CN104115747B - Tissue culture method is utilized to produce apple class flavones - Google Patents

Abstract

The invention discloses and utilize tissue culture method to produce apple class flavones.The invention provides a kind of method utilizing tissue culture method to prepare flavonoid, comprise the steps: 1) by R6R6 genotype explant inducing culture in callus inducing medium, obtain callus; 2) by described callus succeeding transfer culture in subculture medium, subcultured callus is obtained; 3) described subcultured callus is strengthened cultivation, callus after being enhanced in enhancing substratum; 4) extract the flavonoid in callus after described enhancing, obtain object product.Experiment of the present invention proves, utilize the callus that aforesaid method is cultivated, its Flavonoid Content is more than 30 times of apple variety fruit flesh flavones contents such as ' Jin Shuai ', can realize utilizing tissue culture method to carry out the suitability for industrialized production of apple class flavones.

Description

Tissue culture method is utilized to produce apple class flavones

Technical field

The present invention relates to biological technical field, particularly relate to plant biotechnology field, be specifically related to utilize tissue culture method to produce apple class flavones.

Background technology

" doctor's food homology " is developing direction.Flavonoid is the class main polyphenol class material in Apple, has many-sided physiological function to HUMAN HEALTH; And apple is worldwide fruit, because its ecological suitability is strong, fruit is of high nutritive value, storage tolerance is got well and supply cycle is long, considerable country is all classified as major consumers fruit and is recommended energetically in the world; China is apple production maximum in the world and country of consumption, wherein within 2012, produces apple 3,950 ten thousand tons, be mainly used in eating raw, and nearly 70% is Flavonoid Content lower ' Fuji apple ' kind.Therefore; for ensureing that human consumer absorbs enough polyphenol and flavonoid from apple; effectively utilize Xinjiang of China codlin resource; further cultivation also promotes the high functional type Variety of Apple of Flavonoid Content; the excised cotyledon technical system utilizing callus to produce apple class flavones is set up in research, and the health for the scientific conservation of Malus sieversii resource and sustainable utilization, the high-quality and efficient development promoting China's Apple Industry and the mankind is significant.

Malus sieversii and red meat modification (Malussieversiif.neidzwetzkyana) thereof are ancestors' kinds of world's Cultivated apple, not only genetic diversity enriches, and the functional component such as fruit polyphenol and Ca content is all more than 3 times of ' Red Star ' apple variety, it is the valuable source of apple quality breeding.But due to reasons such as the farmland reclamation of wastelands, Malus sieversii resource is just being seriously damaged, endangered; For this reason, researchist, on the basis studied Malus sieversii resource Genetic diversity evaluation, took the lead in constructing the F1 hybrid separation colony of ' Fuji apple ' apple variety × Xinjiang red meat apple at home in 2006; Recent research finds, there is the separation phenomenon of red/continuous meat, red/crisp meat, white/continuous meat and white/crisp meat strain in F1 colony, the crisp meat strain of red meat that fruit is individual comparatively greatly, fresh food quality is better, resistance of oxidation is strong, Flavonoid Content is high can be selected from F-1 hybrids colony, and have selected red crisp 1 ~ No. 10.As technical backstopping, propose the concept (health type apple be rich in flavonoid in fruit, can eating or process raw) of " functional type apple ", declare the method for breeding patent of invention eating class functional type apple " three select two early one to urge " raw.

Except the crisp meat strain of red meat that above-mentioned fruit is larger, fruit less (single fruit weight 20-40g) can also be selected from F-1 hybrids colony, segregation ratio is extremely low, fresh food quality is poor or very poor but Flavonoid Content is very high, red, branch, leaf, flower are mauve purplish red 1 ~ No. 3 (see Fig. 1) pulp entirely; , fresh food quality little with fruit poor purplish red 1 ~ No. 3 for hybrid strain, be bred as fruit large, that fresh food quality is an excellent functional type Variety of Apple more difficult.

Summary of the invention

An object of the present invention is to provide a kind of method utilizing tissue culture method to prepare the high apple callus of Flavonoid Content.

