CN104099424A

CN104099424A - Method for preparing length relying probe for detecting gene mutation

Info

Publication number: CN104099424A
Application number: CN201410363255.4A
Authority: CN
Inventors: 何骏奇; 毛丹丹; 王校; 卞雪莲
Original assignee: SHANGHAI ZHONGYOU MEDICINE HIGH-TECH Co Ltd
Current assignee: SHANGHAI ZHONGYOU MEDICINE HIGH-TECH Co Ltd
Priority date: 2014-07-29
Filing date: 2014-07-29
Publication date: 2014-10-15

Abstract

The invention discloses a method for preparing a length relying probe for detecting gene mutation. The method comprises the following steps: 1) selecting a carrier irrelevant to a target sequence to be detected as a template, and designing an amplimer sequence of a length relying probe pair according to a target nucleotide sequence and an unrelated sequence; 2) manually synthesizing a primer; 3) conducting PCR amplification; 4) purifying and recycling a PCR product; 5) digesting the PCR product by adopting a T7 excision enzyme; 6) recycling ssDNA. The method for preparing the MLPA probe is low in cost, all operations of amplification, enzyme digestion and the like can be finished only through a PCR instrument, dsDNA and nucleotide which are not digested completely are digested and excluded by utilization of the T7 excision enzyme, the probe preparation efficiency is improved, and the hybridization efficiency in the MLPA experiment is improved.

Description

A kind of length for detection of transgenation relies on probe preparation method

Technical field

The present invention relates to oligonucleotide probe preparation, be specially and can be used for detecting transgenation, comprise that the length of single nucleotide polymorphism (SNP), copy number variation (CNV) and numerical abnormalities of chromosomes relies on the preparation method of probe.

Background technology

Detect transgenation and be the important auxiliary diagnosis means of the Main Means of diagnosis genetic diseases and other metabolism, neural class disease.Transgenation comprises as single nucleotide polymorphism (SNPs), copy number variation (CNVs), gene fragment repetition and disappearance (Ins/Del), numerical abnormalities of chromosomes, gene methylation etc.Wherein single nucleotide polymorphism (SNPs), copy number variation (CNVs) and numerical abnormalities of chromosomes are the main Types detecting at present in gene mutation type.

The technique means that detects at present transgenation be take round pcr and PCR and is prolonged raw technology as main, and round pcr has that sense cycle is short, detection sensitivity is high, detected result accuracy rate is high, detected result is reliable.Yet; round pcr can only be realized a reaction tubes and analyze a gene locus; efficiency is low; while round pcr having relatively high expectations to sample DNA quality; for lower concentration inferior quality sample DNA, often there will be false negative or false-positive result,, site part methyl high for some special sample DNA(CG content) the round pcr ability mailbox that also often seems.Current will to as numerous different heredity, nerve, cardiovascular, cerebrovascular disease carry out the detection of molecular biology specialty, early stage sample sorting loaded down with trivial details, testing amount is large.Therefore, detection in Gene Mutation is badly in need of a kind of high-throughput, detection method fast and easily.

The technology of common high throughput testing transgenation has gene chip, multiple-pass capillary tube electrophoresis, dhplc analysis, the order-checking of two generations etc.Although these methods can realize the detection of " the corresponding entry of monocyte sample ", yet the detectivity to " Multi-example corresponding entry " mode is limited, its limitation mainly to detect sample DNA require correctness high, detected result to depend on to detect the degree of depth, cost is high.For disposable acquisition multiple goal DNA product fragment, adopt comparatively cheap multiple PCR technique, but target dna causes phase mutual interference and primer-oligomerization body between primer sequence to make this technology for detection number gene receive very large restriction more, generally can be over 10.

The Dr. Schouten JP of Holland in 2002 has created a kind of new detection in Gene Mutation technology and has detected for medical science, this technology is multiple join dependency probe amplification technology (Multiplex Ligation dependent Primers Amplification, MLPA) its principle is to rely on probe to (Fig. 1) for different target gene site design lengths, this length relies on one end tool gene specific of probe to two sequences, they with after the renaturation of target gene region, only stay a breach separately, in this simultaneously all length rely on one end that probe centering do not hybridize with goal gene and be all connected to identical base sequence (both universal primer sequence, GS) for PCR, when being connected with target area renaturation and under the effect of ligase enzyme, length dependence probe pair itself becomes like this template DNA of PCR, and increase and reach the effect that signal amplifies by a pair of universal primer, because the probe of the target gene site design for different is different to length, (need not be by order-checking means by separated PCR product size, by agarose gel electrophoresis or capillary electrophoresis, can reach separated effect) just can know whether the existence of target gene, can carry out qualitative analysis to target gene, also can carry out relative quantitative assay.

