: 5 '-AGGTGACACTATAGAATACACCAAATCGGAAGACA-3 '
Downstream primer: 5 '-GTACGACTCACTATAGGGAAAATGACGGGATGAGAT-3 '
Every bar primer is mixed with respectively the storage liquid of 100 μMs, during use, is diluted to the working fluid of 200nM.
2. pcr amplification reaction: the primer preparation PCR reaction system adopting pure species yeast and step 1. to design respectively, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer, to be checked after PCR primer being diluted 50 times; RocheDNA extraction test kit (HighPurePCRTemplatePreparationKit, Cat.No.11796828001) is used to extract the DNA of miscegenation yeast samples.The composition of PCR reaction system refers to table 1, and PCR response procedures refers to table 2.
The composition of table 1PCR reaction system
Table 2PCR response procedures
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast; Wherein, what GeXP capillary electrophoresis detected employing is the GeXP genetic analysis systems that Beckman produces.Reagent in following concrete steps is all in the test kit appended by this instrument self; Concrete steps comprise:
A. get DSS400 (in molecular weight mark-400), add 80 times of volume SLS (sample-loading buffer, methane amide), vortex oscillator shakes 30S, is transferred in the hole of model;
B. get 0.6 μ lPCR product dilution to be added to and point to be equipped with in the hole of the upper model of SLS and the DSS mixed solution of 40 μ l, cover a dropstone wax oil with after liquid-transfering gun mixing;
C. in each hole of damping fluid plate, add the dissociating buffer of 250 μ l;
D. machine of going up carries out GeXP capillary electrophoresis detection (using Freg-3 separation method), utilizes GeXP system parameter to analyze capillary electrophoresis result, record result; The principal product peak of 286bp has all been there is from the pcr amplification product of Fig. 1 and Fig. 2, L830 yeast and L053 yeast.Meanwhile, have also appeared the characteristic peak of 289bp, and do not detect this characteristic peak in L053 in L830, therefore, the characteristic peak at 289bp place may be used for differentiation two primary yeast.
4. production standard curve: the DNA extracting pure species yeast respectively, detect nucleic acid concentration, mix by different volumes respectively after being diluted to same concentrations, the mass percent namely obtaining the pure species yeast possessing characteristic peak is followed successively by the miscegenation cerevisiae dna of 0,20%, 40%, 60%, 80%, 100%.GeXP detection is carried out to the miscegenation yeast that the L830 yeast-L053 yeast of different ratios forms, according to the characteristic peak ratios H of miscegenation ratio and relative quantification
289/ H
286production standard curve, is shown in Fig. 5.
The formula that matching obtains is: y=0.2707x+0.0595, R2=0.9621.Therefore, the linearly dependent coefficient of typical curve reaches 0.9621, shows that the monitoring method accuracy utilizing GeXP technology to set up is higher.
5. real-time monitor fermentation liquid: the detection of GeXP capillary electrophoresis is carried out to the yeast samples of the miscegenation fermentation that the L830 yeast-L053 yeast of different time forms, obtains the H detecting sample
289/ H
286ratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts, the results detailed in Fig. 6.As shown in Figure 6, L830 proportion is high, and improves constantly along with time lapse, progressively reaches about 70%.The growth showing under fermentation conditions L830 yeast comparatively L053 is preponderated, and in leavening property and flavour substances generation etc., shared by L830, weight is also larger.
Embodiment 2:
As different from Example 1, embodiment 2 selects L830 yeast and L820 yeast to carry out the 10L fermenting experiment of miscegenation fermentation, and after fermentation starts, 64h, 70.5h, 92h, 160h, 280h get fermented liquid and carry out miscegenation yeast detection respectively.
4. production standard curve: the DNA extracting pure species yeast respectively, detect nucleic acid concentration, mix by different volumes respectively after being diluted to same concentrations, the mass percent namely obtaining the pure species yeast possessing characteristic peak is followed successively by the miscegenation cerevisiae dna of 0,20%, 40%, 60%, 80%, 100%.GeXP detection is carried out to the miscegenation yeast that the L830 yeast-L820 yeast of different ratios forms, according to the characteristic peak ratios H of miscegenation ratio and relative quantification
289/ H
286production standard curve, is shown in Fig. 7.The formula that matching obtains is: y=0.0027x+0.0457, R2=0.9994.The linearly dependent coefficient of typical curve reaches 0.9994, shows that the monitoring method accuracy utilizing GeXP technology to set up is higher.
