CN104099418A - Protein interaction detection method based on nucleotide sequence - Google Patents

Abstract

The invention relates to a protein interaction detection method, namely, a PDf (protein dimerization footprinting) method based on a nucleotide sequence, a kit and an application of the kit. The basic principle is that based on the influence of the interaction of target protein on the combined structural domain of DNAs fused by the protein and combination dynamics of a corresponding special DNA (deoxyribonucleic acid) sequence, the interaction of target protein can be represented by the corresponding special DNA sequence, and the target protein interaction strength is obtained by a copy number of the special DNA sequence.

Description

Protein interaction detection method based on nucleotide sequence

Technical field

The invention belongs to protein research technical field, be specifically related to the detection of protein interaction, relate in particular to utilize DNA encoding protein interaction information carry out protein interaction at body detecting method, test kit and uses thereof.

Background technology

Although tradition has been widely used in biological study in body protein interphase interaction detection technique, there is many deficiencies.For example, yeast-two hybrid technique (Y2H) is although realize simple, but its detection of dynamic and detection by quantitative ability are obviously not enough, and FRET (fluorescence resonance energy transfer) technology (FRET) is although have good spatial and temporal resolution and quantitation capabilities, it is limited to the fluorescence intensity of fluorescin and the character such as space structure of protein.And these traditional detection technology only can, for single protein interaction to detecting, can not detect including multipair interactional protein interaction network in same cell simultaneously.

For this reason, we are by invention protein dimerization footprinting (Protein Dimerization footprinting, be called for short PDf) detection technique, detection technique based on nucleotide sequence is detected and combined with protein-protein interaction, thereby realize on body ground, qualitative and/or quantitatively, dynamically detect protein interaction, and make directly protein interaction network to be detected and becomes possibility.

Summary of the invention

Present method is utilized the change of binding kinetics between the DNA binding domains of target protein matter interphase interaction intensity pair and its fusion and corresponding specific DNA binding site, realize the interphase interaction of target protein matter is represented by corresponding specific DNA sequences, target protein matter interphase interaction intensity is provided by the copy number of this sequence.

Concrete, the present invention relates to the following:

1. the method for obtaining protein-protein interaction information, it comprises the steps:

(1) in host cell, express and merge the target protein matter that has DNA binding domains, while the avidity of corresponding specific DNA sequences being significantly higher than to monomer during described DNA binding domains dimerization;

(2) under physiological status, with linking agent, process, target protein matter dimer and DNA in host cell are cross-linked to form to complex body;

(3) DNA is broken into small segment;

(4) small segment described in separation and Extraction, and digest with DNase I;

(5) make to spend linking agent and process, the product of step (4) is gone to be cross-linked, and purifying obtains DNA fragmentation;

(6) DNA fragmentation that detecting step (5) obtains.

2. according to the method described in 1, described host cell comprises intestinal bacteria, yeast, mammalian cell.

3. according to the method described in 1, described DNA binding domains comprises the DNA binding domains of lambda particles phage protein C I and meets the mutant of DNA binding domains character described in claim 1 step (1), the DNA binding domains of lambda particles phage protein C RO and meet the mutant of DNA binding domains character described in claim 1 step (1); Described corresponding specific DNA sequences comprises CI binding sequence and their mutant nucleotide sequence, CRO binding sequence and their mutant nucleotide sequence.

4. according to the method described in 1, the linking agent using in described step (2) is formaldehyde.

5. according to the method described in 1, in described step (3), use MNase or supersound process to smash DNA for small segment.

6. according to the method described in 1, that in described step (5), uses goes linking agent for Proteinase K.

7. according to the method described in 1, detection in described step (6) comprises the qualitative and/or detection by quantitative based on nucleotide sequence, described detection by quantitative comprises quantitative PCR, high-flux sequence and/or DNA microarray, and described qualitative detection comprises PCR and/or agarose gel electrophoresis.

8. for obtaining a test kit for protein interaction information, comprising:

(1) with the expression vector of DNA binding domains and corresponding specific DNA sequences, while the avidity of corresponding specific DNA sequences being significantly higher than to monomer during described DNA binding domains dimerization;

(2) host cell;

(3) linking agent and reaction terminating liquid thereof;

(4) smash device or reagent and the reaction buffer thereof of DNA;

(5) DNase I and reaction buffer thereof;

(6) remove linking agent;

(7) DNA detection device.

9. according to the test kit described in 8, described linking agent is formaldehyde, and described crosslinking reaction stop buffer is glycine solution, described in to remove linking agent be Proteinase K, described in smash DNA reagent be MNase.

10. according to the test kit described in 8, described DNA detection device comprises qualitative and/or quantitative testing device, described quantitative testing device comprises quantitative PCR device, high-flux sequence device or DNA microarray proofing unit, and described qualitative detection device comprises PCR device or agarose gel electrophoresis device.

Method of the present invention is compared with the result of FRET (fluorescence resonance energy transfer) (FRET) technology and yeast two-hybrid (Y2H) technology, and method of the present invention can be well carried out on body ground, quantitatively, dynamically detect the protein-protein interaction of varying strength.Further, present method detects the detection technique based on nucleotide sequence to combine with protein interaction, can greatly improve the flux of detection, and by using different and non-cross DNA binding domains-specific DNA sequences pair, make the method can on system level, direct quantitatively, dynamically detect the protein interaction network that many protein interactions form simultaneously.

Method of the present invention can help biologist's direct quantitative Way for Studying Protein-Protein Interactions group system level, but not simply utilizes the data of single protein interaction to carry out analysing protein interactive network by building corresponding network model.

Detailed Description Of The Invention

Below technical scheme of the present invention is elaborated further.It should be pointed out that each embodiment of the present invention can combine as required by any way.

First aspect of the present invention provides a kind of protein dimerization footprinting (PDf) that obtains protein-protein interaction information, its principle is the impact on binding kinetics between the DNA binding domains of its fusion and corresponding specific DNA sequences based on target protein matter interphase interaction intensity, realization represents the interphase interaction of target protein matter by corresponding specific DNA sequences, target protein matter interphase interaction intensity is provided by the copy number of this specific DNA sequences.

In one embodiment, said method comprising the steps of:

(1) in host cell, express to merge the target protein matter that has DNA binding domains, during described DNA binding domains dimerization to the avidity of corresponding specific DNA during far above monomer;

(2) under physiological status, with linking agent, process, target protein matter dimer and DNA in host cell are cross-linked to form to complex body;

(3) DNA is broken into small segment;

(4) small segment described in separation and Extraction, and digest with DNase I;

(5) make to spend linking agent and process, the product of step (4) is gone to be cross-linked, and purifying obtains DNA fragmentation;

(6) DNA fragmentation that detection by quantitative step (5) obtains.

In a preferred embodiment, as long as to the avidity of corresponding specific DNA, the DNA binding domains during far above monomer may be used to the present invention during dimerization, this kind of DNA binding domains and corresponding specific DNA sequences include but not limited to DNA binding domains and the CI binding sequence of lambda particles phage protein C I, the DNA binding domains of lambda particles phage protein C RO and CRO binding sequence.In such cases, when occurring to interact between target protein, DNA binding domains forms dimer, and this dimer is combined with corresponding specific DNA, thus in cross-linking process due to the enough nearly DNA-protein dimer mixture that forms of distance; On the contrary, when not interacting between target protein, DNA binding domains exists with monomeric form, because the DNA binding domains of monomeric form is not combined with specific DNA or in conjunction with very weak, thereby can not be effectively crosslinked, in subsequent process, will distinguish with dimer.