MLPA technology has (not needing expensive and complicated operating equipment) easy and simple to handle, specificity high (specific recognition of probe renaturation and ligase enzyme) and high-throughput (single tube can be surveyed nearly 45 gene locuss), need DNA sample amount low (only needing 20ng/ μ l DNA), Application Areas extensively (can be applicable to single nucleotide polymorphism (SNP), copy number variation (CNV), gene fragment disappearance and repetition (Int/Del), numerical abnormalities of chromosomes, the analysis of methylation analysis and mRNA) feature.Over the years, surpass in the research report that has up to a hundred pieces and applied this technology.

The length relating in MLPA technology for target gene relies on probe pair, wherein the right design of length dependence probe is difficult point, Holland scientist has creatively utilized the characteristic of M13 single stranded phage, at the derivative sequence two ends of insertion, designed restriction enzyme (RE) recognition site dexterously, to adopt double digestion to obtain length, rely on probe pair, overcome current oligonucleotide chemosynthesis and be generally difficult to reach difficulty more than 50mer.

Its principle is exactly by the irrelevant sequence varying in size of each M13 carrier or irrelevant template (Unrelated Template, UT) thereby introducing single-stranded probe obtains the different single-stranded probe of length.This single-stranded probe biological method is very loaded down with trivial details, not only needs the processes such as gene clone, virus transfection, plasmid extraction, also must buy the M13 carrier of a set of costliness, and in addition, operation M13 virus is very easily polluted.Simultaneously in order to monopolize MLPA application market, the dutch company MRC-Holland M13 carrier of not resaled now, therefore, it is anxious to be resolved that length relies on the right preparation method of probe.

Summary of the invention

The object of the invention is to rely on the probe problem loaded down with trivial details to biological preparation method for above-mentioned MLPA length, provide a kind of working method easy, pollute the MLPA length controlled, preparation efficiency is high and rely on the right preparation method of probe.

Another object of the present invention be to provide length that a kind of MLPA for for cardiovascular disorder relevant risk gene detects rely on probe to and the MLPA detection method of risk of cardiovascular diseases gene.

To achieve these goals, the present invention has adopted following technical scheme (Fig. 2):

1. for target site to be measured or two pairs of primers of fragment design, a pair of is universal primer, for follow-up pcr amplification, detects, and is respectively GSF and GSR, and this is irrelevant to the native sequences (NS) in primer sequence and target site to be measured or fragment and long probe; Detection primer for target site to be measured or fragment, is respectively TSF and TSR.

2. preparation length relies on the long probe of probe centering:

1) long probe of length dependence probe centering is comprised of three parts, is respectively GSR, NS and TSR;

2) 5 ' of GSR end is modified with reporter group;

3) determine one section with target site to be measured or fragment and the irrelevant native sequences (NS) of universal primer;

4) for the design pair for amplification primer of long probe, be respectively GSR-N ' and TSR-N ', wherein GSR-N ' is comprised of the sequence of the sequence of GSR and the 18bp left and right of NS sequence 3 ' end, TSR-N ' is comprised of the sequence of the reverse complementary sequence of object long probe 5 ' terminal sequence and the 18bp left and right reverse complemental of NS sequence 5 ' end, and the 5 ' end of TSR-N ' will be with phosphorylation modification;

5) with GSR-N ' and TSR-N ', take the nucleotide sequence of described long probe and carry out pcr amplification as template, obtain the Double-stranded nucleotide sequence of complementary strand 5 ' end phosphorylation modification;

6) purifying reclaims PCR product, removes the underproof PCR product of primer dimer and amplification length;

7) dsDNA of the PCR product after adopting nucleic acid T7 exonuclease to above purifying digests, and removes that ssDNA of 5 ' end phosphorylation mark;

8) adopt ssDNA purifying to reclaim test kit digestion after product is reclaimed, obtain the long probe that length relies on probe centering.

9), according to the needs of test set, 3 ' end of long probe is carried out to the modification of reporter group.

10) by ultraviolet spectrophotometer, the long probe OD260 obtaining and the ratio of OD280 are being detected, its ratio is between 1.6 ~ 2.0, and packing is standby.If ratio, not within the scope of this, carries out purifying to the long probe obtaining again.

3. preparation length relies on the short probe of probe centering

1) the short probe of length dependence probe centering is comprised of two parts, is respectively GSF and TSF;

2) for short probe, relate to pair for amplification primer, be respectively GSF-N ' and TSF-N ', wherein GSF-N ' is comprised of the sequence of the 15bp left and right of the sequence 5 ' end of GSF, the sequence of the 15bp left and right reverse complemental of TSF-N ' in the reverse complementary sequence of TSF sequence 3 ' end forms, and will be with upper phosphorylation modification at the 5 ' end of its GSF-N ';

3) with GSF-N ' and TSF-N ', take the nucleotide sequence of described short probe and carry out pcr amplification as template, obtain the Double-stranded nucleotide sequence of complementary strand 5 ' end phosphorylation modification;

4) purifying reclaims PCR product, removes primer dimer and underproof PCR product;

5) dsDNA of the PCR product after adopting nucleic acid T7 exonuclease to above purifying digests, and removes that ssDNA of 5 ' end phosphorylation mark;

6) adopt ssDNA purifying to reclaim test kit digestion after product is reclaimed, obtain the short probe that length relies on probe centering.