Method provided by the invention, comprises the steps:

1) by R6R6 genotype apple explant inducing culture in callus inducing medium, callus is obtained;

2) by described callus succeeding transfer culture in subculture medium, subcultured callus is obtained;

3) described subcultured callus is strengthened cultivation in enhancing substratum, callus after being enhanced, is the apple callus that Flavonoid Content is high.

In aforesaid method, described callus inducing medium is that 2.5mg/L2,4-D, 0.5mg/L6-BA, 0.1mg/LKT, MS liquid nutrient medium (each component and final concentration thereof shown in table 1, for having N's), peptizer and water form by final concentration;

Described subculture medium is 0.3mg/LNAA, 1.0mg/L6-BA, MS liquid nutrient medium (each component and final concentration thereof shown in table 1, for having N's), peptizer and water composition by final concentration;

6-BA, water and peptizer that described enhancing substratum is 1.0mg/L by the NAA being 0.3mg/L without NMS substratum, final concentration, final concentration form.

Described each component without NMS substratum final concentration as shown in Table 4 and water composition.

In aforesaid method, described peptizer is for being agar, and the final concentration of described peptizer in the substratum at its place is 7g/L.

In aforesaid method, the condition of described inducing culture is first 24 DEG C of light culture 2 weeks, then the photoperiod is that 16/8h cultivates 2 ~ 3 weeks, intensity of illumination 50umolm ^-2s ^-1;

The condition of described succeeding transfer culture is 24 DEG C, 16/8h, intensity of illumination 50umolm ^-2s ^-1, cultivate 2 weeks;

The described condition of cultivating that strengthens is: 24 DEG C, 16/8h, intensity of illumination 50umolm ^-2s ^-1, cultivate 15 days.

In aforesaid method, the apple callus that described Flavonoid Content is high is Flavonoid Content higher than the apple callus of 10mg/g or Flavonoid Content higher than the apple callus of 15mg/g or Flavonoid Content higher than the apple callus of 20mg/g or Flavonoid Content higher than the apple callus of 25mg/g or the Flavonoid Content apple callus higher than 28mg/g.

In aforesaid method, described R6R6 genotype apple is with Xinjiang red meat apple for male parent, and red fuji apple is that female parent is hybridized, and obtains the genotypic hybrid generation apple of R6R6;

Described R6R6 genotype is specially purplish red No. 1.

The choosing method of the genotypic hybrid generation apple of described R6R6 is using the pulp organization genomic dna of hybrid generation as template, and by following primer to carrying out pcr amplification, what obtain 504bp size strip is R6R6 genotype:

F:5’-GGTGGTCAAAGATGTGTGTTG-3’

R:5’-CTTATCTTTTGCCTGCTACCC-3’。

Another object of the present invention is to provide a kind of substratum group utilizing tissue culture method to prepare the high apple callus of Flavonoid Content.

Substratum group provided by the invention, is made up of the callus inducing medium be used alone, subculture medium and enhancing substratum,

Described callus inducing medium is that 2.5mg/L2,4-D, 0.5mg/L6-BA, 0.1mg/LKT, MS liquid nutrient medium, peptizer and water form by final concentration;

Described subculture medium is that 0.3mg/LNAA, 1.0mg/L6-BA, MS liquid nutrient medium, peptizer and water form by final concentration;

6-BA, water and peptizer that described enhancing substratum is 1.0mg/L by the NAA being 0.3mg/L without NMS substratum, final concentration, final concentration form.

Peptizer in above-mentioned each substratum is agar, and the final concentration in each substratum can be 7g/L, also can be the concentration that liquid nutrient medium can be made to solidify.

Experiment of the present invention proves, the present invention utilizes purplish red No. 3 blades to induce callus, find in callus Subculture, the callus of the culture medium culturing that hormone kind, concentration are different, there is notable difference in its cyanin or Flavonoid Content and related gene expression amount thereof, the growth hormone of high density inhibits the biosynthesizing of flavonoid, then significantly promotes the biosynthesizing of flavonoid, prepare the callus that Flavonoid Content is high without N substratum.