In a preferred embodiment, crosslinked referring to as herein described is fixed together the molecule apart from enough near to be beneficial to subsequent analysis.In a preferred embodiment, described linking agent includes but not limited to formaldehyde, glutaraldehyde etc.

In a preferred embodiment, the method for smashing DNA and be small segment is well known by persons skilled in the art, comprises ultrasonic and enzyme processing etc., preferably with MNase, processes.

In a preferred embodiment, detect go the method for DNA fragmentation separated after crosslinked include but not limited to PCR, agarose gel electrophoresis, quantitative PCR, high-flux sequence and DNA microarray etc. based on the qualitative of nucleotide sequence and or quantitative measurement technology.

It is a kind of for obtaining the test kit of protein interaction information that second aspect of the present invention provides, and comprising:

(1) with the expression vector of DNA binding domains and corresponding specific DNA sequences, during described DNA binding domains dimerization to the avidity of corresponding specific DNA during far above monomer;

(2) host cell;

(3) linking agent and reaction terminating liquid thereof;

(4) smash device and reagent and the reaction buffer thereof of DNA;

(5) DNase I and reaction buffer thereof;

(6) remove linking agent;

(7) DNA detection device.

In a preferred embodiment, described host cell includes but not limited to bacterium, yeast, and mammalian cells etc., described linking agent, remove linking agent, smash the device of DNA and reagent, quantitative testing device etc. all as previously mentioned.

Accompanying drawing explanation

Fig. 1. carrier pPIDA1 and pPIDK1 structural representation, wherein (A) is pPIDA1, (B) be pPIDK1, Plac is promotor, and CI (N) is the DNA binding domains of protein C I, MCS is multiple clone site, Ter is transcription termination sequence, and BR is specific DNA binding sequence, and AmpR is ammonia benzyl sistomycocin resistant gene, KanR is kalamycin resistance gene, the replication orgin that Ori is carrier.

Fig. 2. protein dimerization footprinting (PDf) fundamental diagram.

Fig. 3. the dimerization domain C I (C) of protein C I of take is target protein matter checking PDf detection method.(a) be the schematic diagram of the carrier of structure, wherein BR-pSP73 is blank, only contains the corresponding specific DNA sequences BR of CI protein DNA binding domains CI (N); The negative contrast of pPIDA1, contains CI protein DNA binding domains CI (N) (can not dimerization) and corresponding specific DNA sequences BR; The positive contrast of CI (C)-pPIDA1, containing can the CI protein dimerization domain C I (C) of dimerization and the fused protein of CI protein DNA binding domains CI (N) and corresponding specific DNA sequences BR.(b) by 12 hours DNase I, fully digest, PDf method can be distinguished blank group, negative group and positive group well, thereby has verified the exactness of PDf detection method.(c) in PDf method specific DNA sequences (BR) quantity of two carrier systems with the changing conditions of induction time.

Experimental verification and the analysis of the reaction Kinetics Model of Fig. 4 .PDf detection method.(a) PDf measured value of experiment and high consistency based on kinetic model calculated value, proved the reliability of model; (b) by kinetic model, calculate, when target protein matter monomer concentration Cs changes between 0.01-100 times, the changing conditions of PDf signal; (c) the positive and negative experimental group of contrast, the PDf signal that DNA binding domains is combined with specific DNA sequences and DNA binding domains is combined with specific DNA sequences during protein monomers state during protein dimerization.

Fig. 5. the Static and dynamic protein interaction based on PDf method detects the comparison with existing protein-protein interaction detection technique.(a) use respectively yeast two-hybrid (Y2H), FRET (fluorescence resonance energy transfer) (FRET) and PDf method, the static protein interaction in intestinal bacteria chemotactic system is detected.(b) PhoB dimerization intensity dynamic change in time under the environment of different phosphate acid concentration in intestinal bacteria PhoR/PhoB phosphoric acid signal transducting system.(c) utilize PhoR/PhoB phosphoric acid signal transducting system that FRET method records under the environment of different phosphate acid concentration after abundant reaction the dimerization intensity of PhoB.

Fig. 6. non-cross DNA binding domains-specific DNA sequences interact right design and test.(a) structural information based on PDB structure 1LMB, by FoldX computed in software wild-type CI protein DNA binding domains CI (N) ^wtwith mutant CI (N) ^mut1from the interaction energy of different specific DNA sequences, under the condition of all possible specific DNA sequences of traversal, with respect to wild-type DNA binding domains (CI (N) ^wt) variable quantity of dimer and wild-type specific DNA sequences (BR1) interaction energy.Wherein, on the occasion of representing that interaction energy increases, negative value represents that interaction energy declines.(b) based on DNA binding domains CI (N) ^wtand CI (N) ^mut1and the PDf detected result of different B R sequence, wherein dotted line represents standard value.X-coordinate CI (N) in figure ^wt-BRi (i=1,4,5,6,7,8,9,10) represents that the DNA binding domains in two carriers is CI (N) ^wt, specific DNA sequences is BRi; CI (N) ^mut1-BRi (i=1,4,5,6,7,8,9,10) represents that the DNA binding domains in two carriers is CI (N) ^mut1, specific DNA sequences is BRi; CI (N) ^wt/mut1-BRi (i=1,4,5,6,7,8,9,10) represents that in two carriers, a DNA binding domains is CI (N) ^wt, another is CI (N) ^mut1, specific DNA sequences is BRi.(c) utilize PDf technology in health check-up, to survey the schematic diagram of multipair protein interaction simultaneously.

Embodiment

Materials and methods

(1) bacterial strain and carrier

A. clone strain: (raw work is biological, SD8411) for e. coli k12 strain DH5 α

B. expression strain: e. coli k12 strain JM109 (Takara, D9052A)

C. carrier: pSP73 (Promega, P2221), pSB1K3 (iGEM Distribution)

(2) substratum and reagent

A. substratum:

LB liquid nutrient medium:

Sodium-chlor 1g, yeast extract 0.5g, peptone 1g, distilled water 100ml

LB solid medium:

Sodium-chlor 1g, yeast extract 0.5g, peptone 1g, agar 1.2g, distilled water 100ml

M9 histidine defect substratum:

Solution 1:20% glucose solution 2ml, 20mM adenine solution 1ml, 10X histidine defect amino acid supplementation liquid 10ml

Solution 2:1M Adlerika 0.1ml, 1M thiamine hydrochloride cellulose solution 0.1ml, 10mM solution of zinc sulfate 0.1ml, 100mM calcium chloride solution 0.1ml, 100mM isopropylthiogalactoside (IPTG) 0.05ml, in solution 1, add solution 2 and mix, and adding wherein after 10ml10XM9 salt, with distilled water, being settled to 100ml.