7) by ultraviolet spectrophotometer, the short probe OD260 obtaining and the ratio of OD280 are being detected, its ratio is between 1.6 ~ 2.0, and packing is standby.If ratio, not within the scope of this, carries out purifying to the short probe obtaining again.

The dsDNA sequence of 5 ' the end phosphorylation modification that described pcr amplification obtains need first be carried out T7 exonuclease through purifying again.

3 ' of described long probe holds reporter group in the modification of carrying out reporter group to select, according to detection means, determine and use which kind of reporter group, reporter group can be fluorophor, can select the albumen of particular dye sensitivity, also can select specific antibodies albumen.

In described T7 exonuclease digestion process, 1 T7 of unit exonuclease digestion for 1ug dsDNA.

MLPA probe preparation method of the present invention with adopt M13 phage to prepare MLPA to compare, have the following advantages:

1) pcr amplification primer is simple, only needs to consider the problem routinely of the PCR design of primers such as primer Tm value and length, by combining target nucleotide sequence, for masterplate design pair of primers.

2) utilize simple round pcr and T7 exonuclease digestion can obtain length and rely on probe pair, without phage, cultivate, can in one day, complete probe preparation work, greatly reduce MLPA technical threshold.

3) without cloning preparation, without specificity endonuclease digestion, simple to operate.

4) the required padding sequence of probe source is various and convenient, can make different probe padding sequence be consistent, and also can select as required the different masterplates required padding sequence that increases, and the non-specific hybridization while reducing hybridization, improves and be detected as power.

Accompanying drawing explanation

The Hybridization principle schematic diagram of Fig. 1 MLPA technology;

Fig. 2 probe preparation flow of the present invention figure;

Agarose gel electrophoresis analytical results figure in Fig. 3 embodiment of the present invention 1;

Electrocapillary phoresis analytical results figure in Fig. 4 embodiment of the present invention 2.

Embodiment

With specific examples, preparation method of the present invention is described by reference to the accompanying drawings, but not as a limitation of the invention, be specially the preparation and the detection thereof that with multiplex ligation amplification technology, detect the length dependence probe of Mammals cardiovascular disorder genes involved.

The length that embodiment 1 detects Mammals cardiovascular disorder genes involved ACE gene relies on right preparation and the detection thereof of probe, comprises the following steps:

1. for two pairs of primers of ACE gene design to be measured, a pair of is universal primer, for follow-up pcr amplification, detects, and is respectively GSF and GSR, and this is irrelevant to the native sequences (NS) in primer sequence and target site to be measured or fragment and long probe; Detection primer for target site to be measured or fragment, is respectively TSF and TSR.

2. preparation length relies on the long probe of probe centering:

1) determine one section with ACE gene to be measured and the irrelevant native sequences (NS) of universal primer, in NS and ACE gene order hen house to be measured;

2) for long probe, relate to pair for amplification primer, be respectively GSR-N ' and TSR-N ', wherein GSR-N ' is comprised of the sequence of the sequence of GSR and the 18bp left and right of NS sequence 3 ' end, TSR-N ' is comprised of the sequence of the reverse complementary sequence of object long probe 5 ' terminal sequence and the 18bp left and right reverse complemental of NS sequence 5 ' end, and the 5 ' end of TSR-N ' will be with phosphorylation modification;

3) pcr amplification, obtains the Double-stranded nucleotide sequence that complementary strand 5 ' is held phosphorylation modification;

5) Double-stranded nucleotide sequence of the PCR product after adopting T7 exonuclease to above purifying digests, and removes that ssDNA of 5 ' end phosphorylation mark;

6) adopt ssDNA purifying to reclaim test kit digestion after product is reclaimed, obtain the long probe that length relies on probe centering;

7) 3 ' end of long probe is carried out to the modification of reporter group;

8) long probe obtaining is being determined the quality of synthetic long probe by ultraviolet spectrophotometer.

3. preparation length relies on the short probe of probe centering

2) for short probe, relate to pair for amplification primer, be respectively GSF-N ' and TSF-N ', wherein GSF-N ' is comprised of the sequence of the 18bp left and right of the sequence 5 ' end of GSF, the sequence of the 18bp left and right reverse complemental of TSF-N ' in the reverse complementary sequence of TSF sequence 3 ' end forms, and its 5 ' end will be with phosphorylation modification;

3) with GSF-N ' and TSF-N ', take the nucleotide sequence of described long probe and carry out pcr amplification as template, obtain the Double-stranded nucleotide sequence of complementary strand 5 ' end phosphorylation modification;

7) the short probe obtaining is being determined the quality of synthetic short probe by ultraviolet spectrophotometer.

