CN104120138B - A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof - Google Patents
A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof Download PDFInfo
- Publication number
- CN104120138B CN104120138B CN201410358406.7A CN201410358406A CN104120138B CN 104120138 B CN104120138 B CN 104120138B CN 201410358406 A CN201410358406 A CN 201410358406A CN 104120138 B CN104120138 B CN 104120138B
- Authority
- CN
- China
- Prior art keywords
- gene
- atpgk2
- arabidopsis
- plant
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention has cloned a kind of arabidopsis glycerol 3-phosphate kinase gene strengthening plant salt endurance<i>atPGK2</i>, and disclose its application。The nucleotide sequence of this gene, such as shown in SEQ ID NO:1, also includes and SEQ ID NO:1 nucleotide sequence homology gene between 90～100%。The present invention additionally provides the structure of recombinant vector and transgene method to apply said gene simultaneously, can cultivate the transgenic plant new varieties that salt tolerance is higher, be with a wide range of applications。
Description
[technical field]: the invention belongs to plant genetic engineering field, specifically utilizes Protocols in Molecular Biology to obtain a kind of Gene A tPGK2 that can strengthen plant salt endurance and the application in transgenic plant thereof。
[background technology]: the soil salinization is all extremely serious in the whole world, salt stress is one of the important abiotic stress of impact whole world crop yield (ParvaizandSatyawati, 2008)。China's salinized soil area is big, distribution is wide, type is many, account for the 10% of area, and salinization of soil every year and Secondary Saline are all constantly increasing the weight of, the sustainable development making agricultural production is on the hazard, have a strong impact on the growth promoter of plant and the yield and quality (Sun Jianchang etc., 2008) of industrial crops。Therefore, the transgenic crop new varieties cultivating salt tolerance enhancing are very urgent tasks。
Plant genetic engineering refers in vitro, utilizes toolenzyme that DNA molecular carries out " montage " and " splicing " and forms the DNA molecular of restructuring, is converted plant cell and make it express。At present, plant genetic engineering is utilized to cultivate the transgenic plant new varieties of salt tolerance enhancing achieved with certain progress。Many studies have shown that, the salt-resistant related gene of plant imported the cell of self or other species and produces transfer-gen plant, it is possible to being obviously enhanced the salt resistance ability of transgenic plant。As in arabidopsis the ZmCBL4 gene of overexpression Semen Maydis can improve transfer-gen plant at germination period and Seedling Stage the toleration (Wangetal., 2007) to salt stress；Chen etc. (2008) utilize constitutive promoter CaMV35S to drive arabidopsis AtNHX1 gene overexpression in Semen Fagopyri Esculenti, and in transgenic Semen Fagopyri Esculenti plant, the content of main nutrient composition is not by the impact of high-salt stress；Liang etc. (1997) utilize BADH gene overexpression in tobacco plant of CaMV35S promoters driven Herba Spinaciae, and the salt tolerance of transgene tobacco significantly improves。