B. reagent

10X histidine defect amino acid supplementation liquid:

VITAMIN B4 200mg, arginine hydrochloride 200mg, Isoleucine 300mg, lysine hydrochloride 300mg, methionine(Met) 200mg, phenylalanine 500mg, Threonine 2000mg, tyrosine 300mg, uridylic 200mg, α-amino-isovaleric acid 1500mg, leucine 1000mg, tryptophane 200mg, distilled water 1L.

10X M9 salt:

Sodium phosphate dibasic 67.8g, potassium primary phosphate 30g, sodium-chlor 5g, ammonium chloride 10g, distilled water 1L.

Antibiotic solution: ammonia benzyl sistomycocin solution, kantlex solution

Pierce Chromatin Prep Module(Thermo Scientific，26158)

(raw work is biological, SK1144) for UNIQ-10 pillar oligonucleotide purification kit

(raw work is biological, SK8192) for SanPrep pillar plasmid DNA a small amount of extraction agent box

AxyPrep PCR cleaning agents box (Axygen, AP-PCR-50)

In-Fusion HD Cloning Kit(CloneTech，639648)

Deoxyribonuclease I (DNase I) (2,000U/mL, New England BioLabs, M0303S)

PrimeSTAR Max DNA Polymerase(Takara，R045A)

SYBR Premix EX Tag II(Takara，RR820A)

Restriction enzyme:

EcoRI，BamHI，KpnI，SpeI，NheI，XhoI，DpnI

37% formaldehyde solution

Lysis Buffer I：

In the ratio preparation that adds 1ul proteolytic enzyme and inhibitors of phosphatases mixed solution in every 100ul Membrane Extraction Buffer (Pierce Chromatin Prep Module)

MNase enzyme is cut buffering working fluid

By adding the preparation of 0.1ul1M dithiothreitol (DTT) (DTT) solution proportion in every 100ul MNase enzyme cutting buffering liquid (Pierce Chromatin Prep Module).

Remove crosslinked mixed solution (10ul):

Remove nuclease water 6.6 μ l, 5M sodium chloride solution 2.4 μ l, Proteinase K 1 μ l.

(3) vector construction

A.pPIDA1 and pPIDK1 detect the structure of carrier

(i) MCS-pSP73, MCS-pSB1K3 and BR-pSP73 vector construction

By the multiple clone site MCS sequence shown in SEQ ID NO:1

SEQ ID NO：1

5’-GGTACCGCGGCCGCTACTAGTGCCATGGAGGCCGAATTCCCGGGGATCCGTCGACCTGCATGCTAGCAGCGGCCG-3’

By ClaI and two restriction enzymes of XhoI, be inserted in pSP73 carrier, obtain MCS-pSP73.

By multiple clone site MCS sequence shown in SEQ ID NO:2

SEQ ID NO：2

5’-GGTACCGCGGCCGCTACTAGTGCCATGGAGGCCGAATTCCCGGGGATCCGTCGACCTGCATGCTAGCAGCGGCCGCTCGAG-3’

By AatII and two restriction enzymes of PstI, be inserted in pSB1K3 carrier, obtain MCS-pSB1K3.

In addition, the corresponding specific DNA sequences BR (SEQ ID NO:21) of DNA binding domains CI (N) is inserted between the NheI of MCS-pSP73 carrier and XhoI site and obtains BR-pSP73 carrier.

(ii) clone of CI (N) and CI (N)-MCS-pSP73 and CI (N)-MCS-pSB1K3 vector construction

Utilize following primer to take the DNA binding domains CI (N) of lambda particles phage genome as masterplate clone protein C I.

Clone's forward primer (SEQ ID NO:3):

5’-GGGGTACCGCGGCCGCTACTAGTATGAGCACAAAAAAGAAACCATTAACACAAGAG-3’

Clone's reverse primer (SEQ ID NO:4):

5’-CCCTCGAGCGGCCGCTGCTAGCCTGAACATGTGAAAAAACAGGGTACTCAT-3’

Clone products CI (N) (SEQ ID NO:5):

5’-GGGGTACCGCGGCCGCTACTAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCTAGCAGCGGCCGCTCGAGGG-3’

Above clone products is inserted between the KpnI of MCS-pSP73 and MCS-pSB1K3 carrier and SpeI site and is obtained CI (N)-MCS-pSP73 and CI (N)-MCS-pSB1K3 carrier by restriction enzyme KpnI and NheI.

(iii) pPIDA1 and pPIDK1 vector construction

Ribosome bind site RBS and promotor Plac sequence are inserted between the KpnI and SpeI site of CI (N)-MCS-pSP73 and CI (N)-MCS-pSB1K3 successively, transcription termination sequence Ter and the corresponding specific DNA sequences BR of cI (N) are inserted between the NheI and XhoI site of CI (N)-MCS-pSP73 and CI (N)-MCS-pSB1K3 successively, finally obtain pPIDA1 and pPIDK1 carrier.Wherein Plac, RBS and Ter sequence are as follows:

Plac(SEQ ID NO：6)：

5’-CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACA-3’

RBS(SEQ ID NO：7)：

5’-ATTAAAGAGGAGAAA-3’

Ter(SEQ ID NO：8)：

5’-CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA-3’

B. gene clone:

With following primer clone goal gene, the polymerase chain reaction obtaining (PCR) product is carried out to purifying with AxyPrep PCR cleaning agents box, obtain that product can be used for subsequent step or in-20 ℃ of preservations.

Clone's forward primer (SEQ ID NO:9):

5 '-CATGGAGGCCGAATTC111222333444555666777888-3 ' (wherein i.e. the 1st codon of 111 initiation codons that are goal gene, the follow-up codon sequence of all the other numeral goal gene)

Clone's reverse primer (SEQ ID NO:10):

5 '-GCAGGTCGACGGATCCLLLNNNNNNNNNNNNNNNNNNNNN-3 ' (last codon that wherein LLL is goal gene, wherein N represents the front and continued codon sequence of goal gene)

C. homologous recombination

Utilize restriction enzyme EcoRI and BamHI to carry out after double digestion processing carrier pPIDA1 and pPIDK1, enzyme is cut to product and with AxyPrep PCR cleaning agents box, carry out purifying, and then obtain linearized vector, utilize In-Fusion HD Cloning Kit at 50 ℃, to react after 15 minutes with linearized vector respectively goal gene again, transform in bacillus coli DH 5 alpha competence 37 ℃ of incubated overnight on the LB solid medium that contains corresponding microbiotic (ammonia benzyl sistomycocin or kantlex).Finally obtain the X-pPIDA1 that contains target protein matter X and the Y-pPIDK1 that contains target protein matter Y.

D. carrier extracting and check

Picking transforms the mono-clonal bacterium colony of the recombinant vectors obtaining in the LB liquid nutrient medium that contains corresponding microbiotic (penbritin or kantlex), and 37 ℃, 250rpm jolting incubated overnight.

Next day, take out incubated overnight bacterium liquid and extract recombinant vectors with SanPrep pillar plasmid DNA a small amount of extraction agent box.The carrier extracting can be checked its exactness by order-checking.