5. real-time monitor fermentation liquid: the detection of GeXP capillary electrophoresis is carried out to the yeast samples of the miscegenation fermentation that the L830 yeast-L820 yeast of different time forms, obtains the H detecting sample
289/ H
286ratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts, the results detailed in Fig. 8.As shown in Figure 8, quite (about 50%), the later stage, L830's 92h the former two's ratio gradually preponderated, and was stabilized in about 57%.Show in fermentation early stage, two primary yeast energy for growth are suitable, but along with the development of course of fermentation, the growth vigor of L830 embodies gradually, and occupy an leading position in the leavening property of phase and substance metabolism aspect after fermentation.
Embodiment 3:
As different from Example 1, select L830 yeast and WP3470 yeast to carry out the 10L fermenting experiment of miscegenation fermentation, after fermentation starts, 64h, 70.5h, 92h, 160h, 280h get fermented liquid and carry out miscegenation yeast detection respectively.
4. production standard curve: the DNA extracting pure species yeast respectively, detect nucleic acid concentration, mix by different volumes respectively after being diluted to same concentrations, the mass percent namely obtaining the pure species yeast possessing characteristic peak is followed successively by the miscegenation cerevisiae dna of 0,20%, 40%, 60%, 80%, 100%.GeXP detection is carried out to the miscegenation yeast that the L830 yeast-WP3470 yeast of different ratios forms, according to the characteristic peak ratios H of miscegenation ratio and relative quantification
289/ H
286production standard curve, is shown in Fig. 9.
The formula that matching obtains is y=22776/ (65316x+6769); R
2=0.97384, the relation conefficient of typical curve reaches 0.97384, shows that the monitoring method accuracy utilizing GeXP technology to set up is higher.
5. real-time monitor fermentation liquid: the detection of GeXP capillary electrophoresis is carried out to the yeast samples of the miscegenation fermentation that the L830 yeast-WP3470 yeast of different time forms, obtains the H detecting sample
289/ H
286ratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts, the results detailed in Figure 10.As shown in Figure 10, WP3470 proportion is high, and improves constantly along with time lapse, progressively reaches about 80%.The growth showing under fermentation conditions WP3470 yeast comparatively L830 is preponderated, and constantly increases along with the advantage of carrying out of fermentation, and in leavening property and flavour substances generation etc., shared by WP3470, weight is larger.
Claims (9)
1. the method for Fast Monitoring miscegenation Yeast proliferation, is characterized in that: comprise design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve and real-time monitor fermentation liquid; Concrete detecting step is as follows:
1. design of primers: the differential fragment in search Lager beer yeast gene group sequence, and the primer of different yeast is distinguished according to differential fragment design; The amplified fragments of the amplified production that designed upstream and downstream primer pair is answered has total fragment and the characteristic fragment of different yeast simultaneously; Ensure that amplified fragments reaches the requirement of GeXP capillary electrophoresis detection and has total peak and characteristic peak simultaneously;
2. pcr amplification reaction: respectively by the primer preparation PCR reaction system that 1. the pure species yeast DNA extracted and step design, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer;
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast;
4. production standard curve: (a) extracts the DNA of two kinds of pure species yeast, the two mixed according to different ratios, obtain the miscegenation cerevisiae dna of different mixing proportion, described blending ratio is mass percent; B () miscegenation yeast to different mixing proportion carries out the detection of GeXP capillary electrophoresis, obtain the peak height H of characteristic peak
tand two primary yeast have the peak height H at peak
b; C () is according to blending ratio and H
t/ H
bratio, production standard curve;
5. real-time monitor fermentation liquid: extract DNA to the miscegenation fermented sample be made up of step two kinds of pure species yeast 4., carry out PCR reaction, the PCR primer after dilution is carried out the detection of GeXP capillary electrophoresis, obtains the H detecting sample
t/ H
bratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts in yeast.