4. by the length of ACE gene obtained above, rely on what is said or talked about for carrying out hybridization with Mammals nuclear DNA, connect laggard performing PCR amplification, PCR product is carried out to gel electrophoresis analysis.

The design of implementation step 1 long probe amplimer is synthetic.

Design the irrelevant amplimer that is easy to carry out pcr amplification of target fragment a pair of and to be measured and long probe nucleotide sequence, be respectively GSR-N ' and TSR-N ', the 5 ' end of TSR-N ' carries out phosphorylation modification, for the pcr amplification detection of long probe.

Select plasmid pET-28a(purchased from Novagen company) in a part of sequence be the template sequence (NS) irrelevant with target fragment to be detected, and prepare special-purpose universal primer GSR-N ' (the 18bp reverse complementary sequence by 5 ' end of GSR and NS sequence forms) and prepare the downstream primer TSR-N ' (reverse complementary sequence of the 23bp being held by TSR and NS sequence 3 ' forms) that ACE gene length probe is used according to the long probe sequence of ACE gene and NS sequences Design synthetic long probe.

The concrete nucleotides sequence of above-mentioned primer is classified as:

GSR：5'- CACACAGGAAACAGCTATGAC -3' 21bp

TSR：5'-ACCTGCTGCCTATACAGTCACTTTT-3' 25bp

GSR-N ': 5'- gCGGTCCCAAAGGGTCAGTtCTAGAGCTAGGAGATGC-3'47 bp(underscore is partly the reverse complementary sequence of GSR, and remainder is the reverse complementary sequence of the 18bp of NS sequence 5 ' end)

TSR-N ': 5'- tGGACGACGGATATGTCAGTGAAAAgACGAAGGATTACGTCCTCAGCG-3'48bp 5' end phosphorylation modification (underscore is partly the reverse complementary sequence of TSR sequence, and remainder is the reverse complementary sequence of the 23bp of NS sequence 3 ' end)

The concrete sequence of long probe fragment that final pcr amplification obtains is:

CACACAGGAAACAGCTATGAC(GSR sequence)

AGATCTCGAT CCTCTACGCC GGACGCATCG TGGCCGGCAT CACCGGCGCC ACAGGTGCGG TTGCTGGCGC CTATATCGCC GACATCACCG ATGGGGAAGA

TCGGGCTCGC CACTTCGGGC TCATGAGCGC TTGTTTCGGC GTGGGTATGG TGGCAGGCCC CGTGGCCGGG GGACTGTTGG GCGCCATCTC CTTGCATGCA

CCATTCCTTG CGGCGGCGGT GCTCAACGGC CTCAACCTAC TACTGGGCTG CTTCCTAATG CAGGAGTCGC(NS sequence)

ACCTGCTGCCTATACAGTCACTTTT(TSR sequence)

The pcr amplification of implementation step 2 long probes and the purifying of product thereof reclaim

Take plasmid pET-28a as template, use primer GSR-N ' and TSR-N ' to carry out PCR amplification.

1) PCR reaction system:

2) PCR response procedures

① 94℃ 3min

② 46℃ 30s

③ 72℃ 40s

④ go to ②，35 cycle

⑤ 72℃ 5min

3) purifying of PCR product reclaims

Use the DNA fragmentation purification kit of the CODE:51106 of Qiagen company to reclaim PCR product.

The design of the short probe amplification primer of implementation step 3 is synthetic.

Design the irrelevant amplimer that is easy to carry out pcr amplification of target fragment a pair of and to be measured, be respectively GSF-N ' and TSF-N ', the 5 ' end of TSF-N ' carries out phosphorylation modification, for the pcr amplification detection of short probe.

The concrete nucleotides sequence of above-mentioned primer is classified as:

GSF：5'- CGCCAGGGTTTCCCAGTCACGAC -3' 23bp

TSF：5'- TTTTATGTGGTTTCGCCAATTTTAT -3' 25 bp

GSF-N ': 5 ' the end 15bp reverse complementary sequence that 5'-GCGGTCCCAAAGGGT-3'15bp(is GSF)

TSF-N ': 5'-AAAATACACCAAAGC-3'15 bp(is 3 ' end 15bp reverse complementary sequence of TSR sequence)

The concrete sequence of short probe fragment that final pcr amplification obtains is:

TTTTATGTGGTTTCGCCAATTTTAT(TSF sequence)

CGCCAGGGTTTCCCAGTCACGAC(GSF sequence)

The pcr amplification of implementation step 4 short probes and the purifying of product thereof reclaim

The plasmid mammalian genes group DNA of take is template, uses primer GSR-N ' and TSR-N ' to carry out PCR amplification.