Accompanying drawing explanation

Fig. 1 is the Xinjiang red meat apple preserved of Xinjiang tire country Germplasm Resources and apple variety first-filial generation (F1) the fruit properties separation case such as ' Fuji apple '

Fig. 2 is to be R6R6 from F1 segregating population Select gene type purplish red No. 1 spire is the explant of callus induction

Fig. 3 is for induce callus from purplish red No. 1 spire

Fig. 4 is the red callus on lower concentration NAA subculture medium (NAA0.3mg/L+6-BA1.0mg/L) and the yellow callus on 2,4-D combination substratum (2,4-D0.6mg/L+TDZ0.5mg/L)

Fig. 5 is Anthocyanin Content and the increment of red callus on lower concentration NAA subculture medium

Fig. 6 is Anthocyanin Content and the increment that 2,4-D combines yellow callus on substratum

Fig. 7 is that the NAA of high density and 2,4-D of lower concentration all affect the biosynthesizing of callus flavonoid

Fig. 8 is comparison that is red and yellow callus flavonoid biosynthesis related genes expression amount

Fig. 9 is HPLC color atlas that is red and yellow callus flavonoid

Figure 10 is normal MS substratum and comparing without callus on NMS substratum

Figure 11 is without NMS substratum and normal MS substratum callus Anthocyanin Content

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Purplish red No. 1 in following embodiment is documented in as in Publication about Document: Wang Yan, Liu great Liang, Wang Chuanzeng, Song Yang, Chen Xiaoliu, Zhang Yanmin, Chen Xuesen, ' purplish red No. 1 ' red meat apple pulp oxidation-resistance and anthocyanogen are analyzed, gardening journal, 2012,39 (9): 1551-1558, the public can obtain from Shandong Agricultural University.

' summer red meat ' Xinjiang red meat apple is documented in as in Publication about Document: Chen Xuesen, Zhang Jing, Liu great Liang, Ji Xiaohao, Zhang Zongying, Zhang Rui, Mao Zhiquan, Zhang Yanmin, Wang Lixia, Li Min, Xinjiang red meat apple first generation of hybrid fruit properties heritable variation and the excellent strain evaluation of functional type apple, Scientia Agricultura Sinica, 2014,47 (11): 2193-2204, the public can obtain from Shandong Agricultural University.

Embodiment 1, tissue culture method is utilized to improve apple class flavones

One, the acquisition of explant

1, F1 segregating population is built

' summer red meat ' Xinjiang red meat apple preserved with Xinjiang tire country Germplasm Resources, for male parent, is that female parent is hybridized with ' Fuji apple ' apple variety, builds first-filial generation (F1) segregating population;

2, from F ₁segregating population selects explant

Primer is designed according to red meat apple transcription factor MYB10 promoter sequence (R6),

Primer sequence is as follows:

F:5 '-GGTGGTCAAAGATGTGTGTTG-3 ' (sequence 1)

R:5 '-CTTATCTTTTGCCTGCTACCC-3 ' (sequence 2)

With the genomic dna of first-filial generation (F1) segregating population apple pulp tissue as template, above-mentioned primer carries out pcr amplification, and what obtain 504bp size strip is R6R6 genotype.

Found that, in first-filial generation (F1), purplish red 1 ~ No. 3 is R6R6, and the crisp meat strain of red meat is R6R1, and plain boiled pork strain is R1R1, shows that R6R6 genotype has the hereditary basis of high Flavonoid Content.

Therefore, the explant (Fig. 2) of Select gene type to be purplish red No. 1 blade of R6R6 be callus induction.

Two, tissue culture method is utilized to produce apple class flavones

1, Callus of Leaf inducing culture

Adopt purplish red No. 1 young leaflet tablet spring as explant, clean up with tap water, 75% aqueous ethanolic solution soaks 15s, and with aseptic water washing 3 times, 3% aqueous sodium hypochlorite solution soaks 10min, and aseptic water washing 6 times, is cut into 1cm ²fritter, be placed in callus inducing medium, light culture 2 weeks in 24 DEG C of constant temperature culture rooms, then the photoperiod is that 16/8h (light/dark) cultivates 2 ~ 3 weeks, intensity of illumination 50umolm ^-2s ^-1, obtain Callus of Leaf (Fig. 3).