Glycerol 3-phosphate acid kinase (the 3-Phosphoglyceratekinase of plant, PGK) as important enzyme catalysis 3-phoshoglyceric acid and 1, change between 3-diphosphoglyceric acid, have in carbon fixation, glycolysis and glyconeogenesis metabolism critical function (BlakeandRice, 1981;Watsonetal., 1982)。At present, the gene of many coding PGKs is cloned (WatsonandLittlechild, 1990) in plant, animal and microorganism。In plant, such as Semen Pisi sativi (PacoldandAnderson, 1975), Semen Tritici aestivi (Longstaffetal., 1989), Fructus Hordei Vulgaris (McMorrowandBradbeer, 1990), Herba Spinaciae (Kopke-Secundoetal., and the PGKs of Fructus Lycopersici esculenti (Raoetal., 1995) etc. is successively separated and clone, and the albumen majority of its coding is purified for enzymatic activity research 1990)。Sequence analysis shows, the PGKs of higher plant is encoded by two cell nucleus gene, the aminoacid sequence of its encoding proteins has higher homology, wherein, the transit peptides being positioned chloroplast that the aminoacid sequence of one gene code is about made up of 70 aminoacid by one section at N-end, on the contrary, the aminoacid sequence of another gene code there is no transit peptide sequence at N-end。Thus it is speculated that two PGKs encoded by higher plant cell core be respectively positioned in chloroplast and Cytoplasm (Longstaffetal., 1989;KitayamaandTogasaki, 1995)。The enzymatic activity research majority of the separation of higher plant PGKs gene, clone, sequence analysis and its encoding proteins is concentrated on the later stage in last century by the above。Enter this century, although there are some researches show in the recent period under condition of salt stress, in plant the content of PGK albumen dramatically increase (Kosovaetal., 2011;Wangetal., 2013), but the function for its physiological function particularly involved in plant response salt stress is unclear。
Plant is for adapting to salt stress, to reduce the salt stress injury to self to greatest extent, from the expression to the perception of salt stress signal, intracellular signal transmission and intracellular signal transduction to final regulation and control stress response gene, make plant produce a series of forms, physiology and biochemistry change to resist salt stress (Zhu, 2002;JiangandDeyholos, 2006;Radietal., 2013)。In order to excavate plant salt tolerance gene and cultivate the transgenic plant that salt tolerance strengthens, the present invention has cloned arabidopsis coding glycerol 3-phosphate kinase gene AtPGK2, by this gene transformation model plant arabidopsis, it has been found that the toleration of salt stress is remarkably reinforced by transgenic Arabidopsis plants。
[summary of the invention]: the present invention seeks to separate the resistant gene of salt with clone plant, and its function participating in salt stress response is identified, it is provided that a kind of molecular biology model plant arabidopsis glycerol 3-phosphate kinase gene AtPGK2 and the application in transgenic plant thereof。
The invention provides a kind of arabidopsis glycerol 3-phosphate kinase gene AtPGK2 sequence new, 1437bp, the nucleotide sequence of this gene is selected from the nucleotide sequence as shown in sequence table SEQ IDNO:1。As the example of concrete application, the invention provides the cloning process of a kind of arabidopsis coding glycerol 3-phosphate kinase gene AtPGK2, concrete operation step is as follows:
(1) total serum IgE the reverse transcription of extracting Arabidopsis plant are cDNA；
(2) with cDNA for template, the CDS sequence of AtPGK2 gene is expanded by PCR method；
(3) pcr amplification product is reclaimed。
Invention also provides the arabidopsis glycerol 3-phosphate kinase gene AtPGK2 application coerced at plant salt endurance, that is: the CDS sequence of the AtPGK2 gene of clone is utilized, build the fusion gene of " CaMV35S-AtPGK2 ", carry out Plant Transformation, thus obtaining the transgenic plant of constitutive expression AtPGK2 genes of interest in arabidopsis。The wherein said genes of interest in fusion gene can be any genes of interest needed for the improvement of basic research, transformation technology, flowers or crops salt-tolerance character。
As the example of concrete application, the invention provides the application building and participating at transgenic arabidopsis salt stress of one " CaMV35S-AtPGK2 " fusion gene。Specific operation process is as follows:
(1) the CDS sequence fragment of the AtPGK2 gene of pcr amplification is passed through with NcoI/BstEII double digestion；
(2) with NcoI/BstEII double digestion pCAMBIA1301(purchased from CAMBIA company) plasmid, reclaims big carrier segments；
(3) the CDS sequence fragment of the AtPGK2 gene that the above-mentioned first step obtains is mixed and pCAMBIA1301 carrier large fragment that second step obtains, under ligase catalysis, it is attached reaction, completes the structure of " CaMV35S-AtPGK2 " fusion gene on pCAMBIA1301 carrier。
The pcr amplification primer of the CDS sequence of wherein designed AtPGK2 gene is as follows, and wherein forward primer introduces NcoI restriction enzyme site, and downstream primer introduces BstEII restriction enzyme site:
Forward primer: 5 '-CATGCCATGGCTTCCACCGCCGCAACTGCA-3’
Downstream primer: 5 '-GGGTAACCTTAAACAGTGACTGGCGTTGCT-3’。
The structure of " CaMV35S-AtPGK2 " fusion gene in described application constitutive expression in transgenic arabidopsis is expressed, and operating process is as follows:
The concrete grammar of transformation of Arabidopsis thaliana, adopts the method (CloughandBent, 1998) of agriculture bacillus mediated Floraldip, it is thus achieved that seed through 50mgl-1Hygromycin resistance screen, grow normal resistant plant turn earth culture support, utilize 50mgl-1Hygromycin carry out resistance screening obtain convert AtPGK2 gene homozygous transgenic arabidopsis strain, then detect transgenic arabidopsis strain salt tolerance。
The positive effect of the present invention:
Result of the test shows, by the coding glycerol 3-phosphate kinase gene AtPGK2 transformation mode plant Arabidopsis thaliana of clone, it is possible to significantly improve the salt tolerance of transfer-gen plant。The Fusion gene construction " CaMV35S-AtPGK2 " of the present invention can use in agricultural production as genetic resources or selection-breeding transgenic plant is to improve salt tolerance, is with a wide range of applications。
[accompanying drawing explanation]
Fig. 1 converts the expression analysis of genes of interest AtPGK2 in the transgenic arabidopsis strain of " CaMV35S-AtPGK2 " fusion gene, * * P 0.01。
Fig. 2 is the Salt Tolerance Analysis of the transgenic arabidopsis strain Seedling Stage converting " CaMV35S-AtPGK2 " fusion gene。
Fig. 3 is that the transgenic arabidopsis strain converting " CaMV35S-AtPGK2 " fusion gene becomes the Salt Tolerance Analysis in seedling stage。* P 0.05。
[detailed description of the invention]
Embodiment 1: the clone of arabidopsis coding glycerol 3-phosphate kinase gene AtPGK2
(1) utilizing different sulphuric acid nitrile guanidine-phenol method to extract the total serum IgE of Arabidopsis plant, the use of medicine, preparation and concrete operation step are with reference to the method for (2002) such as Huang Peitang。
(2) the CDS sequential design special primer according to known arabidopsis AtPGK2 gene, introduces NcoI restriction enzyme site in forward primer, introduces BstEII restriction enzyme site in downstream primer。
Forward primer: 5 '-CATGCCATGGCTTCCACCGCCGCAACTGCA-3 ' (introduces NcoI restriction enzyme site)
Downstream primer: 5 '-GGGTAACCTTAAACAGTGACTGGCGTTGCT-3 ' (introduces BstEII restriction enzyme site)
(3) 1 is takenGRNA makes the template of reverse transcription, with P2853The reverse transcription ImProm-II of Promega is utilized for primerTMCarry out reverse transcription, P2853Primer sequence, reverse transcription program and reverse transcription system are as follows。
P2853Primer sequence: 5'-GCGAATTCTTTTTTTTTTTTTTTTT-3'
Reverse transcription program:
72 DEG C 5 minutes；25 DEG C 5 minutes；42 DEG C 60 minutes；80 DEG C 20 minutes；4 DEG C of insulations。
Reverse transcription system:
| Reagent | Addition (μ l) |
| DEPC water | 5.0 |
| P2853Primer (10 μm of ol l-1) | 1.0 |
| 5 × reaction buffer is (containing Mg2+) | 4.0 |
| MgCl2(25 mmol l-1) | 2.4 |
| DNTP(10 mmol l-1) | 4.0 |
| HPRI inhibitor | 0.6 |
| ImProm-II TMReverse transcription (5 U μ l-1) | 1.0 |
| Template ribonucleic acid (50 ng μ l-1) | 2.0 |
(4) with the cDNA of reverse transcription for template, above-mentioned primer is utilized to carry out pcr amplification, it is thus achieved that the CDS fragment of AtPGK2 gene。
PCR response procedures:
94 DEG C 3 minutes；
94 DEG C 30 seconds, 56 DEG C 30 seconds, 72 DEG C 2 minutes, 30 circulations；
72 DEG C 10 minutes；
4 DEG C of insulations。
PCR reaction system:
| Reagent | Addition (μ l) |
| Sterilizing distilled water | 36.5 |
| 10 × reaction buffer is (containing Mg2+) | 5.0 |
| DNTP(10 mmol l-1) | 4.0 |
| Forward primer (10 μm of ol l-1) | 1.0 |
| Downstream primer (10 μm of ol l-1) | 1.0 |
| ExTaq archaeal dna polymerase (5 U μ l-1) | 0.5 |
| Template DNA (50 ng μ l-1) | 2.0 |
(5) reclaiming target DNA fragment by agarose gel electrophoresis, recovery method adopts the DNA agarose gel of Dalian treasured biotech firm to reclaim test kit, and concrete operation step is shown in catalogue。
(6) PCR primer after recovery being carried out DNA sequencing, its nucleotide sequence is such as shown in sequence table 1。
Embodiment 2: utilize pCAMBIA1301 vector construction " CaMV35S-AtPGK2 " fusion gene
(1) from escherichia coli, carrier pCAMBIA1301 plasmid (purchased from CAMBIA company) is extracted, with reclaiming big carrier segments after NcoI/BstEII double digestion。
(2) the CDS fragment NcoI/BstEII double digestion of the AtPGK2 gene that embodiment 1 is reclaimed, reclaims the fragment after (with embodiment 1) enzyme action by agarose gel electrophoresis。
(3) above-mentioned 2 fragments are connected overnight in 16 DEG C under ligase catalysis, complete " CaMV35S-AtPGK2 " Fusion gene construction on pCAMBIA1301 carrier。
Linked system:
| Reagent | Addition (μ l) |
| CDS fragment (the 50 ng μ l of AtPGK2 gene-1) | 2.0 |
| PCAMBIA1301 carrier large fragment (50 ng μ l-1) | 3.0 |
| Solution I ligase | 5.0 |
(4) with connecting mixture conversion bacillus coli DH 5 alpha competent cell, concrete grammar is as follows:
CaCl routinely2Induction and method for transformation, prepare bacillus coli DH 5 alpha competent cell, with 10 μ l connect product transformed competence colibacillus cells, then even spread to containing Amp, X-gal and IPTG flat board on, 37 DEG C be inverted cultivation 12 hours。
(5) carrying out PCR reaction with plasmid for template, identify " CaMV35S-AtPGK2 " fusion gene in plasmid, the size of amplified fragments is 1678bp。The primer is as follows:
Forward primer: 5'-GCGATAAAGGAAAGGCCATCG-3'
Downstream primer: 5 '-GGGTAACCTTAAACAGTGACTGGCGTTGCT-3 '
(6) from positive colony, extract plasmid, convert Agrobacterium GV3101 by conventional method, it is thus achieved that through engineering approaches Agrobacterium, for Plant Transformation。
Embodiment 3: the preparation of transgenic Arabidopsis plants
(1) " CaMV35S-AtPGK2 " fusion gene arabidopsis thaliana transformation built by embodiment 2, concrete method for transformation adopts the method (CloughandBent, 1998) of agriculture bacillus mediated Floraldip, it is thus achieved that seed through 50mgl-1Hygromycin resistance screen, grow normal plant turn earth culture support。
(2) transfer-gen plant real-time quantitative RT-PCR detection: by embodiment 2 through PCR identify transgenic arabidopsis expanding propagation, through 50mgl-1Hygromycin resistance screening obtains T3The transgenic line that isozygotys of generation, obtains the growth wild type of 1 week and transgenic arabidopsis seedling respectively, extracts the total serum IgE of plant tissue according to the method for embodiment 1 and reverse transcription is mRNA, carry out PCR reaction by following primer, response procedures and reaction system:
The detection primer of AtPGK2 gene:
Forward primer: 5 '-CGTTGACTCTCGTTTCTCGGTCC-3 '
Downstream primer: 5 '-TCCAACACTCTTCTTCGCCATCG-3 '
The detection primer of TIP41-like gene:
Forward primer: 5 '-GTATGAAGATGAACTGGCTGACAAT-3 '
Downstream primer: 5 '-ATCAACTCTCAGCCAAAATCGCAAG-3 '
Response procedures:
95 DEG C: 2 minutes；1 circulation；95 DEG C: 10 seconds；60 DEG C: 30 seconds；40 circulations。
Reaction system:
| Composition | Addition (L) |
| Sterilizing distilled water | 4.0 |
| 2 x SYBR Premix | 10.0 |
| CDNA(10 ng/L) | 2.0 |
| Forward primer (2 μm of ol l-1) | 2.0 |
| Downstream primer (2 μm of ol l-1) | 2.0 |
Real-time quantitative PCR result is as it is shown in figure 1, AtPGK2 gene significantly raises at the expression of two transgenic lines, and comparing elevated-levels with wild type control increases by 7～8 times。
Embodiment 4: the salt tolerance detection of the transgenic arabidopsis strain of process LAN AtPGK2 gene
(1) Seedling Stage salt tolerance detection:
The transgenic line identified by real-time quantitative RT-PCR in embodiment 3 is tied up to Seedling Stage and carries out salt tolerance detection。Concrete grammar: by wild type and the process LAN AtPGK2 gene T isozygotied3The transgenic arabidopsis seed in generation is layered on 1/2MS culture medium germination and growth 4 days (growth conditions: intensity of illumination: 90 μ Em-2s-1, the photoperiod: 16h illumination/8h is dark), then seedling is transferred in the 1/2MS culture medium containing 150mMNaCl and grows 15 days, added up the survival rate (sum of seedling number/seedling that survival rate=growing point is downright bad) of seedling every 3 days。Result of the test is as in figure 2 it is shown, the transgenic arabidopsis strain of process LAN AtPGK2 gene increases significantly at the salt tolerance relatively wildtype Arabidopsis thaliana of Seedling Stage。
(2) Seedling Salt-tolerance detection is become:
The transgenic line identified by real-time quantitative RT-PCR in embodiment 3 tied up to the seedling phase carries out salt tolerance detection。Concrete grammar: by wild type and the process LAN AtPGK2 gene T isozygotied3The transgenic arabidopsis seed in generation is sowed in soil, cultivates at 28 days (growth conditionss: intensity of illumination: 90 μ Em of normal grown under lighting conditions-2s-1, the photoperiod: 16h illumination/8h is dark), then watered by the NaCl solution of 300mM every 3 days, after 15 days, add up the survival rate (sum of number of seedling/seedling that survival rate=growing point is downright bad) of seedling。Result of the test is as it is shown on figure 3, the transgenic arabidopsis strain of process LAN AtPGK2 gene increases significantly at the salt tolerance relatively wildtype Arabidopsis thaliana becoming seedling stage。
The above embodiments result shows and confirms, and the salt tolerance of arabidopsis AtPGK2 gene provided by the present invention and plant is proportionate, and in plant, this gene of process LAN can significantly improve transgenic plant in Seedling Stage and the salt tolerance becoming seedling stage。Therefore, the Fusion gene construction " CaMV35S-AtPGK2 " of the present invention can use in agricultural production as genetic resources or selection-breeding transgenic plant is to improve salt tolerance, is with a wide range of applications。
Sequence table
SEQUENCELISTING
<110>Agricultural University Of Jiangxi
<120>a kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof
<130>2014
<160>9
<170>PatentInversion3.3
<210>1
<211>1437
<212>DNA
<213>arabidopsis (Arabidopsisthaliana)
<400>1
atggcttccaccgccgcaactgcagctctttcgatcatcaaatccaccggtggcgccgcc60
gttacacgctcctcccgcgcctcctttggacacattccctccacatctgtctccgcacgt120
cgccttggcttctccgccgtcgttgactctcgtttctcggtccacgtggcgtccaaggtc180
cactccgtgcgcggaaagggcgccaggggagtgattacgatggcgaagaagagtgttgga240
gatctgaattctgtagatttgaaggggaagaaggtgtttgttagagctgatctcaatgta300
cctctcgatgacaaccagaatatcactgacgacactagaatcagagccgccattcccacc360
atcaagtttttgattgagaatggtgctaaggtcatcctctccactcatttgggaaggcca420
aagggtgtcactccaaagttcagcttggctcctcttgttcccagattatcagagctcctt480
ggtattgaggtcgtgaaagctgatgattgtattggtccagaagtggaaaccttggtggct540
tcccttcctgaaggtggagttttgcttcttgagaacgtgaggttttacaaggaggaagag600
aagaacgaacctgattttgctaagaagcttgcttctctagctgacctttatgtcaacgat660
gcgttcgggactgctcacagagcccatgcttcaacagagggagtcactaagttcttgaag720
ccatcagttgctggtttccttttgcaaaaggagttggactaccttgttggtgcggtttca780
aacccaaagagaccatttgctgccattgtgggaggttccaaggtctcatctaagattgga840
gttatcgaatcgcttcttgagaaatgtgacatccttctgcttggtggtggaatgatcttt900
acattctacaaggcgcaaggtctttccgttggctcctcccttgttgaagaagacaagctt960
gaattggctacaacactccttgccaaggctaaggccagaggagtctctctgttgttacca1020
acagatgttgtgattgctgacaagttcgctcctgatgccaacagcaagattgtgccagca1080
tcagccattcctgatgggtggatgggattggacatcggtccagactcggtgaaaacattc1140
aacgaagctctggataccacgcagacagtcatttggaatggaccaatgggagttttcgag1200
tttgaaaagtttgcaaaaggaactgaggcggtagcgaataaactagcagagctaagcaaa1260
aagggagtgacaacgataataggaggaggagactcggtggcagcagtggagaaagtggga1320
gtagcaggagtcatgagtcacatctccacaggtggtggtgccagtttggagctcttggaa1380
ggcaaagtgcttcccggtgtcgtcgctcttgatgaagcaacgccagtcactgtttaa1437
<210>2
<211>30
<212>DNA
<213>artificial sequence
<400>2
catgccatggcttccaccgccgcaactgca30
<210>3
<211>30
<212>DNA
<213>artificial sequence
<400>3
gggtaaccttaaacagtgactggcgttgct30
<210>4
<211>25
<212>DNA
<213>artificial sequence
<400>4
gcgaattcttttttttttttttttt25
<210>5
<211>21
<212>DNA
<213>artificial sequence
<400>5
gcgataaaggaaaggccatcg21
<210>6
<211>23
<212>DNA
<213>artificial sequence
<400>6
cgttgactctcgtttctcggtcc23
<210>7
<211>23
<212>DNA
<213>artificial sequence
<400>7
tccaacactcttcttcgccatcg23
<210>8
<211>25
<212>DNA
<213>artificial sequence
<400>8
gtatgaagatgaactggctgacaat25
<210>9
<211>25
<212>DNA
<213>artificial sequence
<400>9
atcaactctcagccaaaatcgcaag25
Claims (1)
1. arabidopsis AtPGK2 gene application in strengthening plant salt endurance, described AtPGK2 gene is such as shown in SEQIDNO:1。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410358406.7A CN104120138B (en) | 2014-07-26 | 2014-07-26 | A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410358406.7A CN104120138B (en) | 2014-07-26 | 2014-07-26 | A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104120138A CN104120138A (en) | 2014-10-29 |
| CN104120138B true CN104120138B (en) | 2016-06-22 |
Family
ID=51765769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410358406.7A Expired - Fee Related CN104120138B (en) | 2014-07-26 | 2014-07-26 | A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104120138B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120130B (en) * | 2014-07-26 | 2016-08-24 | 江西农业大学 | The plant blade specific promoter of a kind of salt stress induction and application thereof |
| CN104611346B (en) * | 2015-02-16 | 2017-10-20 | 天津大学 | A kind of resistant gene of salt and the recombinant vector including the gene |
| CN104829700A (en) * | 2015-05-11 | 2015-08-12 | 安徽农业大学 | Corn CCCH-type zinc finger protein, and encoding gene ZmC3H54 and application thereof |
| CN106282167A (en) * | 2016-09-19 | 2017-01-04 | 西藏自治区农牧科学院 | A kind of cloning expression method of Semen avenae nudae TIFY9 gene |
| CN112126651B (en) * | 2020-09-07 | 2022-08-26 | 江西农业大学 | Arabidopsis AtGLK1 gene sequence for increasing plant anthocyanin content and application thereof |
| CN116004672B (en) * | 2022-12-13 | 2023-12-22 | 安徽农业大学 | Phosphoglycerate kinase gene for improving plant biomass and yield and application thereof |
-
2014
- 2014-07-26 CN CN201410358406.7A patent/CN104120138B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| "BT000250.1";Nguyen M.等;《GenBank》;20020919;第1-2页 * |
| "华支睾吸虫3-磷酸甘油酸激酶基因的扩增、克隆及表达";吴德 等;《中国寄生虫学与寄生虫病杂志》;20041031;第22卷(第5期);摘要 * |
| "磷酸甘油酸激酶的研究进展";吴德 等;《中国热带医学》;20050430;第5卷(第2期);第385-387、267页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104120138A (en) | 2014-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104120138B (en) | A kind of arabidopsis AtPGK2 gene strengthening plant salt endurance and application thereof | |
| CN101413004B (en) | Novel plant strong-salt resistance gene NHXFS1 and encoding protein | |
| CN101906155A (en) | Protein ErNAC7 related to drought and salt resistance of plants and coding gene and application thereof | |
| CN109536516B (en) | Cloning and application of corn drought-resistant gene ZmDSR | |
| CN109666681A (en) | Plant drought, salt tolerant protein EeCIPK26 and its encoding gene and application | |
| CN103497940B (en) | A kind of plant drought associated protein TaSnRK2.6 and encoding gene thereof and application | |
| CN101831436A (en) | Method for breeding adverse-resistant plant | |
| CN106397556B (en) | Plant drought GAP-associated protein GAP ZmNAC111 and its encoding gene and application | |
| CN108610405B (en) | Application of protein TaNRT2.5 in regulation and control of plant root system development | |
| CN101260403B (en) | Plant strong salt-resistant gene AtNHXS1 and its coding protein and application | |
| CN114231539B (en) | Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector thereof | |
| CN101952431A (en) | The conversion plant of growth | |
| CN113429467B (en) | Application of NPF7.6 protein in regulation and control of nitrogen tolerance of leguminous plant root nodule | |
| CN107746847A (en) | A kind of application of rape C CCH class transcription factors | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN106939314A (en) | Salt sward anti-drought gene Hg.S4 and its application | |
| CN104120134B (en) | The application in cultivating resistance of reverse transgenic plant of the GsHSFB2b albumen | |
| CN107354140B (en) | The drought-resistant Protein G mNARK of plant and encoding gene and application | |
| CN102140133B (en) | Protein ErABF1 related to drought resistance and salt tolerance of plant and encoding gene and application thereof | |
| CN112048011A (en) | Application of rice gene OsNF-YC5 in improving salt tolerance of rice | |
| CN107287212B (en) | Halogeton sativus salt-tolerant gene HgS3 and application thereof | |
| CN105753952A (en) | Plant drought tolerance related protein Tabzip174 as well as coding gene and application thereof | |
| CN101704884A (en) | Plant drought resistance and salt tolerance associated protein EeABF6, coding gene and application thereof | |
| CN110643617A (en) | Rice grain weight related OsGASR9 gene, application thereof, protein, expression vector and transgenic rice method | |
| CN110004159A (en) | It is a kind of regulate and control Chinese tamarisk salt tolerance key gene TcNAC1 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160622 Termination date: 20180726 |