1) PCR reaction system:

2) PCR response procedures

① 94℃ 3min

② 46℃ 30s

③ 72℃ 40s

④ go to ②，35 cycle

⑤ 72℃ 5min

3) purifying of PCR product reclaims

The PCR product that implementation step 5 T7 exonuclease digestion purifying reclaim.

Use the T7 exonuclease of NEB company to digest PCR product, the digestion of PCR product is obtained to ssDNA probe.

Implementation step 6 ssDNA probe purifying reclaim and quality inspection.

Use the ssDNA purifying recovery test kit of the CODE:51106 of Qiagen company to carry out purifying recovery to the product of above-mentioned Lamda exonuclease digestion.

The probe obtaining is measured to the ratio of OD260 and OD280 by ultraviolet spectrophotometer, ratio is qualified between 1.6 ~ 2.0, and ratio is the PCR product within the scope of this not, need to carry out PCR product purification again.

Implementation step 7 MLPA experimental verifications.

1) hybridization

By the length of ACE gene obtained above, rely on probe to carrying out hybridization with mammalian genes group DNA.

Reaction system:

Hybridization buffer: 1.5ul

Probe is to (long probe and short probe equal proportion are mixed): 2.5ul (30fmol)

Genomic dna: more than 5ul(total amount 50ng)

Reaction conditions:

1. 95 ℃ of sex change 5min of genomic dna

2. then add 95 ℃ of 1min of hybridization buffer and probe

3. hybridize 60 ℃ 16 hours

2) connect

Linked system:

Hybridization product: 8ul

Taq ligase enzyme: 5U

10×Taq buffer ：3ul

ddH ₂O：up to 30ul

Condition of contact:

15min95 ℃ of reaction 7min of 54 ℃ of reactions.

① 54℃ 15min

② 95℃ 7min

3) PCR augmentation detection

PCR system:

PCR response procedures:

① 95℃ 5min

② 95℃ 30s

③ 60℃ 30s

④ 72℃ 40s

⑤ go to ②，40 cycle

⑥ 72℃ 5min

4) agarose gel electrophoresis analysis

Fig. 3 is shown in by analytical results schematic diagram, the MLPA result of ACE gene there will be three kinds of situations (ins 644bp, ins/del 644bp, 364, del 364 bp), the negative control that the water of take is masterplate does not have pcr amplification product, and probe prepared by provable the present invention can be used for MLPA experiment.

The length that embodiment 2 detects Mammals cardiovascular disorder genes involved ACE, GNB3, NOS3 gene relies on preparation and the detection thereof of probe groups, comprises the following steps:

1. the length dependence probe groups for ACE, GNB3, NOS3 gene designs a pair of universal primer, for follow-up pcr amplification, detect, be respectively GSF and GSR, this is irrelevant to the native sequences (NS) in primer sequence and target site to be measured or fragment and long probe.

The concrete nucleotides sequence of above-mentioned primer is classified as:

GSR：5'- CACACAGGAAACAGCTATGAC -3' 21bp

TSR：5'-ACCTGCTGCCTATACAGTCACTTTT-3' 25bp

2. for a pair of detection primer for target site to be measured or fragment of ACE gene design to be measured, be respectively TSF and TSR.

3. for a pair of detection primer for target site to be measured or fragment of GNB3 gene design to be measured, be respectively TSF1, TSRC1 and TSRT1.

4. for a pair of detection primer for target site to be measured or fragment of NOS3 gene design to be measured, be respectively TSF1, TSRG2 and TSRT2.

The design of implementation step 1 long probe amplimer is synthetic.

1. the length of preparation ACE gene relies on the long probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the long probe amplimer of ACE gene is classified as:

CACACAGGAAACAGCTATGAC(GSR sequence)

ACCTGCTGCCTATACAGTCACTTTT(TSR sequence)

2. the length of preparation GNB3 gene relies on the long probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the long probe amplimer of GNB3 gene is classified as:

GSR：5'- CACACAGGAAACAGCTATGAC -3' 21bp

TSRC1：5'- TCATCTGCGGCATCACGTCCGTGGC-3' 25bp

TSRT1：5'- TCATCTGCGGCATCACGTCTGTGGC-3' 25bp

TSRC1-N ': 5'- aGTAGACGCCGTAGTGCAGGCACCGgACGAAGGATTACGTCCTCAGCG-3'48bp 5' end phosphorylation modification (underscore is partly the reverse complementary sequence of TSRC1 sequence, and remainder is the reverse complementary sequence of the 23bp of NS sequence 3 ' end)

TSRT1-N ': 5'- aGTAGACGCCGTAGTGCAGACACCGgACGAAGGATTACGTCCTCAGCG-3'48bp 5' end phosphorylation modification (underscore is partly the reverse complementary sequence of TSRT1 sequence, and remainder is the reverse complementary sequence of the 23bp of NS sequence 3 ' end)