Callus inducing medium finds through research, following component is best callus inducing medium: be 2.5mg/L2 by final concentration, 4-D (2,4-dichlorphenoxyacetic acid), final concentration is 0.5mg/L6-BA (6-benzyl aminoadenine), final concentration is 0.1mg/LKT (kinetin), MS liquid nutrient medium, final concentration are 7g/L peptizer and water composition, wherein peptizer is agar, adjusts medium pH to 5.8 with 1mol/LNaOH or 1mol/LHCl.

MS liquid nutrient medium component is as shown in table 1:

Table 1 is the component in MS liquid nutrient medium

Macroelement

Final concentration (gL in substratum -1)

NH 4NO 3	1.65
		KNO 3	1.9
KH 2PO 4	0.17
		MgSO 4.7H 2O	0.37
CaCl 2	0.44
		Trace element	Concentration (mgL in substratum -1)
FeSO 4.7H 2O	27.8
		Na 2EDTA	37.3
MnSO 4.4H 2O	22.3
		ZnSO 4.4H 2O	8.6
H 3BO 3	6.2
		KI	0.83
Na 2MoO 4.2H 2O	0.25
		CuSO 4.5H 2O	0.025
CoCl 2.6H 2O	0.025
		Organic composition	Concentration (mgL in substratum -1)
Glycine	2.0
		Vitamin	0.4
Pyridoxine hydrochloride	0.5
		Nicotinic acid	0.5
Inositol	100

2, succeeding transfer culture

For realizing apple class flavones batch production scale operation, increase economic efficiency, the key of callus succeeding transfer culture is under callus has the prerequisite of higher-class flavones content, there is larger increment, thus there is higher flavonoid biological yield, namely the key of callus succeeding transfer culture will balance callus growth and flavonoid synthesizes this conflict, affects flavonoid synthesis because callus growth is too fast, flavonoid advantage synthesis and affect callus growth; Therefore, take MS as minimum medium, choose two kinds of growth hormone (NAA and 2,4-D) and two kinds of mitogens (TDZ and 6-BA) carry out hormone concentration and composite test, devise 16 kinds of solid subculture mediums altogether, the NAA of often kind of substratum each final concentration as shown in Table 2, the 6-BA of each final concentration and final concentration are the agar composition of 7g/L.

Table 2 is that 16 kinds of subculture mediums and callus grow 20 days increment, Anthocyanin Content and Flavonoid Content mensuration

TDZ is N-phenyl-N '-1,2,3-thiadiazoles-5-urea.

The Callus of Leaf that above-mentioned 1 obtains is placed in above-mentioned 16 kinds of solid subculture mediums to cultivate, culture condition is that 16/8h in 24 DEG C of constant temperature culture rooms (light/dark) carries out light cultivation, intensity of illumination 50umolm ^-2s ^-1, cultivate 2 weeks, obtain callus after subculture.

Observe callus growth situation and colour-change after subculture, within after subculture the 15th day, measure callus cyanin after subculture, flavonoid component content and increment, concrete grammar is as follows:

Callus after the subculture of accurate inoculation 0.3g growth 15d, after cultivating 20d, weighs in the balance and gets callus quality as increment under succeeding transfer culture condition.

The mensuration of Anthocyanin Content adopts colorimetry, gets 0.5g callus liquid nitrogen grinding powdered, with the dark lixiviate 24h of 15ml1% hydrochloric acid methanol 4 DEG C, with spectrophotometric determination 530nm light absorption value, represents Anthocyanin Content.

Flavonoid total content measures the method with reference to Jia etc. (1999), and concrete operations are: after sample adds liquid nitrogen grinding, take 1g, lucifuge lixiviate 24h at the ethanol 5mL adding 80% precooling puts 4 DEG C.Afterwards at 4 DEG C, the centrifugal 20min of 12,000rpm.Draw 0.5mL supernatant liquor in new pipe, add 0.3mL8%NaNO2,0.3mL10%Al (NO3) 3,2mL2mol/LNaOH, 4.9mL ethanol in order respectively, after leaving standstill 10min, under 510nm, measure light absorption value (blank replaces supernatant liquor with 80% ethanol).With rutin (rutin; Sigmachemical, St, Louis, USA) be standard specimen, last Flavonoid Content is expressed as mgruting-1FW.Repeat 3 times.