2. the method for Fast Monitoring miscegenation Yeast proliferation according to claim 1, is characterized in that: described two kinds of pure species yeast are yeast L830 and yeast L053, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
3. the method for Fast Monitoring miscegenation Yeast proliferation according to claim 1, is characterized in that: described two kinds of pure species yeast are yeast L830 and yeast L820, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
4. the method for Fast Monitoring miscegenation Yeast proliferation according to claim 1, it is characterized in that: described two kinds of pure species yeast are yeast L830 and yeast WP3470, the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
5. the method for Fast Monitoring miscegenation Yeast proliferation, is characterized in that: comprise design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve and real-time monitor fermentation liquid; Concrete detecting step is as follows:
1. design of primers: the differential fragment in search Lager beer yeast gene group sequence, and the primer of different yeast is distinguished according to differential fragment design; The amplified fragments of the amplified production that designed upstream and downstream primer pair is answered has total fragment and the characteristic fragment of different yeast simultaneously; Every bar primer is mixed with the storage liquid of 100 μMs respectively, is diluted to the working fluid of 200nM during use;
2. pcr amplification reaction: respectively by the primer preparation PCR reaction system that 1. the pure species yeast DNA extracted and step design, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer;
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast;
4. production standard curve: (a) is the DNA extracting pure species yeast respectively, detects nucleic acid concentration and is diluted to same concentrations, by different volumes than mixing, namely obtains the miscegenation cerevisiae dna of different mass ratio; B () miscegenation yeast to different mixing proportion carries out the detection of GeXP capillary electrophoresis, obtain the peak height H of characteristic peak
tand two primary yeast have the peak height H at peak
b; C () is according to blending ratio and H
t/ H
bratio, production standard curve;
5. real-time monitor fermentation liquid: extract DNA to the miscegenation fermented sample be made up of step two kinds of pure species yeast 4., carry out PCR reaction, the PCR primer after dilution is carried out the detection of GeXP capillary electrophoresis, obtains the H detecting sample
t/ H
bratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts in yeast; Described two kinds of pure species yeast are yeast L830 and yeast L053, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
6. the method for Fast Monitoring miscegenation Yeast proliferation, is characterized in that: comprise design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve and real-time monitor fermentation liquid; Concrete detecting step is as follows:
1. design of primers: the differential fragment in search Lager beer yeast gene group sequence, and the primer of different yeast is distinguished according to differential fragment design; The amplified fragments of the amplified production that designed upstream and downstream primer pair is answered has total fragment and the characteristic fragment of different yeast simultaneously; Every bar primer is mixed with the storage liquid of 100 μMs respectively, is diluted to the working fluid of 200nM during use;
2. pcr amplification reaction: respectively by the primer preparation PCR reaction system that 1. the pure species yeast DNA extracted and step design, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer;
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast;
4. production standard curve: (a) is the DNA extracting pure species yeast respectively, detects nucleic acid concentration and is diluted to same concentrations, by different volumes than mixing, namely obtains the miscegenation cerevisiae dna of different mass ratio; B () miscegenation yeast to different mixing proportion carries out the detection of GeXP capillary electrophoresis, obtain the peak height H of characteristic peak
tand two primary yeast have the peak height H at peak
b; C () is according to blending ratio and H
t/ H
bratio, production standard curve;
5. real-time monitor fermentation liquid: extract DNA to the miscegenation fermented sample be made up of step two kinds of pure species yeast 4., carry out PCR reaction, the PCR primer after dilution is carried out the detection of GeXP capillary electrophoresis, obtains the H detecting sample