The concrete sequence of long probe fragment (GNB3 gene C site) that final pcr amplification obtains is:

CACACAGGAAACAGCTATGAC(GSR sequence)

TCGCAAATTG TCGCGGCGAT TAAATCTCGC GCCGATCAAC TGGGTGCCAG CGTGGTGGTG TCGATGGTAG AACGAAGCGG CGTCGAAGCC TGTAAAGCGG

CCATTCCTTG CGGCGGCGGT GCTCAACGGC CTCAACCTAC TACTGGGCTG CTTCCTAATG CAGGAGTCGC(NS1 sequence)

TCATCTGCGGCATCACGTCCGTGGC(TSRC1 sequence)

The concrete sequence of long probe fragment (GNB3 gene T site) that final pcr amplification obtains is:

CACACAGGAAACAGCTATGAC(GSR sequence)

TCATCTGCGGCATCACGTCTGTGGC(TSRT1 sequence)

3. the length of preparation NOS3 gene relies on the long probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the long probe amplimer of NOS3 gene is classified as:

GSR：5'- CACACAGGAAACAGCTATGAC -3' 21bp

TSRG2：5'- TGCTGCAGGCCCCAGATGAGCCCCC-3' 25bp

TSRT2：5'- TGCTGCAGGCCCCAGATGATCCCCC-3' 25bp

TSRG2-N ': 5'- aCGACGTCCGGGGTCTACTCGGGGGgACGAAGGATTACGTCCTCAGCG-3'48bp 5' end phosphorylation modification (underscore is partly the reverse complementary sequence of TSRG2 sequence, and remainder is the reverse complementary sequence of the 23bp of NS sequence 3 ' end)

TSRT2-N ': 5'- aCGACGTCCGGGGTCTACTAGGGGGgACGAAGGATTACGTCCTCAGCG-3'48bp 5' end phosphorylation modification (underscore is partly the reverse complementary sequence of TSRT2 sequence, and remainder is the reverse complementary sequence of the 23bp of NS sequence 3 ' end)

The concrete sequence of long probe fragment (NOS3 gene G site) that final pcr amplification obtains is:

CACACAGGAAACAGCTATGAC(GSR sequence)

CCGCTGGATG ACCAGGATGC CATTGCTGTG GAAGCTGCCT GCACTAATGT TCCGGCGTTA TTTCTTGATG TCTCTGACCA GACACCCATC AACAGTATTA

CCATTCCTTG CGGCGGCGGT GCTCAACGGC CTCAACCTAC TACTGGGCTG CTTCCTAATG CAGGAGTCGC(NS2 sequence)

TGCTGCAGGCCCCAGATGAGCCCCC(TSRG2 sequence)

The concrete sequence of long probe fragment (NOS3 gene T site) that final pcr amplification obtains is:

CACACAGGAAACAGCTATGAC(GSR sequence)

TGCTGCAGGCCCCAGATGATCCCCC(TSRT2 sequence)

Operation, with embodiment 1, is used FAM fluorophor to modify at long probe 3 ' end.

1. the length of preparation ACE gene relies on the short probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the short probe amplification primer of ACE gene is classified as:

GSF：5'- CGCCAGGGTTTCCCAGTCACGAC -3' 23bp

TSF：5'- TTTTATGTGGTTTCGCCAATTTTAT -3' 25 bp

TSF-N ': 5'-AAAATACACCAAAGC-3'15 bp(is 3 ' end 15bp reverse complementary sequence of TSF sequence)

The concrete sequence of short probe fragment (ACE gene) that final pcr amplification obtains is:

TTTTATGTGGTTTCGCCAATTTTAT(TSF sequence)

CGCCAGGGTTTCCCAGTCACGAC(GSF sequence)

2. the length of preparation GNB3 gene relies on the short probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the short probe amplification primer of GNB3 gene is classified as:

GSF：5'- CGCCAGGGTTTCCCAGTCACGAC -3' 23bp

TSF1：5'- CTTCTCCCTCAGTGGCCGCCTACTA -3' 25 bp

TSF1-N ': 5'-GAAGAGGGAGTCACC-3'15 bp(is 3 ' end 15bp reverse complementary sequence of TSF1 sequence)

The concrete sequence of short probe fragment (GNB3 gene) that final pcr amplification obtains is:

CTTCTCCCTCAGTGGCCGCCTACTA(TSF1 sequence)

CGCCAGGGTTTCCCAGTCACGAC(GSF sequence)

3. the length of preparation NOS3 gene relies on the short probe of probe centering:

Operation is with embodiment 1.