(4) cotransformation and expression

A. cotransformation

The X-pPIDA1 that restructuring is obtained and Y-pPIDK1 carrier cotransformation in e. coli jm109 competence, 30 ℃ of incubated overnight on the LB solid medium that contains penbritin and kantlex.The mono-clonal bacterium colony that picking incubated overnight obtains in the M9 histidine defect substratum that contains penbritin and kantlex, 37 ℃, 250rpm jolting incubated overnight.

B. express

The bacterium liquid of getting above incubated overnight is inoculated in the new M9 histidine defect substratum that contains penbritin and Ka Na mycin, and after OD600 value is adjusted to 0.03～0.04, adding final concentration is the isopropylthiogalactoside (IPTG) of 10 μ M, then in 37 ℃, 250rpm jolting is cultivated after 8h, measures and record OD600.

(5) protein dimerization footprinting detects (PDf)

A. chromatin is crosslinked separated with bacterium

Get the e. coli jm109 bacterium liquid 1ml of above 8h abduction delivering in 15ml centrifuge tube, add 37% formaldehyde solution of 27 μ l, and in 25 ℃, 300rpm jolting reaction 8 minutes, then adding 10X glycine solution to final concentration is 1X, and in 25 ℃, 300rpm jolting reaction 5 minutes.Reaction solution is transferred in 1.5ml centrifuge tube, 4 ℃, after the centrifugal 4min of 12000rpm, abandon supernatant, and with 4 ℃ of 1ml1X PBS solution, the centrifugal 2min of 12000rpm cleans bacterial precipitation twice, then with the resuspended bacterial precipitation of 1ml1X PBS solution that has added 10 μ l proteolytic enzyme and inhibitors of phosphatases mixed solution, and in 4 ℃, after the centrifugal 4min of 12000rpm, abandon supernatant, the bacterial precipitation obtaining can be used for follow-up test or in-20 ℃ of preservations.

B. sample dissociation and MNase enzymic digestion

With the resuspended bacterial sediment of 200 μ l Lysis Buffer I, vibration mixed after 15 seconds, and be placed in and react 10 minutes on ice, more centrifugal 3 minutes of 9000rpm remove supernatant.Then, with 200 μ l MNase enzymes, cut the resuspended above precipitation of buffering working fluid, and get 100 μ l for subsequent detection.

In every 18 μ l MNase enzyme cutting buffering liquids, add 2 μ l MNase and mix, getting 4 μ l and add in the resuspended liquid of above 100 μ l, in 37 ℃ of reactions 15 minutes, wherein the vibration in 5 minutes of every mistake mixed once.Then, to adding 20 μ lMnase reaction kind of stop buffers in above reaction solution, and be placed in and place on ice after 5 minutes, centrifugal 5 minutes of 9000rpm also moves clean supernatant.

C. the extraction of Protein-DNA complex and DNase I enzymic digestion

By the precipitation obtaining in the resuspended previous step of 50 μ l core Extraction buffer, and be placed in and react 15 minutes on ice, the vibration in 5 minutes of every mistake mixes once.Then 9000rpm is centrifugal 5 minutes, and retains supernatant, transfers them in 1.5ml centrifuge tube, then adds wherein 2 μ l DNase I digested overnight (at least 12 hours).

D. remove purifying crosslinked and DNA fragmentation

Reaction overnight liquid is placed on to cooled on ice in 10 minutes in 75 ℃ of reactions, and adds wherein 10 μ l remove crosslinked mixed solution and mix, then in 65 ℃ of reactions 1.5 hours.Above reaction solution is carried out to purifying with UNIQ-10 pillar oligonucleotide purification kit, and then obtain the DNA fragmentation solution after purifying.

(6) quantitative PCR detection of target DNA fragment

Get the above DNA fragmentation soln using of 1 μ l SYBR Premix EX Tag II test kit target DNA fragment is wherein carried out to detection by quantitative.Reaction conditions is 95 ℃, reaction 30s, then 95 ℃, 5s; 67.5 ℃, 30s, reacts 30 circulations, and the detection primer of CI (N) specific binding sequence B R is:

Forward primer (SEQ ID NO:11):

5’-AGCAAAATCAGGGTGTTATCTACCTCTGGCGGTGATAACTTC-3’

Reverse primer (SEQ ID NO:12):

5’-CCGCTGCTAGCACCACAGGGCAGAG-3’

In addition the PDf signal value that, quantitative result is all measured in CI (C)-pPIDA1+CI (C)-pPIDK1 system with CI protein dimerization domain C I (C) for benchmark, and revise and obtain by the OD600 value of bacterial growth after 8 hours abduction deliverings.

CI protein dimerization domain C I (C) sequence (SEQ ID NO:13):

5’-GCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAACCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTACAACCACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTTGTTCCGTTGTGGGGAAAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGA-3’

(7) structure of DNA binding domains CI (N) mutant and the transformation of corresponding specific DNA sequences

(i) structure of DNA binding domains CI (N) mutant

With mutant CI (N) ^mut1for example, utilize following primer:

Forward primer (SEQ ID NO:14):

5’-GCAGACAAGATGGGGATGGGGCAGTCAGCGATTAATAAGGCATTTAATGGCATCAATGC-3’

Reverse primer (SEQ ID NO:15):

5’-GCATTGATGCCATTAAATGCCTTATTAATCGCTGACTGCCCCATCCCCATCTTGTCTGC-3’

To comprise wild-type DNA binding domains CI (N) ^wtcI (the C)-pPIDA1 of (SEQ ID NO:5) is that masterplate carries out PCR, and obtaining PCR product is linearized vector.With restriction enzyme DpnI, this PCR product is fully digested, via conversion and carrier, extracting, obtaining DNA binding domains is mutant CI (N) ^mut1carrier.

(ii) transformation of corresponding specific DNA sequences

With preparation DNA binding domains CI (N) ^wtand CI (N) ^mut1non-cross specific DNA sequences is example.In order to design, the specific DNA sequences of cross reaction can not occur from different DNA binding domains specific bindings, we utilize and from PDB database, download the CI (N) obtaining ^wtthe structural information of the X-ray diffraction structure 1LMB of-DNA complex, by the interaction energy of FoldX computed in software DNA binding domains and DNA sequence dna, and travel through all array configurations of DNA sequence dna and calculate and assess its variation of interaction energy with respect to wild-type specific DNA sequences.Take this calculation result as basis, and we design corresponding DNA sequence dna, utilize above rite-directed mutagenesis method to transform CI (C)-pPIDA1, and utilize PDf method to detect the specific binding capacity of different CI (N) mutant and different DNA sequence dnas.

For CI (N) ^wtand CI (N) ^mut1to obtain exactly three kinds of DNA sequence dnas: specifically with CI (N) ^wt-CI (N) ^wtthe DNA sequence dna of homodimer combination, specifically with CI (N) ^mut1-CI (N) ^mutthe DNA sequence dna of 1 homodimer combination, and specifically with CI (N) ^wt-CI (N) ^mut1the DNA sequence dna of heterodimer combination.In addition, as hereinbefore, in PDf detection method herein, all utilize the PDf detection signal of CI protein dimerization domain C I (C) in the two carrier systems of CI (C)-pPIDA1+CI (C)-pPIDK1 for benchmark value compares.DNA binding domains in this system on each carrier is wild-type CI (N) ^wt, BR sequence is wild-type specific DNA sequences.