The mensuration of cyanin component adopts liquid chromatography mass spectrometric coupling method, liquid phase chromatogram condition: adopt WATERSACQUITYUPLC chromatographic instrument, chromatographic column is BEHC18 post (100mm × 2.1mm), packing material size 1.7 μm.Column temperature 45 DEG C, sampling volume 1 μ L.Moving phase: acetonitrile (A), 0.2% (volume fraction) formic acid solution (B); Gradient: 0 ~ 0.1min5%A; 20min20%A; 22min80%A; 22.1min5%A; 25min5%A, flow velocity 0.3mLmin-1.PAD scanning wavelength scope 200 ~ 700nm, adopts WATERSACQUITYPDA detector, determined wavelength 520nm.Mass Spectrometry Conditions: mass spectrograph is WATERSMALDISYNAPTQ-TOFMS, ESI ionizer, electro-spray ionization positive ion drainage pattern (ESI+).Sweep limit 100 ~ 1500m/z.Capillary voltage 3.5kV, taper hole voltage 30V.Source temperature 100 DEG C, precipitation temperature 300 DEG C.Desolventizing airshed 500Lh-1.

The mensuration of flavonoid component adopts liquid phase chromatography, liquid phase chromatogram condition: adopt WATERSACQUITYUPLC chromatographic instrument, chromatographic column is BEHC18 post (100mm × 2.1mm), packing material size 1.7 μm.Column temperature 45 DEG C, sampling volume 1 μ L.Moving phase: acetonitrile (A), 0.2% (volume fraction) formic acid solution (B); Gradient: 0 ~ 0.1min5%A; 20min20%A; 22min80%A; 22.1min5%A; 25min5%A, flow velocity 0.3mLmin-1.PAD scanning wavelength scope 200 ~ 700nm, adopts WATERSACQUITYPDA detector, determined wavelength 280nm.The standard specimen of catechin, l-Epicatechol, phlorizin and Quercetin is utilized to demarcate.

Above-mentioned detected result is as shown in table 2, can find out, the kind of mitogen is little on callus flavonoid synthesis impact, and growth hormone kind and concentration affect very large on the synthesis of callus flavonoid.

Shown in Fig. 4 and Fig. 5, lower concentration NAA combine substratum on callus be all bright red, cyanin and flavonoid component content very high;

Shown in Fig. 4 and Fig. 6,2,4-D and high density NAA combination substratum on callus be all yellow, cyanin and flavonoid component content very low.

Fig. 7 shows, and the NAA of high density and 2,4-D of lower concentration all affects the biosynthesizing of callus flavonoid.

More above-mentioned red callus (NAA0.3mg/L+6-BA1.0mg/L) and yellow callus (2, flavonoid biosynthesis related genes expression amount (CHS, CHI, F3H, DFR, LDOX, UFGT, MYB10, bHLH3, TTG1) 4-D0.6mg/L+TDZ0.5mg/L)

The primer sequence of amplification needed for said gene is as follows:

MdCHS-FGGAGACAACTGGAGAAGGACTGGAA (sequence 3)

MdCHS-RCGACATTGATACTGGTGTCTTC (sequence 4)

MdCHI-FGGGATAACCTCGCGGCCAAA (sequence 5)

MdCHI-RGCATCCATGCCGGAAGCTACAA (sequence 6)

MdF3H-FTGGAAGCTTGTGAGGACTGGGGT (sequence 7)

MdF3H-RCTCCTCCGATGGCAAATCAAAGA (sequence 8)

MdDFR-FGATAGGGTTTGAGTTCAAGTA (sequence 9)

MdDFR-RTCTCCTCAGCAGCCTCAGTTTTCT (sequence 10)

MdLDOX-FCCAAGTGAAGCGGGTTGTGCT (sequence 11)

MdLDOX-RCAAAGCAGGCGGACAGGAGTAGC (sequence 12)

MdUFGT-FCCACCGCCCTTCCAAACACTCT (sequence 13)

MdUFGT-RCACCCTTATGTTACGCGGCATGT (sequence 14)

MdMYB10-FTGCCTGGACTCGAGAGGAAGACA (sequence 15)

MdMYB10-RCCTGTTTCCCAAAAGCCTGTGAA (sequence 16)

BHLH3-FACCACCTCAGCCAGAACCT (sequence 17)

BHLH3-RCCTTCACCTTGGCTCTTAGTT (sequence 18)

MdTTG1-FAGAATCCCATCTCAGAGCGG (sequence 19)

MdTTG1-RAGGGTCGGGTTCGGCTTTATT (sequence 20).

Result as shown in Figure 8, can find out, in whole growth cycle the dynamic change of cyanin composite structure gene and regulate gene expression amount and the dynamic change of Anthocyanin Content consistent, fall after rising generally, reach the highest at 12d or 15d, and gene expression amount peak is slightly early than Anthocyanin Content peak.Red callus gene expression amount substantially all higher than yellow callus, except CHI expression amount is all lower and difference is little.In structure gene, CHS, F3H, LDOX, UFGT expression amount difference is larger, and red callus expression amount is apparently higher than yellow callus; In regulatory gene, the red callus of MYB10, bHLH3 expression amount is apparently higher than yellow callus, but the yellow callus of TTG1 is higher than red callus.Red callus is consistent with RT-PCR result with yellow callus growth 15dqRT-PCR detected result, find their significant differences on transcriptional level, early gene is relatively smaller relative to late gene difference, and wherein the red callus of CHS, CHI, F3H is 10 times, 1.4 times and 5.8 times of yellow callus respectively.In late period structure gene, UFGT difference is maximum, and red callus is about 27 times of yellow callus, DFR and LDOX is 10.8 times and 9.4 times respectively.The red callus of MYB10 and bHLH3 expression amount is 6 times and 18 times of yellow callus respectively, and the yellow callus of TTG1 is slightly higher than red callus expression amount.

The HPLC color atlas of red and yellow callus flavonoid, as shown in Figure 9, upper figure is the HPLC color atlas of red callus flavonoid to result, and figure below is the HPLC color atlas of yellow callus flavonoid; Can find out, red callus and yellow callus flavonoid component basically identical, just in red callus component concentration apparently higher than yellow callus.

Red and yellow callus flavonoid component comparision contents, result is as shown in table 3:

Table 3 is comparison that is red and yellow callus flavonoid component content

By comprehensive comparative analysis, best subculture medium by final concentration be 0.3mg/LNAA, 1.0mg/L6-BA, MS liquid nutrient medium, final concentration is that 7g/L peptizer and water form, wherein peptizer is agar, and medium pH is 5.8.

3, cultivation is strengthened

Research finds, when hormone kind is identical with concentration, is 4 times of Anthocyanin Content on normal nitrogen MS substratum without the Anthocyanin Content on NMS substratum.

Containing with or without the enhancing substratum of NMS substratum by cultivating the subcultured callus obtained in above-mentioned 2 at best subculture medium and cultivating respectively containing in normal nitrogen MS substratum, culture condition is that 16/8h (light/dark) carries out light cultivation, intensity of illumination 50umolm in 24 DEG C of constant temperature culture rooms ^-2s ^-1, 15 days, callus after being enhanced.

Above-mentioned 6-BA, water and final concentration containing being 1.0mg/L with or without the enhancing substratum of NMS substratum by the NAA being 0.3mg/L without NMS liquid nutrient medium, final concentration, final concentration is that 7g/L peptizer forms, and wherein peptizer is agar, and medium pH is 5.8.

Formula without NMS liquid nutrient medium is as shown in table 4 as follows.

Table 4 is without the component in NMS liquid nutrient medium

Detect the Flavonoid Content (detection method is shown in 2 succeeding transfer culture) in callus after strengthening,

As shown in Figure 10 and Figure 11, warp is containing the callus cultivating 15 days with or without NMS enhancing substratum (anaerobic treatment), and purplish red No. 1 grows into 0.5g by 0.3g during inoculation, and Anthocyanin Content is 16.1OD for result _530/g, flavonoid total content is 28.0mg/g, and cyanin biological yield is 8.4OD530, and flavonoid biological yield (callus biomass * flavonoid total content) is 14.6mg.

Through cultivating the callus of 15 days containing normal nitrogen MS substratum (normal level), purplish red No. 1 grows into 1.2g by 0.3g during inoculation, and Anthocyanin Content is 0.9OD ₅₃₀/ g, flavonoid total content is 8.7mg/g, and cyanin biological yield is 1.0OD530, and flavonoid biological yield is 10.2mg.

Common ' Jin Shuai ' apple variety fruit flesh flavones content is only 0.86mg/g; Adopt aforesaid method carry out cultivating with ' Wang Lin ' apple variety callus and detect, cyanin and flavonoid all almost can't detect.

The above results shows, is that adverse circumstance is cultivated, effectively facilitates biosynthesizing and the accumulation of flavonoid without NMS substratum.Therefore, the callus of succeeding transfer culture, before plan therefrom extracts flavonoid, is cultivating without on NMS substratum, can significantly improve the biological yield of flavonoid.

Claims (9)

1. utilize tissue culture method to prepare a method for the high apple callus of Flavonoid Content, comprise the steps:

1) by R6R6 genotype apple explant inducing culture in callus inducing medium, callus is obtained;

2) by described callus succeeding transfer culture in subculture medium, subcultured callus is obtained;

3) described subcultured callus is strengthened cultivation in enhancing substratum, callus after being enhanced, is the apple callus that Flavonoid Content is high;

Described callus inducing medium is that 2.5mg/L2,4-D, 0.5mg/L6-BA, 0.1mg/LKT, MS liquid nutrient medium, peptizer and water form by final concentration;

Described subculture medium is that 0.3mg/LNAA, 1.0mg/L6-BA, MS liquid nutrient medium, peptizer and water form by final concentration;

6-BA, water and peptizer that described enhancing substratum is 1.0mg/L by the NAA being 0.3mg/L without NMS substratum, final concentration, final concentration form;

Described R6R6 genotype apple is with Xinjiang red meat apple for male parent, and red fuji apple is that female parent is hybridized, and chooses R6R6 genotype apple in hybrid generation apple;

Described R6R6 genotype apple is purplish red No. 1, and described explant is blade.

2. method according to claim 1, is characterized in that: described peptizer is for being agar, and the final concentration of described peptizer in the substratum at its place is 7g/L.

3. method according to claim 1, is characterized in that:

The condition of described inducing culture is first 24 DEG C of light culture 2 weeks, then the photoperiod is that 16/8h cultivates 2 ~ 3 weeks, intensity of illumination 50umolm ^-2s ^-1;

The condition of described succeeding transfer culture is 24 DEG C, 16/8h, intensity of illumination 50umolm ^-2s ^-1, cultivate 2 weeks;

The described condition of cultivating that strengthens is: 24 DEG C, 16/8h, intensity of illumination 50umolm ^-2s ^-1, cultivate 15 days.

4., according to described method arbitrary in claim 1-3, it is characterized in that: the apple callus that described Flavonoid Content is high is the apple callus of Flavonoid Content higher than 10mg/g.

5., according to described method arbitrary in claim 1-3, it is characterized in that: the apple callus that described Flavonoid Content is high is the apple callus of Flavonoid Content higher than 15mg/g.

6., according to described method arbitrary in claim 1-3, it is characterized in that: the apple callus that described Flavonoid Content is high is the apple callus of Flavonoid Content higher than 20mg/g.

7., according to described method arbitrary in claim 1-3, it is characterized in that: the apple callus that described Flavonoid Content is high is the apple callus of Flavonoid Content higher than 25mg/g.

8., according to described method arbitrary in claim 1-3, it is characterized in that: the apple callus that described Flavonoid Content is high is the apple callus of Flavonoid Content higher than 28mg/g.

9. utilize tissue culture method to prepare a substratum group for the high apple callus of Flavonoid Content, be made up of the callus inducing medium be used alone, subculture medium and enhancing substratum,

Described callus inducing medium is that 2.5mg/L2,4-D, 0.5mg/L6-BA, 0.1mg/LKT, MS liquid nutrient medium, peptizer and water form by final concentration;

Described subculture medium is that 0.3mg/LNAA, 1.0mg/L6-BA, MS liquid nutrient medium, peptizer and water form by final concentration;

6-BA, water and peptizer that described enhancing substratum is 1.0mg/L by the NAA being 0.3mg/L without NMS substratum, final concentration, final concentration form.