Concrete nucleotides sequence for the short probe amplification primer of NOS3 gene is classified as:

GSF：5'- CGCCAGGGTTTCCCAGTCACGAC -3' 23bp

TSF2：5'- AGAACTCTTCCTTCTGCCCCCCGAG -3' 25 bp

TSF2-N ': 5'-TCTTGAGAAGGAAGA-3'15 bp(is 3 ' end 15bp reverse complementary sequence of TSF2 sequence)

The concrete sequence of short probe fragment (NOS3 gene) that final pcr amplification obtains is:

AGAACTCTTCCTTCTGCCCCCCGAG(TSF2 sequence)

CGCCAGGGTTTCCCAGTCACGAC(GSF sequence)

Operation is with embodiment 1.

Implementation step 6 ssDNA probe purifying reclaim and quality inspection.

Operation is with embodiment 1.

Implementation step 7 MLPA experimental verifications.

1) hybridization

Reaction system:

Hybridization buffer: 1.5ul

Genomic dna: more than 5ul(total amount 50ng)

Reaction conditions:

1. 95 ℃ of sex change 5min of genomic dna

2. then add 95 ℃ of 1min of hybridization buffer and probe

3. hybridize 60 ℃ 16 hours

2) connect

Linked system:

Hybridization product: 8ul

Taq ligase enzyme: 5U

10×Taq buffer ：3ul

ddH2O：up to 30ul

Condition of contact:

15min95 ℃ of reaction 7min of 54 ℃ of reactions.

① 54℃ 15min

② 95℃ 7min

3) PCR augmentation detection

PCR system:

PCR response procedures:

① 95℃ 5min

② 95℃ 30s

③ 60℃ 30s

④ 72℃ 40s

⑤ go to ②，40 cycle

⑥ 72℃ 5min

4) electrocapillary phoresis analysis

Analytical results is shown in Fig. 4, detects genomic MLPA result and can go out item, and the negative control that the water of take is masterplate does not have PCR amplified production, and probe prepared by provable the present invention can be used for MLPA experiment.

The upper marine excellent medical biotechnology of <110> company limited

<120> length for detection of transgenation relies on probe preparation method

<160> 23

<210> 1

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> GSR

<400> 1

cacacaggaa acagctatga c 21

<210> 2

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSR

<400> 2

acctgctgcc tatacagtca ctttt 25

<210> 3

<211> 37

<212> DNA

<213> artificial sequence

<220>

<223> GSR-N’

<400> 3

gcggtcccaa agggtcagtt ctagagctag gagatgc 37

<210> 4

<211> 47

<212> DNA

<213> artificial sequence

<220>

<223> TSR-N’

<400> 4

tggacgacgg atatgtcagtg aaaagacgaa ggattacgtc ctcagcg 47

<210> 5

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> GSF

<400> 5

cgccagggtt tcccagtcac gac 23

<210> 6

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> GSF

<400> 6

ttttatgtgg tttcgccaat tttat 25

<210> 7

<211> 15

<212> DNA

<213> artificial sequence

<220>

<223> GSF-N’

<400> 7

gcggtcccaa agggt 15

<210> 8

<211> 15

<212> DNA

<213> artificial sequence

<220>

<223> TSF-N’

<400> 8

aaaatacacc aaagc 15

<210> 9

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSRC1

<400> 9

tcatctgcgg catcacgtcc gtggc 25

<210> 10

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSRT1

<400> 10

tcatctgcgg catcacgtct gtggc 25

<210> 11

<211> 48

<212> DNA

<213> artificial sequence

<220>

<223> TSRC1-N’

<400> 11

agtagacgcc gtagtgcagg caccggacga aggattacgt cctcagcg 48

<210> 12

<211> 48

<212> DNA

<213> artificial sequence

<220>

<223> TSRT1-N’

<400> 12

agtagacgcc gtagtgcaga caccggacga aggattacgt cctcagcg 48

<210> 13

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSRG2

<400> 13

tgctgcaggc cccagatgag ccccc 25

<210> 14

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSRT2

<400> 14

tgctgcaggc cccagatgat ccccc 25

<210> 15

<211> 48

<212> DNA

<213> artificial sequence

<220>

<223> TSRG2-N’

<400> 15

acgacgtccg gggtctactc ggggggacga aggattacgt cctcagcg 48

<210> 16

<211> 48

<212> DNA

<213> artificial sequence

<220>

<223> TSRT2-N’

<400> 16

acgacgtccg gggtctacta ggggggacga aggattacgt cctcagcg 48

<210> 17

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSF1

<400> 17

cttctccctc agtggccgcc tacta 25

<210> 18

<211> 15

<212> DNA

<213> artificial sequence

<220>

<223> TSF1-N’

<400> 18

gaagagggag tcacc 15

<210> 19

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> TSF2

<400> 19

agaactcttc cttctgcccc ccgag 25

<210> 20

<211> 15

<212> DNA

<213> artificial sequence

<220>

<223> TSF2-N’