Embodiment 1 protein dimerization footprinting detects (PDf) principle of work

In the present invention, protein dimerization footprinting detects (PDf) principle of work as shown in Figure 2.Target protein, after expression in escherichia coli, can interact by the DNA binding domains of its fusion and the specific DNA sequences on carrier.If two proteins interacts, its dimer can be combined with very high avidity with DNA, on the contrary can not in conjunction with or with very low avidity combination.Then, through formaldehyde treated, DNA and be cross-linked to form mutually complex body with the protein dimer of its combination.Under the effect of MNase enzyme, carrier is broken into small segment, by after these small segment separation and Extraction, with DNase I, it is fully digested, thereby will not remove with the DNA fragmentation of protein bound.With Proteinase K, postdigestive sample is gone to be cross-linked, and carry out purifying and obtain corresponding target DNA fragment.These DNA fragmentations are carried out to detection by quantitative or the qualitative detection based on nucleotide sequence such as PCR and agarose gel electrophoresis based on nucleotide sequence such as quantitative PCR, high-flux sequence and DNA microarray, can obtain the interactive network information based on target protein matter.

Embodiment 2 be take the dimerization domain C I (C) of protein C I and is that target protein matter checking protein dimerization footprinting detects (PDf) method

In order to verify that PDf detected result whether can the interactional varying strength of reactive protein; by BR-pSP73 (blank); (Fig. 3 a) for pPIDA1 (negative control) and three groups of control experiments of CI (C)-pPIDA1 (positive control); provable via the digestion in 12 hours of DNase I enzyme; can be by the DNA fragmentation Ex-all of not protected by protein bound, thus make PDf detected result can react different proteins interaction strength (result is as shown in Figure 3 b).

The foundation of the reaction Kinetics Model that embodiment 3 PDf detect

The impact combination of the detection by quantitative ability of protein interaction intensity and DNA binding domains monomer and specific DNA sequences being detected protein-protein interaction for PDf is discussed, the dynamic process that we are combined with specific DNA sequences from protein monomers, the impact of the correlation parameter of protein dimerization has been discussed is protein interaction process on DNA binding kinetics.

1. protein monomers DNA binding kinetics model

If θ _bfor combining the ratio of the DNA fragment specific of protein monomers, θ _rfor the ratio of the DNA fragment specific of unbinding protein monomer, C _sfor the concentration of protein monomers, k _onfor the rate constant of protein monomers and specific DNA sequences association reaction, k _offthe rate constant of reacting with specific DNA sequences complex dissociation for protein monomers.

According to above definition, have:

θ _b+θ _r＝1 (1)

And according to experimental principle, θ _bvelocity of variation be:

$\frac{{\mathrm{d\θ}}_b}{\mathrm{dt}}=k_{\mathrm{on}}{C}_s{\mathrm{\θ}}_r-k_{\mathrm{off}}{\mathrm{\θ}}_b---\left(2\right)$

In conjunction with equation (1) and equation (2), can obtain the final condition of model:

When t=0, while not occurring to be cross-linked, system beinthebalancestate, can obtain if θ now _bvalue is can obtain:

${\mathrm{\θ}}_b^0=\frac{k_{\mathrm{on}}{C}_s}{k_{\mathrm{on}}{C}_s+k_{\mathrm{off}}}---\left(3\right)$

And after crosslinked beginning, above equilibrium state is destroyed, θ _bvalue with crosslinked, carry out and constantly increase, when t=∞, it reaches maximum:

${\mathrm{\θ}}_b^{\∞}=1---\left(4\right)$

Equation (2) is carried out to differential to the time, and can obtain in conjunction with equation (1):

$\frac{d^2{\mathrm{\θ}}_b}{{\mathrm{dt}}^2}+(k_{\mathrm{on}}{C}_s+k_{\mathrm{off}})\frac{{\mathrm{d\θ}}_b}{\mathrm{dt}}=0---\left(5\right)$

The above differential equation has following general solution:

${\mathrm{\θ}}_b=\mathrm{\α}{e}^{{\mathrm{tr}}_1}+\mathrm{\β}{e}^{{\mathrm{tr}}_2}---\left(6\right)$

R wherein ₁=0, r ₂=-(k _onc _s+ k _off), then according to the final condition formula (3) of model and formula (4), obtain:

${\mathrm{\θ}}_b=1-\frac{k_{\mathrm{off}}}{k_{\mathrm{on}}{C}_s+k_{\mathrm{off}}}{e}^{-t(k_{\mathrm{on}}{C}_s+k_{\mathrm{off}})}---\left(7\right)$

Equation (7) has been described the process that protein monomers is combined with specific DNA in the cross-linking process of PDf method.Nonsaturation and the specific DNA sequences overall number of considering specific DNA sequences in experimentation are steady state value (seeing Fig. 3 c), and the PDf signal that can obtain protein monomers binding specificity DNA sequence dna is:

I _s＝εKθ _b (8)

The maximum combined number that wherein ε K is specific DNA sequences, ε is constant, K=k _on/ k _off, (7) are brought into (8) and can obtain I _sthe complete form of signal:

$I_s=\mathrm{\ϵK}(1-\frac{k_{\mathrm{off}}}{k_{\mathrm{on}}{C}_s+k_{\mathrm{off}}}{e}^{-t(k_{\mathrm{on}}{C}_s+k_{\mathrm{off}})})---\left(9\right)$

2. the DNA binding kinetics model of protein dimerization process

The PDf signal of protein dimerization process comprises the contribution of two parts, and one is the combination of protein monomers and specific DNA sequences, and another is the combination of protein dimer and specific DNA sequences.The PDf signal that therefore, can obtain protein dimerization or protein interaction is:

I _sd＝I _s+I _d (10)

Wherein, I _sfor the contribution that protein monomers is combined with specific DNA sequences, its form as shown in (9), I _dthe contribution of being combined with specific DNA sequences for protein dimer.

On the DNA of protein monomers combination model basis, can expand the DNA binding kinetics model that obtains protein dimer.Definition C _dfor the concentration of protein dimer, k _ondfor the rate constant of protein dimer and specific DNA sequences association reaction, k _offdthe rate constant of reacting with specific DNA sequences complex dissociation for protein dimer.According to above definition, the intensity of protein dimerization or protein interaction can be expressed as:

K _dimer＝C _d/C _s ² (11)

Consider the nonsaturation of specific DNA sequences, can obtain protein dimer and be combined contributed PDf signal with specific DNA sequences and be:

Wherein ε ' is constant.

Therefore, the PDf signal of protein dimerization or protein interaction process is:

In conjunction with equation (11), can further obtain equation (14):

This is the PDf signal of protein dimerization or interaction process.

Experimental verification and the analysis of the reaction Kinetics Model that embodiment 4 PDf detect

On the basis of above-mentioned model, utilize two vector expression system X-pPIDA1+GFP-pPIDK1, the reaction Kinetics Model of PDf is carried out to experimental verification and analysis.As shown in Fig. 4 (a), pPIDA1 and pPIDK1 have identical protein monomers and detect performance and identical protein expression ability, so protein X and GFP have approximate expression amount.Because GFP almost exists with monomeric form in cell, so, the PDf signal I of the system of only expressing GFP can be utilized _sdbe similar to the PDf signal I of target protein X _sthereby, can utilize the reporter gene character of GFP to detect protein monomers in conjunction with the impact on albumin X dimerization interaction PDf detected result.

In order to further illustrate and verify above principle:

First, by relatively PDf measured value of experiment and the calculated value based on above kinetic model (are shown in Fig. 4 a), illustrate that this kinetic model can match with experimental result, has confirmed the reliability of this model.

Then, continue to investigate the impact of protein monomers fluctuation of concentration on PDf signal.According to kinetic model, establishing protein monomers change in concentration multiple is Δ, when protein concn becomes Δ C from Cs _stime, PDf detection signal I _s' be:

${I_s}^{\′}=\mathrm{\ϵK}-\frac{k_{\mathrm{off}}}{k_{\mathrm{on}}\·\mathrm{\Δ}\·C_s+k_{\mathrm{off}}}{e}^{-t(k_{\mathrm{on}}\·\mathrm{\Δ}\·C_s)+k_{\mathrm{off}})}---\left(15\right)$

So PDf detection signal I _svariation multiple be

${\mathrm{\ΔI}}_s=\frac{{I_s}^{\′}}{I_s}---\left(16\right)$

When protein concn Cs changes between 0.01-100 times, result shows that the variation multiple upper limit of PDf signal is about 10 (seeing Fig. 4 b).So, when time, can think I _sto I _sdimpact can ignore, i.e. I _s≈ 0.

Now can obtain equation (17):

Based on this equation, can obtain for two testing protein A and B, its PDf detection signal has following relation:

It is the ratio that two proteins dimerization intensity ratio separately can approximate its PDf detection signal.In other words, be exactly that protein interaction intensity can represent with corresponding specific DNA sequences copy number.And the PDf signal of positive by contrast in negative experimental group, while finding that the abduction delivering time is 8 hours, the numerical value (I of positive group _sd) to significantly be greater than 10 times of negative numerical value (I that organize _s) (seeing Fig. 4 c), meet with co-relation the experiment condition that therefore selected this abduction delivering time is PDf.Meanwhile, with the PDf detection signal of CI protein dimerization domain C I (C) for benchmark, definition is as the PDf signal I of certain target protein X _sd(X) < 0.1I _sd ^reftime, can think I _sd(X)=0, usings this as judging whether interactional standard occurs between protein.

The Static and dynamic protein interaction of embodiment 5 based on PDf method detects the comparison with existing protein interaction detection technique

In order to verify that PDf method quantitative and qualitative analysis detects the performance of protein interaction, we have selected 4 protein cheA, cheB, cheZ and cheY in intestinal bacteria chemotactic system to carry out PDf detection to it, and result as shown in Figure 5 a.By comparing with yeast two-hybrid (Y2H) and FRET (fluorescence resonance energy transfer) (FRET) experimental result, PDf method can realize well the quantitative and qualitative analysis of protein interaction is detected.

CheA sequence (SEQ ID NO:16):

＞gi|49175990：c1973348-1971384Escherichia coli str.K-12substr.MG1655chromosome，complete genome

GTGAGCATGGATATAAGCGATTTTTATCAGACATTTTTTGATGAAGCGGACGAACTGTTGGCTGACATGGAGCAGCATTTGCTGGTTTTGCAGCCGGAAGCGCCAGATGCCGAACAATTGAATGCCATCTTTCGGGCTGCCCACTCGATCAAAGGAGGGGCAGGAACTTTTGGCTTCAGCGTTTTGCAGGAAACCACGCATCTGATGGAAAACCTGCTCGATGAAGCCAGACGAGGTGAGATGCAACTCAACACCGACATTATCAATCTGTTTTTGGAAACGAAGGACATCATGCAAGAACAGCTCGACGCTTATAAACAGTCGCAAGAGCCGGATGCCGCCAGCTTCGATTATATCTGCCAGGCCTTGCGTCAACTGGCATTAGAAGCGAAAGGCGAAACGCCATCCGCAGTGACCCGATTAAGTGTGGTTGCCAAAAGTGAACCGCAAGATGAGCAGAGTCGCAGTCAGTCGCCGCGACGAATTATCCTTTCGCGCCTGAAGGCCGGGGAAGTCGACCTGCTGGAAGAAGAACTGGGACATCTGACAACGTTAACTGACGTGGTGAAAGGGGCGGATTCGCTCTCGGCAATATTACCGGGCGACATCGCCGAAGATGACATCACAGCGGTACTCTGTTTTGTGATTGAAGCCGATCAGATTACCTTTGAAACAGTAGAAGTCTCGCCAAAAATATCCACCCCACCAGTGCTTAAACTGGCAGCCGAACAAGCGCCAACCGGCCGCGTGGAGCGGGAAAAAACGACGCGCAGCAATGAATCCACCAGCATCCGTGTAGCGGTAGAAAAGGTTGATCAATTAATTAACCTCGTCGGCGAGCTGGTTATCACCCAGTCCATGCTTGCCCAGCGTTCCAGCGAACTGGACCCGGTTAATCATGGTGATTTGATAACCAGCATGGGGCAGTTACAACGTAACGCCCGTGATTTGCAGGAATCAGTGATGTCGATTCGCATGATGCCGATGGAATATGTTTTTAGTCGCTATCCCCGGCTGGTGCGTGATCTGGCGGGAAAACTCGGCAAGCAGGTAGAACTGACGCTGGTGGGCAGTTCTACTGAACTCGACAAAAGCCTGATAGAACGCATTATCGACCCGCTGACCCACCTGGTACGCAATAGCCTCGATCACGGTATTGAACTGCCAGAAAAACGGCTCGCCGCAGGTAAAAACAGCGTCGGAAATTTAATTCTGTCTGCCGAACATCAGGGCGGCAACATTTGCATTGAAGTGACCGACGATGGGGCGGGGCTAAACCGTGAGCGAATTCTGGCAAAAGCGGCCTCGCAAGGTTTGACTGTCAGCGAAAACATGAGCGACGACGAAGTCGCGATGCTGATATTTGCACCTGGCTTCTCCACGGCAGAGCAGGTCACCGACGTCTCCGGGCGCGGCGTCGGCATGGACGTCGTTAAACGTAATATCCAGAAGATGGGCGGTCATGTCGAAATCCAGTCGAAGCAGGGTACTGGCACTACGATCCGCATTTTACTGCCGCTGACGCTGGCCATCCTCGACGGCATGTCCGTACGCGTTGCGGATGAAGTTTTCATTCTGCCGCTGAATGCTGTTATGGAATCACTGCAACCCCGTGAAGCCGATCTCCATCCACTGGCCGGCGGCGAGCGGGTGCTGGAAGTGCGGGGTGAATATCTGCCCATCGTCGAACTGTGGAAAGTGTTCAACGTCGCGGGCGCGAAAACCGAAGCCACCCAGGGAATTGTGGTGATCTTACAAAGTGGCGGTCGCCGCTACGCCTTGCTGGTGGATCAATTAATTGGTCAACACCAGGTTGTGGTTAAAAACCTTGAAAGTAACTATCGCAAAGTCCCCGGCATTTCTGCTGCGACCATTCTTGGCGACGGCAGCGTGGCACTGATTGTTGATGTCTCCGCCTTGCAGGCGATAAACCGCGAACAACGTATGGCGAACACCGCCGCCTGA

CheB sequence (SEQ ID NO:17):

＞gi|49175990：c1966525-1965476Escherichia coli str.K-12substr.MG1655chromosome，complete genome

ATGAGCAAAATCAGGGTGTTATCTGTCGATGATTCGGCACTGATGCGCCAGATCATGACAGAAATCATCAACAGCCATAGCGACATGGAAATGGTGGCGACCGCGCCTGATCCGCTGGTCGCGCGTGACTTGATTAAGAAATTCAATCCCGATGTGCTGACGCTGGATGTTGAAATGCCGCGGATGGACGGACTGGATTTCCTCGAAAAATTAATGCGTTTGCGTCCAATGCCCGTTGTGATGGTTTCTTCCCTGACCGGCAAAGGGTCAGAAGTCACGCTGCGCGCGCTGGAGCTGGGGGCGATAGATTTTGTCACCAAACCGCAACTGGGTATTCGCGAAGGTATGCTGGCGTATAACGAAATGATTGCTGAAAAGGTGCGTACGGCAGCAAAGGCGAGCCTTGCAGCACATAAGCCATTGTCGGCACCGACAACGCTGAAGGCGGGGCCGTTGTTGAGTTCTGAAAAACTGATTGCGATTGGTGCTTCAACGGGTGGAACTGAGGCAATTCGTCACGTACTGCAACCGTTGCCGCTTTCCAGCCCGGCACTGTTAATTACCCAGCATATGCCGCCCGGTTTCACCCGCTCTTTTGCCGACAGACTTAATAAGCTTTGCCAGATCGGGG TTAAAGAAGCCGAAGACGGAGAACGTGTCTTGCCGGGGCATGCCTATATTGCGCCGGGCGATCGGCATATGGAGCTGTCGCGTAGTGGCGCAAATTACCAAATCAAAATTCACGATGGCCCGGCGGTTAACCGTCATCGGCCTTCGGTAGATGTGTTGTTCCATTCTGTCGCCAAACAGGCGGGGCGTAATGCGGTTGGGGTGATCCTGACCGGTATGGGCAACGACGGCGCGGCGGGAATGTTGGCGATGCGTCAGGCGGGGGCATGGACCCTTGCGCAAAACGAAGCAAGTTGCGTGGTGTTCGGCATGCCGCGCGAGGCCATCAATATGGGTGGTGTCTGCGAAGTGGTCGATCTTAGCCAGGTAAGCCAGCAAATGTTGGCAAAAATTAGTGCCGGACAGGCGATACGTATTTAA

CheY sequence (SEQ ID NO:18):

＞gi|49175990：c1965072-1965461Escherichia coli str.K-12substr.MG1655chromosome，complete genome

ATGGCGGATAAAGAACTTAAATTTTTGGTTGTGGATGACTTTTCCACCATGCGACGCATAGTGCGTAACCTGCTGAAAGAGCTGGGATTCAATAATGTTGAGGAAGCGGAAGATGGCGTCGACGCTCTCAATAAGTTGCAGGCAGGCGGTTATGGATTTGTTATCTCCGACTGGAACATGCCCAATATGGATGGCCTGGAATTGCTGAAAACAATTCGTGCGGATGGCGCGATGTCGGCATTGCCAGTGTTAATGGTGACTGCAGAAGCGAAGAAAGAGAACATCATTGCTGCGGCGCAAGCGGGGGCCAGTGGCTATGTGGTGAAGCCATTTACCGCCGCGACGCTGGAGGAAAAACTCAACAAAATCTTTGAGAAACTGGGCATGTGA

CheZ sequence (SEQ ID NO:19):

＞gi|49175990：c1965061-1964417Escherichia coli str.K-12substr.MG1655chromosome，complete genome

ATGATGCAACCATCAATCAAACCTGCTGACGAGCATTCAGCTGGCGATATCATTGCGCGCATCGGCAGCCTGACGCGTATGCTGCGCGACAGTTTGCGGGAACTGGGGCTGGATCAGGCCATTGCCGAAGCGGCGGAAGCCATCCCCGATGCGCGCGATCGTTTGTACTATGTTGTGCAGATGACCGCCCAGGCTGCGGAGCGGGCGCTGAACAGTGTTGAGGCGTCACAACCGCATCAGGATCAAATGGAGAAATCAGCAAAAGCGTTAACCCAACGTTGGGATGACTGGTTTGCCGATCCGATTGACCTTGCCGACGCCCGTGAACTGGTAACAGATACACGACAATTTCTGGCAGATGTACCCGCGCATACCAGCTTTACTAACGCGCAACTGCTGGAAATCATGATGGCGCAGGATTTTCAGGATCTCACCGGGCAGGTCATTAAGCGGATGATGGATGTCATTCAGGAGATCGAACGCCAGTTGCTGATGGTGCTGTTGGAAAACATCCCGGAACAGGAGTCGCGTCCAAAACGTGAAAACCAGAGTTTGCTTAATGGACCTCAGGTCGATACCAGCAAAGCCGGTGTGGTAGCCAGTCAGGATCAGGTGGACGATTTGTTGGATAGTCTTGGATTTTGA

For the performance of checking PDf method to detect dynamic protein-interacting, it is its temporal resolution, we have chosen the PhoB protein in intestinal bacteria PhoR/PhoB phosphoric acid signal transducting system, detection is under the growing environment of different phosphate acid concentration, the changing conditions in its dimerization intensity reaction times, result is as shown in Fig. 5 b and Fig. 5 c.By comparing with FRET result, PDf can detect the intensity of PhoB dimerization under different phosphate acid concentration and evolution in time thereof, embodies PDf method and have good temporal resolution in detecting dynamic protein interaction.

PhoB sequence (SEQ ID NO:20):

＞gi|388476123：416366-417055Escherichia coli str.K-12substr.W3110，complete genome

ATGGCGAGACGTATTCTGGTCGTAGAAGATGAAGCTCCAATTCGCGAAATGGTCTGCTTCGTGCTCGAACAAAATGGCTTTCAGCCGGTCGAAGCGGAAGATTATGACAGTGCTGTGAATCAACTGAATGAACCCTGGCCGGATTTAATTCTCCTCGACTGGATGTTACCTGGCGGCTCCGGTATCCAGTTCATCAAACACCTCAAGCGCGAGTCGATGACCCGGGATATTCCAGTGGTGATGTTGACCGCCAGAGGGGAAGAAGAAGATCGCGTGCGCGGCCTTGAAACCGGCGCGGATGACTATATCACCAAGCCGTTTTCGCCGAAGGAGCTGGTGGCGCGAATCAAAGCGGTAATGCGCCGTATTTCGCCAATGGCGGTGGAAGAGGTGATTGAGATGCAGGGATTAAGTCTCGACCCGACATCTCACCGAGTGATGGCGGGCGAAGAGCCGCTGGAGATGGGGCCGACAGAATTTAAACTGCTGCACTTTTTTATGACGCATCCTGAGCGCGTGTACAGCCGCGAGCAGCTGTTAAACCACGTCTGGGGAACTAACGTGTATGTGGAAGACCGCACGGTCGATGTCCACATTCGTCGCCTGCGTAAAGCACTGGAGCCCGGCGGGCATGACCGCATGGTGCAGACCGTGCGCGGTACAGGATATCGTTTTTCAACCCGCTTTTAA

The direct detection of dynamic of embodiment 6 protein interaction networks

On the basis of experiment before, consider DNA sequence dna except realizing efficient detection, also there is programmable characteristic, by changing the base of specific DNA sequences in sequence, arrange, change the recognition capability of DNA binding domains to specific DNA sequences, and then it is right to interact by design non-cross DNA binding domains-specific DNA sequences, realize PDf method to detecting when multipair protein interaction is in same system, making for the first time becomes possibility to the direct-detection of protein interaction network.

In order to verify the feasibility of above conception, to wild-type CI protein DNA binding domains CI (N) ^wtin the amino acid of DNA recognition helix do following rite-directed mutagenesis: by QSGVGAL rite-directed mutagenesis, be QSAINKA, thereby obtain mutant CI (N) ^mut1.Then, the CI going out based on FoldX computed in software (N) ^wtand CI (N) ^mut1with the information of DNA interaction energy (see Fig. 6 a), designed following DNA sequence dna:

BR1 (is CI (N) ^wtcorresponding specific DNA sequences) (SEQ ID NO:21):

AGCAAAATCAGGGTGTTATCTACCTCTGGCGGTGATAACTTCATCTCTGCCCTGTGG

BR4(SEQ ID NO：22)：

AGCAAAATCAGGGTGTTATCTACCTCTGGCCGTGATAACTTCATCTCTGCCCTGTGG

BR5(SEQ ID NO：23)：

AGCAAAATCAGGGTGTTATCTACCTCTGGCGGTGCTAACTTCATCTCTGCCCTGTGG

BR6(SEQ ID NO：24)：

AGCAAAATCAGGGTGTTATCTACCCCTGGCGGTGATAACTTCATCTCTGCCCTGTGG

BR7(SEQ ID NO：25)：

AGCAAAATCAGGGTGTTATCTACCCCTGGCCGTGATAACTTCATCTCTGCCCTGTGG

BR8(SEQ ID NO：26)：

AGCAAAATCAGGGTGTTATCTACCCCTGGCTGTGATAACTTCATCTCTGCCCTGTGG

BR9(SEQ ID NO：27)：

AGCAAAATCAGGGTGTTATCTACCCCAGGCCGTGAIAACTTCATCTCTGCCCTGTGG

BR10(SEQ ID NO：28)：

AGCAAAATCAGGGTGTTATCTACCCCAGTCCGTGATAACTTCATCTCTGCCCTGTGG

Wherein BR1,4,5,6,8 is for respectively for CI (N) ^wt-CI (N) ^wtand CI (N) ^mut1-CI (N) ^mut1the sequence of homodimer design, BR7,9,10 is for CI (N) ^wt-CI (N) ^mut1the sequence of heterodimer design.Utilize aforementioned PDf method to detect, as shown in Figure 6 b, sequence B R4 can specific recognition CI (N) ^wt-CI (N) ^wthomodimer, sequence B R6 can specific recognition CI (N) ^mut1-CI (N) ^mut1homodimer, and sequence B R10 is more prone to and CI (N) ^wt-CI (N) ^mut1heterodimer combination, and non-cross between this three.

Based on above result, if detect three couple that may exist between a-protein and PROTEIN B, interact (being that the dimerization of A-A is, the dimerization of the dimerization of B-B and A-B), just can include CI (N) at one ^wt-A and CI (N) ^mut1in the detection system of-B fusion rotein, utilize tri-different specific DNA sequences of BR4, BR6 and BR10 to realize above three pairs of interactions are carried out to PDf detection by quantitative simultaneously.And on the basis of above-mentioned sequences Design and detection method, be optimized (binding ability and the protein expression amount that comprise DNA binding domains and corresponding specific DNA sequences) and expansion (non-cross DNA binding domains-specific DNA sequences effect to), just the Capacity extension of direct-detection protein interaction network can be arrived to larger scale (schematic diagram is as shown in Fig. 6 c).

Claims (10)

1. the method for obtaining protein-protein interaction information, it comprises the steps:

(1) in host cell, express and merge the target protein matter that has DNA binding domains, while the avidity of corresponding specific DNA sequences being significantly higher than to monomer during described DNA binding domains dimerization;

(2) under physiological status, with linking agent, process, target protein matter dimer and DNA in host cell are cross-linked to form to complex body;

(3) DNA is broken into small segment;

(4) small segment described in separation and Extraction, and digest with DNase I;

(5) make to spend linking agent and process, the product of step (4) is gone to be cross-linked, and purifying obtains DNA fragmentation;

(6) DNA fragmentation that detecting step (5) obtains.

2. method according to claim 1, described host cell comprises intestinal bacteria, yeast, mammalian cell.

3. method according to claim 1, described DNA binding domains comprises the DNA binding domains of lambda particles phage protein C I and meets the mutant of DNA binding domains character described in claim 1 step (1), the DNA binding domains of lambda particles phage protein C RO and meet the mutant of DNA binding domains character described in claim 1 step (1); Described corresponding specific DNA sequences comprises CI binding sequence and their mutant nucleotide sequence, CRO binding sequence and their mutant nucleotide sequence.

4. method according to claim 1, the linking agent using in described step (2) is formaldehyde.

5. method according to claim 1, is used MNase or supersound process to smash DNA for small segment in described step (3).

6. method according to claim 1, that in described step (5), uses goes linking agent for Proteinase K.

7. method according to claim 1, detection in described step (6) comprises the qualitative and/or detection by quantitative based on nucleotide sequence, described detection by quantitative comprises quantitative PCR, high-flux sequence and/or DNA microarray, and described qualitative detection comprises PCR and/or agarose gel electrophoresis.

8. for obtaining a test kit for protein interaction information, comprising:

(1) with the expression vector of DNA binding domains and corresponding specific DNA sequences, while the avidity of corresponding specific DNA sequences being significantly higher than to monomer during described DNA binding domains dimerization;

(2) host cell;

(3) linking agent and reaction terminating liquid thereof;

(4) smash device or reagent and the reaction buffer thereof of DNA;

(5) DNase I and reaction buffer thereof;

(6) remove linking agent;

(7) DNA detection device.

9. test kit according to claim 8, described linking agent is formaldehyde, described crosslinking reaction stop buffer is glycine solution, described in to remove linking agent be Proteinase K, described in smash DNA reagent be MNase.

10. test kit according to claim 8, described DNA detection device comprises qualitative and/or quantitative testing device, described quantitative testing device comprises quantitative PCR device, high-flux sequence device or DNA microarray proofing unit, and described qualitative detection device comprises PCR device or agarose gel electrophoresis device.