t/ H
bratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts in yeast; Described two kinds of pure species yeast are yeast L830 and yeast L820, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
7. the method for Fast Monitoring miscegenation Yeast proliferation, is characterized in that: comprise design of primers, pcr amplification reaction, the detection of GeXP capillary electrophoresis, production standard curve and real-time monitor fermentation liquid; Concrete detecting step is as follows:
1. design of primers: the differential fragment in search Lager beer yeast gene group sequence, and the primer of different yeast is distinguished according to differential fragment design; The amplified fragments of the amplified production that designed upstream and downstream primer pair is answered has total fragment and the characteristic fragment of different yeast simultaneously; Every bar primer is mixed with the storage liquid of 100 μMs respectively, is diluted to the working fluid of 200nM during use;
2. pcr amplification reaction: respectively by the primer preparation PCR reaction system that 1. the pure species yeast DNA extracted and step design, upper PCR reacts instrument, and amplification obtains the specific product of different pure species yeast, is PCR primer;
3. GeXP capillary electrophoresis detects: the PCR primer after adopting GeXP capillary electrophoresis to detect dilution is also analyzed, and determines the characteristic peak of pure species yeast;
4. production standard curve: (a) is the DNA extracting pure species yeast respectively, detects nucleic acid concentration and is diluted to same concentrations, by different volumes than mixing, namely obtains the miscegenation cerevisiae dna of different mass ratio; B () miscegenation yeast to different mixing proportion carries out the detection of GeXP capillary electrophoresis, obtain the peak height H of characteristic peak
tand two primary yeast have the peak height H at peak
b; C () is according to blending ratio and H
t/ H
bratio, production standard curve;
5. real-time monitor fermentation liquid: extract DNA to the miscegenation fermented sample be made up of step two kinds of pure species yeast 4., carry out PCR reaction, the PCR primer after dilution is carried out the detection of GeXP capillary electrophoresis, obtains the H detecting sample
t/ H
bratio, the typical curve 4. made by step calculates the blending ratio of two primary yeasts in yeast; Described two kinds of pure species yeast are yeast L830 and yeast WP3470, and the characteristic peak of described yeast L830 is positioned at 289bp, and the total peak of described two primary yeasts is positioned at 286bp.
8. according to the method for the Fast Monitoring miscegenation Yeast proliferation in claim 5-7 described in any one, it is characterized in that: in described miscegenation yeast, the mass percent possessing the yeast of characteristic peak is followed successively by 0,20%, 40%, 60%, 80%, 100%.
9. according to the method for the Fast Monitoring miscegenation Yeast proliferation in claim 2-4 described in any one, it is characterized in that: described GeXP capillary electrophoresis detects and comprises following step:
1. get DSS400, add 80 times of volume SLS, vortex oscillator shakes 30S, be transferred in the hole of model;
2. get the PCR primer after 0.6 μ l dilution, add in the hole of the upper model that 40 μ lSLS-DSS mixed solutions are housed, cover a dropstone wax oil with after liquid-transfering gun mixing;
3. in each hole of damping fluid plate, add the dissociating buffer of 250 μ l;
4. machine of going up carries out the detection of GeXP capillary electrophoresis and records result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410362636.0A CN104131099B (en) | 2014-07-28 | 2014-07-28 | The method of Fast Monitoring miscegenation Yeast proliferation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410362636.0A CN104131099B (en) | 2014-07-28 | 2014-07-28 | The method of Fast Monitoring miscegenation Yeast proliferation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104131099A CN104131099A (en) | 2014-11-05 |
| CN104131099B true CN104131099B (en) | 2016-03-23 |
Family
ID=51803948