<400> 20

tcttgagaag gaaga 15

<210> 21

<211> 270

<212> DNA

<213> artificial sequence

<220>

<223> NS

<400> 21

agatctcgat cctctacgcc ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 270

<210> 22

<211> 370

<212> DNA

<213> artificial sequence

<220>

<223> NS1

<400> 22

agatctcgat cctctacgcc ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg atggggaaga tcgcaaattg tcgcggcgat taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc tgtaaagcgg tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 370

<210> 22

<211> 470

<212> DNA

<213> artificial sequence

<220>

<223> NS2

<400> 22

agatctcgat cctctacgcc ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg atggggaaga tcgcaaattg tcgcggcgat taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc tgtaaagcgg ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 470

Claims

1. the length for multiplex ligation amplification technology relies on probe to preparation method, comprises the preparation of long probe and the preparation of short probe.

2. according to the length for multiplex ligation amplification technology described in claim 1, rely on probe to preparation method, it is characterized in that, the preparation method of described long probe comprises the following steps:

1) design the irrelevant universal primer of native sequences in target fragment a pair of and to be measured and long probe, GSF and GSR, for last PCR augmentation detection;

2) determine one section with long probe and the irrelevant native sequences NS of universal primer, and for designing the primer of pair for amplification long probe, be respectively GRS-N ' and GSF-N ', wherein GSR-N ' is comprised of the sequence of the sequence of GSR and the 18bp left and right of NS sequence 3 ' end, TSR-N ' is comprised of the sequence of the reverse complementary sequence of object long probe 5 ' terminal sequence and the 18bp left and right reverse complemental of NS sequence 5 ' end, and the 5 ' end of TSR-N ' will be with phosphorylation modification;

3) with GRS-N ' and GSF-N ' take described one section as template, carry out PCR amplification with probe and the irrelevant nucleotide sequence of universal primer, obtain the Double-stranded nucleotide sequence of complementary strand 5 ' end phosphorylation modification;

4) purifying reclaims PCR product;

5) adopt T7 exonuclease to digest above dsDNA sequence, remove that ssDNA of 5 ' phosphorylation mark;

6), according to the needs of test set, 3 ' end of long probe is carried out to the modification of reporter group;

7) adopt ssDNA purifying to reclaim test kit digestion product is reclaimed, just obtain long probe.

3. the length for multiplex ligation amplification technology according to claim 2 relies on the preparation method of probe to long probe, it is characterized in that, step 2) described native sequences NS, native sequences can be selected any and target gene fragment and the irrelevant sequence of universal primer.

4. the length for multiplex ligation amplification technology according to claim 2 relies on the preparation method of probe to long probe, it is characterized in that, and the modification of the reporter group described in step 6), reporter group can be used FAM, HAX, Cys5, Cys3.

5. according to the probe preparation method for multiplex ligation amplification technology described in claim 2, it is characterized in that, the Double-stranded nucleotide sequence of 5 ' the end phosphorylation modification that PCR amplification obtains described in step 3) need first carry out the digestion of T7 excision enzyme through purifying again.

6. the probe preparation method for multiplex ligation amplification technology according to claim 2, is characterized in that, in the T7 excision enzyme digestive process described in step 5), 1ugdsDNA digests with 1 T7 of unit excision enzyme.

7. according to the length for multiplex ligation amplification technology described in claim 1, rely on probe to preparation method, it is characterized in that, the preparation method of described short probe comprises the following steps:

1) for short probe, relate to pair for amplification primer, be respectively GSF-N ' and TSF-N ', wherein GSF-N ' is comprised of the sequence of the 18bp left and right of the sequence 5 ' end of GSF, the sequence of the 18bp left and right reverse complemental of TSF-N ' in the reverse complementary sequence of TSF sequence 3 ' end forms, and its 5 ' end will be with phosphorylation modification;

2) with GSF-N ' and TSF-N ', take the nucleotide sequence of described long probe and carry out pcr amplification as template, obtain the Double-stranded nucleotide sequence of complementary strand 5 ' end phosphorylation modification;

3) purifying reclaims PCR product;

4) Double-stranded nucleotide sequence of the PCR product after adopting T7 exonuclease to above purifying digests, and removes that ssDNA of 5 ' end phosphorylation mark;

5) adopt ssDNA purifying to reclaim test kit digestion after product is reclaimed, obtain the short probe that length relies on probe centering.

8. according to the probe preparation method for multiplex ligation amplification technology described in claim 7, it is characterized in that, the Double-stranded nucleotide sequence of 5 ' the end phosphorylation modification that PCR amplification obtains described in step 3) need first carry out the digestion of T7 excision enzyme through purifying again.

9. the probe preparation method for multiplex ligation amplification technology according to claim 7, is characterized in that, in the T7 excision enzyme digestive process described in step 5), 1ugdsDNA digests with 1 T7 of unit excision enzyme.