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410362636.0A Active CN104131099B (en) | 2014-07-28 | 2014-07-28 | The method of Fast Monitoring miscegenation Yeast proliferation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104131099B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434837B (en) * | 2016-10-13 | 2019-11-12 | 山东农业大学 | A kind of method of quick detection plasmogen beer yeast |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101405411A (en) * | 2006-01-23 | 2009-04-08 | 斯蒂鲁斯全球解决方案有限公司 | High throughput testing for presence of microorganisms in a biological sample |
| CN103361439A (en) * | 2013-07-30 | 2013-10-23 | 青岛啤酒股份有限公司 | Method for integrated detection of nine beer-spoilage bacteria |
| CN103627805A (en) * | 2013-12-03 | 2014-03-12 | 青岛啤酒股份有限公司 | Method for rapidly detecting industrial saccharomyces pastorianus higher alcohol metabolizing genes |
-
2014
- 2014-07-28 CN CN201410362636.0A patent/CN104131099B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101405411A (en) * | 2006-01-23 | 2009-04-08 | 斯蒂鲁斯全球解决方案有限公司 | High throughput testing for presence of microorganisms in a biological sample |
| CN103361439A (en) * | 2013-07-30 | 2013-10-23 | 青岛啤酒股份有限公司 | Method for integrated detection of nine beer-spoilage bacteria |
| CN103627805A (en) * | 2013-12-03 | 2014-03-12 | 青岛啤酒股份有限公司 | Method for rapidly detecting industrial saccharomyces pastorianus higher alcohol metabolizing genes |
Non-Patent Citations (3)
| Title |
|---|
| Fast and sensitive detection of genetically modified yeasts in wine;Leon C et al.;《J chromatogra A》;20110122;第1218卷(第42期);7550-7556 * |
| 利用微卫星多态性揭示酿酒酵母菌株遗传多样性;冯敏等;《中国农业科学》;20120616;第45卷(第12期);2537-2543 * |
| 微卫星在酿酒酵母研究中的应用;冯敏等;《食品科学》;20130315;第34卷(第5期);270-273 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104131099A (en) | 2014-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102226155B (en) | Screening and application of yeast with high ethanol yield and low fusel oil yield in Chinese Maotai-flavor liquor production | |
| Arnold et al. | Assessing the impact of corn variety and Texas terroir on flavor and alcohol yield in new-make bourbon whiskey | |
| JP6812197B2 (en) | Beer taste beverage | |
| CN104263848A (en) | Deafness susceptibility gene mutation detection kit as well as preparation method and application thereof | |
| CN102154503A (en) | Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe | |
| CN102181530B (en) | Kit for detecting DNA residues of CHO cell and using method thereof | |
| CN104131099B (en) | The method of Fast Monitoring miscegenation Yeast proliferation | |
| Liu et al. | Determination of ethanol content in kombucha products by gas chromatography with flame ionization detection: a multilaboratory study | |
| CN105063028A (en) | SSR (simple sequence repeat) primer group and method for constructing malt fingerprint maps by aid of primer group | |
| Guadalupe-Daqui et al. | The effect of CO2 concentration on yeast fermentation: rates, metabolic products, and yeast stress indicators | |
| CN112695120A (en) | Primer, kit and method for rapid identification and quantification of saccharomyces cerevisiae | |
| CN106701746B (en) | High-throughput malt Purity technology based on Capillary Electrophoresis and SSR marker | |
| CN103627815B (en) | Method for rapidly detecting industrial saccharomyces pastorianus ester metabolism genes | |
| CN103562372A (en) | Mixed distilled liquor and method for producing same | |
| CN103627805B (en) | Method for rapidly detecting industrial saccharomyces pastorianus higher alcohol metabolizing genes | |
| CN116219054A (en) | Malt PYF regulation and control method based on wheat making process gene expression and application thereof | |
| CN102766583B (en) | Screening and application of yeast CGMCC (china general microbiological culture collection center) 4748 with high ethanol yield and low fusel oil yield in production of Chinese Maotai-flavor liquor | |
| CN108913755B (en) | Multiple primers, kit and detection method for detecting fermentation conditions affecting expression quantity of saccharomyces cerevisiae protease A gene | |
| CN210560447U (en) | Separating device for degrading ethyl carbamate yeast | |
| CN113637788B (en) | Method for constructing recombinant plasmid to absolutely quantify fungi in sample | |
| Marcado Acevedo | COMPARISON OF A PORTABLE BEER MEASURING DEVICE AGAINST STANDARD METHODS; AND BEER RECIPE DESIGN: RATIOS AND BOTTLE CONDITIONING | |
| Tyrell et al. | Screening of brewery yeast strains regarding organic acid profile in order to find low succinic acid producer | |
| JP4787605B2 (en) | Yeast fermentation method | |
| CN108913807B (en) | Multiple primers, kit and screening method for screening yeast strains with low protease A gene expression | |
| CN108866167A (en) | Multi-primers, kit and evaluation method for evaluating beer yeast activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |