CN104099418A - Protein interaction detection method based on nucleotide sequence - Google Patents

Abstract

The present invention relates to a method for detecting the interaction between proteins based on DNA sequence (called protein dimerization footprint method, Protein Dimerization footprinting, referred to as PDf), a kit and its application. The basic principle is based on the influence of the interaction strength between the target proteins on the binding kinetics between the fused DNA binding domain and the corresponding specific DNA sequence, so that the interaction between the target proteins is represented by the corresponding specific DNA sequence, while the interaction between the target proteins The strength of the interaction is then given by the copy number of the specific DNA sequence.

Description

Nucleic acid sequence-based protein interaction detection method

technical field

The invention belongs to the technical field of protein research, and specifically relates to the detection of protein interaction, in particular to an in vivo detection method for protein interaction using DNA-encoded protein interaction information, a kit and application thereof.

Background technique

Although traditional in vivo protein-protein interaction detection techniques have been widely used in biological research, there are many shortcomings. For example, although the yeast two-hybrid technology (Y2H) is simple to implement, its dynamic detection and quantitative detection capabilities are obviously insufficient. Although the fluorescence resonance energy transfer technology (FRET) has good spatiotemporal resolution and quantitative capabilities, it is limited. Fluorescence intensity of fluorescent protein and properties such as protein spatial structure. Moreover, these traditional detection techniques can only detect a single protein interaction pair, and cannot simultaneously detect a protein interaction network containing multiple pairs of interactions in the same cell.

To this end, by inventing protein dimerization footprinting (Protein Dimerization footprinting, referred to as PDf) detection technology, we combine nucleic acid sequence-based detection technology with protein-protein interaction detection, so as to achieve in vivo, qualitative and/or quantitative detection. , dynamically detect protein interactions, and make it possible to directly detect protein interaction networks.

Contents of the invention

This method uses the change of the interaction strength between the target proteins on the binding kinetics between the fused DNA binding domain and the corresponding specific DNA binding site to realize the interaction between the target proteins expressed by the corresponding specific DNA sequence, while the target The protein-protein interaction strength is then given by the copy number of the sequence.

Specifically, the present invention relates to the following items:

1. A method for obtaining information on interactions between proteins, comprising the steps of:

(1) expressing a target protein fused with a DNA-binding domain in a host cell, the affinity of the DNA-binding domain to the corresponding specific DNA sequence is significantly higher than that of a monomer when dimerized;

(2) Treating with a cross-linking agent under physiological conditions to cross-link the target protein dimer and DNA in the host cell to form a complex;

(3) breaking the DNA into small fragments;

(4) separate and extract described small fragment, and digest with DNase I;

(5) using a decrosslinking agent to decrosslink the product of step (4), and purify to obtain a DNA fragment;

(6) Detecting the DNA fragments obtained in step (5).

2. according to the method described in 1, described host cell comprises escherichia coli, yeast, mammalian cell.

3. according to the described method of 1, described DNA binding domain comprises the DNA binding domain of lambda phage protein CI and the mutant that meets the DNA binding domain property described in claim 1 step (1), lambda phage protein The DNA binding domain of CRO and its mutants meeting the properties of the DNA binding domain described in claim 1 step (1); the corresponding specific DNA sequences include CI binding sequences and their mutant sequences, CRO binding sequences and their the mutant sequence.

4. according to the method described in 1, the linking agent used in the described step (2) is formaldehyde.

5. The method according to 1, in the step (3), use MNase or ultrasonic treatment to break up the DNA into small fragments.

6. The method according to 1, the decrosslinking agent used in the step (5) is proteinase K.

7. according to the method described in 1, the detection in the described step (6) comprises qualitative and/or quantitative detection based on nucleic acid sequence, and described quantitative detection comprises quantitative PCR, high-throughput sequencing and/or DNA microarray, so Such qualitative tests include PCR and/or agarose gel electrophoresis.

8. A kit for obtaining protein interaction information, comprising:

(1) an expression vector with a DNA binding domain and a corresponding specific DNA sequence, the DNA binding domain has a significantly higher affinity for the corresponding specific DNA sequence when dimerized than when it is monomeric;

(2) host cells;

(3) Cross-linking agent and its reaction termination solution;

(4) Devices or reagents for fragmenting DNA and their reaction buffers;

(5) DNase I and its reaction buffer;

(6) Removing cross-linking agent;

(7) DNA detection device.

9. The kit according to 8, wherein the cross-linking agent is formaldehyde, the cross-linking reaction termination solution is glycine solution, the de-cross-linking agent is proteinase K, and the reagent for breaking DNA is MNase.

10. The test kit according to 8, the DNA detection device comprises a qualitative and/or quantitative detection device, the quantitative detection device comprises a quantitative PCR device, a high-throughput sequencing device or a DNA microarray detection device, and the qualitative detection device Devices include PCR devices or agarose gel electrophoresis devices.

Comparing the method of the present invention with the results of fluorescence resonance energy transfer (FRET) technology and yeast two-hybrid (Y2H) technology, the method of the present invention can well perform in vivo and quantitative analysis of protein-protein interactions of different strengths. , Dynamic detection. Furthermore, this method combines nucleic acid sequence-based detection technology with protein interaction detection, which can greatly increase the throughput of detection, and by using different and non-intersecting DNA binding domain-specific DNA sequence pairs, the The method can directly, quantitatively and dynamically detect the protein interaction network composed of multiple protein interactions at the system level.

The method of the present invention can help biologists directly and quantitatively study the protein interaction group at the system level, instead of simply using single protein interaction data to analyze the protein interaction network by constructing a corresponding network model.

Detailed description of the invention

The technical solution of the present invention will be described in further detail below. It should be noted that the various embodiments of the present invention can be combined in any way as desired.

The first aspect of the present invention provides a protein dimerization footprint method (PDf) for obtaining information on protein-protein interactions. The influence of the binding kinetics between the sequences realizes that the interaction between the target proteins is expressed by the corresponding specific DNA sequence, and the interaction strength between the target proteins is given by the copy number of the specific DNA sequence.

In one embodiment, the method comprises the steps of:

(1) Expressing a target protein fused with a DNA-binding domain in a host cell, the affinity of the DNA-binding domain to the corresponding specific DNA is much higher than that of a monomer when dimerized;

(2) Treating with a cross-linking agent under physiological conditions to cross-link the target protein dimer and DNA in the host cell to form a complex;

(3) breaking the DNA into small fragments;

(4) separate and extract described small fragment, and digest with DNase I;

(5) using a decrosslinking agent to decrosslink the product of step (4), and purify to obtain a DNA fragment;

(6) Quantitative detection of the DNA fragments obtained in step (5).

In a preferred embodiment, as long as the affinity for the corresponding specific DNA during dimerization is much higher than that of the monomer, the DNA binding domain can be used in the present invention, such DNA binding domain and corresponding specific DNA sequence Including but not limited to the DNA binding domain and CI binding sequence of lambda phage protein CI, the DNA binding domain and CRO binding sequence of lambda phage protein CRO. In this case, when the interaction between the target proteins occurs, the DNA-binding domain forms a dimer, which binds to the corresponding specific DNA, thereby forming a DNA- Protein dimer complex; on the contrary, when there is no interaction between the target proteins, the DNA-binding domain exists in the form of a monomer, because the DNA-binding domain in the monomer form does not bind to specific DNA or binds very weakly, As a result, cross-linking is not effective and will be distinguished from dimers in the subsequent process.

In a preferred embodiment, cross-linking as described herein refers to immobilizing molecules that are close enough together for subsequent analysis. In a more preferred embodiment, the cross-linking agent includes but not limited to formaldehyde, glutaraldehyde and the like.

In a preferred embodiment, methods for fragmenting DNA into small fragments are known to those skilled in the art, including sonication and enzyme treatment, etc., preferably MNase treatment.

In a preferred embodiment, methods for detecting DNA fragments separated after decrosslinking include but are not limited to qualitative and \ or quantitative detection techniques.

A second aspect of the present invention provides a kit for obtaining protein interaction information, comprising:

(1) an expression vector with a DNA binding domain and a corresponding specific DNA sequence, the DNA binding domain has a much higher affinity for the corresponding specific DNA when dimerized than when it is monomeric;

(2) host cells;

(3) Cross-linking agent and its reaction termination solution;

(4) Devices and reagents for fragmenting DNA and their reaction buffers;

(5) DNase I and its reaction buffer;

(6) Removing cross-linking agent;

(7) DNA detection device.

In a preferred embodiment, the host cells include but are not limited to bacteria, yeast, mammalian cells, etc., and the cross-linking agent, de-cross-linking agent, DNA fragmentation device and reagent, quantitative detection device, etc. are all such as As mentioned earlier.

Description of drawings

Figure 1. Schematic diagram of the structure of vectors pPIDA1 and pPIDK1, wherein (A) is pPIDA1, (B) is pPIDK1, Plac is the promoter, CI(N) is the DNA binding domain of protein CI, MCS is the multiple cloning site, and Ter is Transcription termination sequence, BR is the specific DNA binding sequence, AmpR is the ampicillin resistance gene, KanR is the kanamycin resistance gene, Ori is the replication origin of the vector.

Figure 2. Schematic diagram of protein dimerization footprinting (PDf).

Figure 3. Validation of the PDf detection method for proteins targeting the dimerization domain CI(C) of protein CI. (a) is a schematic diagram of the constructed vector, wherein BR-pSP73 is a blank control, which only contains the specific DNA sequence BR corresponding to the DNA binding domain CI(N) of the CI protein; pPIDA1 is a negative control, which contains the DNA binding domain of the CI protein Domain CI(N) (cannot dimerize) and corresponding specific DNA sequence BR; CI(C)-pPIDA1 is a positive control, containing CI protein dimerization domains CI(C) and CI that can dimerize A fusion protein of the protein's DNA binding domain CI(N) and the corresponding specific DNA sequence BR. (b) After fully digested with DNase I for 12 hours, the PDf method can well distinguish the blank group, negative group and positive group, thus verifying the correctness of the PDf detection method. (c) The change of the number of specific DNA sequences (BR) in the dual-vector system with induction time in the PDf method.

Figure 4. Experimental validation and analysis of the reaction kinetic model of the PDf detection method. (a) The high consistency between the measured value of PDf and the calculated value based on the kinetic model proves the reliability of the model; (b) calculated by the kinetic model, when the target protein monomer concentration Cs changes between 0.01-100 times , the change of PDf signal; (c) compare the positive and negative experimental groups, that is, the DNA binding domain binds to the specific DNA sequence when the protein dimerizes and the DNA binding domain binds to the specific DNA sequence when the protein monomer state PDf signal.

Figure 5. Comparison of static and dynamic protein interaction detection based on the PDf method with existing protein-protein interaction detection techniques. (a) Yeast two-hybrid (Y2H), fluorescence resonance energy transfer (FRET), and PDf methods were used to detect static protein interactions in the E. coli chemotaxis system, respectively. (b) Dynamic changes of PhoB dimerization intensity over time in the E. coli PhoR/PhoB phosphate signaling system under different phosphate concentrations. (c) PhoR/PhoB phosphate signal transduction system measured by FRET method after full reaction of PhoB dimerization intensity in the environment of different phosphate concentrations.

Figure 6. Design and testing of nonintersecting DNA binding domain-specific DNA sequence interaction pairs. (a) Based on the structural information of the PDB structure 1LMB, the interaction energy of the DNA-binding domain CI(N) ^wt of the wild-type CI protein and the mutant CI(N) ^mut1 with different specific DNA sequences was calculated by FoldX software. The amount of change in the interaction energy of the dimer of the wild-type DNA-binding domain (CI(N) ^wt ) with the wild-type-specific DNA sequence (BR1) relative to the condition of all possible specific DNA sequences. A positive value indicates an increase in the interaction energy, and a negative value indicates a decrease in the interaction energy. (b) PDf detection results based on the DNA-binding domains CI(N) ^wt and CI(N) ^mut1 and different BR sequences, where the dotted line indicates the standard value. The abscissa CI(N) ^wt -BRi (i=1, 4, 5, 6, 7, 8, 9, 10) in the figure indicates that the DNA binding domains in the dual carrier are both CI(N) ^wt , specific DNA The sequences are all BRi; CI(N) ^mut1 -BRi (i=1, 4, 5, 6, 7, 8, 9, 10) indicates that the DNA binding domains in the dual vectors are all CI(N) ^mut1 , specific The DNA sequences are all BRi; CI(N) ^wt/mut1 -BRi (i=1, 4, 5, 6, 7, 8, 9, 10) indicates that a DNA binding domain in the binary vector is CI(N) ^wt , The other is CI(N) ^mut1 , the specific DNA sequences are all BRi. (c) Schematic diagram of the simultaneous in vivo detection of multiple pairs of protein interactions using the PDf technique.

Detailed ways

Materials and Methods

(1) Strains and vectors

a. Cloned strain: Escherichia coli K12 strain DH5α (Sangon Biotech, SD8411)

b. Expression strain: Escherichia coli K12 strain JM109 (Takara, D9052A)

c. Vector: pSP73 (Promega, P2221), pSB1K3 (iGEM Distribution)

(2) Medium and reagents

a. Medium:

LB liquid medium:

Sodium chloride 1g, yeast extract 0.5g, peptone 1g, double distilled water 100ml

LB solid medium:

Sodium chloride 1g, yeast extract 0.5g, peptone 1g, agar 1.2g, double distilled water 100ml

M9 histidine-deficient medium:

Solution 1: 20% glucose solution 2ml, 20mM adenine solution 1ml, 10X histidine deficient amino acid supplement 10ml

Solution 2: 0.1ml of 1M magnesium sulfate solution, 0.1ml of 1M thiamine hydrochloride solution, 0.1ml of 10mM zinc sulfate solution, 0.1ml of 100mM calcium chloride solution, 0.05ml of 100mM isopropylthiogalactoside (IPTG), Add solution 2 to solution 1 and mix well, and add 10ml of 10XM9 salt to it, then distill the volume to 100ml with double distilled water.

b. Reagents

10X Histidine Deficient Amino Acid Supplement:

Adenine 200mg, Arginine Hydrochloride 200mg, Isoleucine 300mg, Lysine Hydrochloride 300mg, Methionine 200mg, Phenylalanine 500mg, Threonine 2000mg, Tyrosine 300mg, Uracil 200mg, Valine acid 1500mg, leucine 1000mg, tryptophan 200mg, double distilled water 1L.

10X M9 Salt:

Disodium hydrogen phosphate 67.8g, potassium dihydrogen phosphate 30g, sodium chloride 5g, ammonium chloride 10g, double distilled water 1L.

Antibiotic solution: ampicillin solution, kanamycin solution

Pierce Chromatin Prep Module (Thermo Scientific, 26158)

UNIQ-10 Column Oligonucleotide Purification Kit (Sangon Biotech, SK1144)

SanPrep Column Plasmid DNA Mini-Extraction Kit (Sangon Biotechnology, SK8192)

AxyPrep PCR Cleanup Kit (Axygen, AP-PCR-50)

In-Fusion HD Cloning Kit (CloneTech, 639648)

Deoxyribonuclease I (DNase I) (2,000U/mL, New England BioLabs, M0303S)

PrimeSTAR Max DNA Polymerase (Takara, R045A)

SYBR Premix EX Tag II (Takara, RR820A)

Restriction enzymes:

EcoRI, BamHI, KpnI, SpeI, NheI, XhoI, DpnI

37% formaldehyde solution

Lysis Buffer I:

Prepare according to the ratio of adding 1ul protease and phosphatase inhibitor mixture to every 100ul Membrane Extraction Buffer (Pierce Chromatin Prep Module)

MNase Digestion Buffer Working Solution

Prepare by adding 0.1ul of 1M dithiothreitol (DTT) solution to every 100ul of MNase digestion buffer (Pierce Chromatin Prep Module).

De-crosslinking mixture (10ul):

6.6 μl of nuclease-free water, 2.4 μl of 5M sodium chloride solution, and 1 μl of proteinase K.

(3) Vector construction

a. Construction of pPIDA1 and pPIDK1 detection vectors

(i) MCS-pSP73, MCS-pSB1K3 and BR-pSP73 vector construction

The multiple cloning site MCS sequence shown in SEQ ID NO: 1

SEQ ID NO: 1

5'-GGTACCGCGGCCGCTACTAGTGCCATGGAGGCCGAATTCCCGGGGATCCGTCGACCTGCATGCTAGCAGCGGCCG-3'

Inserted into the pSP73 vector by ClaI and XhoI restriction endonucleases to obtain MCS-pSP73.

The multiple cloning site MCS sequence shown in SEQ ID NO: 2

SEQ ID NO: 2

5'-GGTACCGCGGCCGCTACTAGTGCCATGGAGGCCGAATTCCCGGGGATCCGTCGACCTGCATGCTAGCAGCGGCCGCTCGAG-3'

Insert the two restriction enzymes AatII and PstI into the pSB1K3 vector to obtain MCS-pSB1K3.

In addition, the specific DNA sequence BR (SEQ ID NO: 21) corresponding to the DNA binding domain CI(N) was inserted between the NheI and XhoI sites of the MCS-pSP73 vector to obtain the BR-pSP73 vector.

(ii) Cloning of CI(N) and construction of CI(N)-MCS-pSP73 and CI(N)-MCS-pSB1K3 vectors

The following primers were used to clone the DNA-binding domain CI(N) of protein CI using the lambda phage genome as a template.

Cloning Forward Primer (SEQ ID NO: 3):

5'-GGGGTACCGCGGCCGCTACTAGTATGAGCACAAAAAAGAAACCATTAACACAAGAG-3'

Cloning reverse primer (SEQ ID NO: 4):

5'-CCCTCGAGCGGCCGCTGCTAGCCTGAACATGTGAAAAAACAGGGTACTCAT-3'

Clone product CI(N) (SEQ ID NO: 5):

5’-GGGGTACCGCGGCCGCTACTAGTATGAGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATGTTCAGGCTAGCAGCGGCCGCTCGAGGG-3’

The above cloning products were inserted between the KpnI and SpeI sites of MCS-pSP73 and MCS-pSB1K3 vectors by restriction enzymes KpnI and NheI to obtain CI(N)-MCS-pSP73 and CI(N)-MCS-pSB1K3 vectors.

(iii) Construction of pPIDA1 and pPIDK1 vectors

The ribosome binding site RBS and the promoter Plac sequence were sequentially inserted between the KpnI and SpeI sites of CI(N)-MCS-pSP73 and CI(N)-MCS-pSB1K3, and the transcription termination sequences Ter and cI(N) The corresponding specific DNA sequence BR was sequentially inserted between the NheI and XhoI sites of CI(N)-MCS-pSP73 and CI(N)-MCS-pSB1K3, and finally pPIDA1 and pPIDK1 vectors were obtained. The sequences of Plac, RBS and Ter are as follows:

Plac (SEQ ID NO: 6):

5'-CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACA-3'

RBS (SEQ ID NO: 7):

5'-ATTAAAGAGGAGAAA-3'

Ter (SEQ ID NO: 8):

5'-CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA-3'

b. Gene cloning:

Use the following primers to clone the target gene, and purify the resulting polymerase chain reaction (PCR) product with the AxyPrep PCR Cleaning Kit. The product can be used in subsequent steps or stored at -20°C.

Cloning Forward Primer (SEQ ID NO: 9):

5'-CATGGAGGCCGAATTC111222333444555666777888-3' (where 111 is the start codon of the target gene, that is, the first codon, and the remaining numbers indicate the subsequent codon sequence of the target gene)

Cloning reverse primer (SEQ ID NO: 10):

5'-GCAGGTCGACGGATCCLLLNNNNNNNNNNNNNNNNNNNNNN-3' (where LLL is the last codon of the target gene, and N represents the sequence of the preceding codon of the target gene)

c. Homologous recombination

The vectors pPIDA1 and pPIDK1 were double digested with restriction endonucleases EcoRI and BamHI, and the digested products were purified with the AxyPrep PCR cleaning kit to obtain a linearized vector, and then the target gene was used with the linearized vector respectively. After In-Fusion HD CloningKit was reacted at 50°C for 15 minutes, it was transformed into Escherichia coli DH5α competent medium, and cultured overnight at 37°C on LB solid medium containing corresponding antibiotics (ampicillin or kanamycin). Finally, X-pPIDA1 containing the target protein X and Y-pPIDK1 containing the target protein Y were obtained.

d. Carrier extraction and inspection

The monoclonal colonies of the transformed recombinant vectors were picked and cultured in LB liquid medium containing corresponding antibiotics (ampicillin or kanamycin) at 37° C. and shaken at 250 rpm overnight.

The next day, take out the overnight culture and use the SanPrep column plasmid DNA mini-extraction kit to extract the recombinant vector. The extracted vectors can be verified for correctness by sequencing.

(4) Co-transformation and expression

a. Co-transformation

The recombinant X-pPIDA1 and Y-pPIDK1 vectors were co-transformed into Escherichia coli JM109 competent, and cultured overnight at 30°C on LB solid medium containing ampicillin and kanamycin. The monoclonal colonies obtained by overnight culture were picked and cultured overnight in M9 histidine-deficient medium containing ampicillin and kanamycin at 37° C. with shaking at 250 rpm.

b. to express

Take the above overnight cultured bacterial solution and inoculate it into a new M9 histidine-deficient medium containing ampicillin and kanamycin, adjust the OD600 value to 0.03-0.04, and then add isopropyl sulfide with a final concentration of 10 μM Substituent galactoside (IPTG) was cultured at 37° C. with shaking at 250 rpm for 8 hours, and the OD600 was measured and recorded.

(5) Protein dimerization footprint detection (PDf)

a. Chromatin cross-linking and bacterial isolation

Take 1ml of the Escherichia coli JM109 bacterial solution induced and expressed in the above 8h into a 15ml centrifuge tube, add 27μl of 37% formaldehyde solution, and shake at 25°C and 300rpm for 8 minutes, then add 10X glycine solution to a final concentration of 1X, and The reaction was shaken at 300 rpm for 5 minutes at 25°C. Transfer the reaction solution to a 1.5ml centrifuge tube, centrifuge at 12000rpm for 4min at 4°C, discard the supernatant, and wash the bacterial pellet twice with 1ml 1X PBS solution at 4°C, centrifuge at 12000rpm for 2min, then add 10μl of protease and phosphatase inhibitors Resuspend the bacterial pellet in 1ml of 1X PBS solution of the mixed solution, centrifuge at 12000rpm at 4°C for 4min and discard the supernatant. The obtained bacterial pellet can be used for subsequent experiments or stored at -20°C.

b. Sample lysis and MNase digestion

Resuspend the bacterial pellet with 200μl Lysis Buffer I, shake and mix for 15 seconds, place on ice for 10 minutes, centrifuge at 9000rpm for 3 minutes and remove the supernatant. Then, resuspend the above pellet with 200μl MNase digestion buffer working solution, and take 100μl for subsequent detection.

Add 2 μl MNase to every 18 μl MNase digestion buffer and mix well, take 4 μl and add it to the above 100 μl resuspension, react at 37°C for 15 minutes, and shake and mix every 5 minutes. Then, 20 μl of Mnase reaction stop solution was added to the above reaction solution, placed on ice for 5 minutes, centrifuged at 9000 rpm for 5 minutes, and the supernatant was removed.

c. Extraction of protein-DNA complexes and digestion with DNase I

Resuspend the pellet obtained in the previous step with 50 μl of nuclear extraction buffer, and place it on ice for 15 minutes, shaking and mixing every 5 minutes. Then centrifuge at 9000rpm for 5 minutes, keep the supernatant, transfer it to a 1.5ml centrifuge tube, and then add 2μl DNase I to it for overnight digestion (at least 12 hours).

d. Decrosslinking and purification of DNA fragments

The overnight reaction solution was reacted at 75°C for 10 minutes, then cooled on ice, and 10 μl of the cross-linking mixture was added thereto, mixed well, and then reacted at 65°C for 1.5 hours. The above reaction solution was purified with UNIQ-10 Column Oligonucleotide Purification Kit to obtain a purified DNA fragment solution.

(6) Quantitative PCR detection of target DNA fragments

Take more than 1 μl of the DNA fragment solution and use the SYBR Premix EX Tag II kit to quantitatively detect the target DNA fragment. The reaction conditions are 95°C for 30s, then 95°C for 5s; 67.5°C for 30s for 30 cycles, and the detection primers for CI(N) specific binding sequence BR are:

Forward primer (SEQ ID NO: 11):

5'-AGCAAAATCAGGGTGTTATCTACCCTCTGGCGGTGATAACTTC-3'

Reverse primer (SEQ ID NO: 12):

5'-CCGCTGCTAGCACCACAGGGCAGAG-3'

In addition, the quantitative results are based on the PDf signal value determined by the CI(C) protein dimerization domain CI(C) in the CI(C)-pPIDA1+CI(C)-pPIDK1 system As a benchmark, and corrected by the OD600 value of bacterial growth after 8 hours of induction of expression.

CI protein dimerization domain CI (C) sequence (SEQ ID NO: 13):

5’-GCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGATGCGGAGAGATGGGTAAGCACAACCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTACAACCACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTTGTTCCGTTGTGGGGAAAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGA-3’

(7) Construction of DNA-binding domain CI(N) mutants and modification of corresponding specific DNA sequences

(i) Construction of DNA-binding domain CI(N) mutants

Taking the mutant CI(N) ^mut1 as an example, the following primers were used:

Forward primer (SEQ ID NO: 14):

5'-GCAGACAAGATGGGGATGGGGCAGTCAGCGATTAATAAGGCATTTAATGGCATCAATGC-3'

Reverse primer (SEQ ID NO: 15):

5'-GCATTGATGCCATTAAATGCCTTATTAATCGCTGACTGCCCCATCCCCATCTTGTCTGC-3'

PCR was performed using CI(C)-pPIDA1 containing the wild-type DNA binding domain CI(N) ^wt (SEQ ID NO: 5) as a template to obtain a linearized vector. The PCR product was fully digested with restriction endonuclease DpnI, and after transformation and vector extraction, the vector with the DNA binding domain as the mutant CI(N) ^mut1 was obtained.

(ii) Modification of the corresponding specific DNA sequence

Take the preparation of a specific DNA sequence in which the DNA-binding domains CI(N) ^wt and CI(N) ^mut1 do not intersect each other as an example. To design specific DNA sequences capable of specifically binding to different DNA-binding domains without cross-reactivity, we utilized the structural information of the X-ray diffraction structure 1LMB of the CI(N) ^wt -DNA complex downloaded from the PDB database , Calculate the interaction energy between the DNA binding domain and the DNA sequence through the FoldX software, and traverse all the combined forms of the DNA sequence and calculate and evaluate its interaction energy change relative to the wild-type specific DNA sequence. Based on this calculation result, we designed the corresponding DNA sequence, transformed CI(C)-pPIDA1 using the above site-directed mutagenesis method, and used the PDf method to detect the specific binding of different CI(N) mutants to different DNA sequences ability.

For CI(N) ^wt and CI(N) ^mut1 , it is necessary to obtain three DNA sequences: a DNA sequence that specifically binds to the CI(N) ^wt -CI(N) ^wt homodimer, and a DNA sequence that specifically binds to the CI(N) wt DNA sequences that bind N) ^mut1 -CI(N) ^mut1 homodimers, and DNA sequences that specifically bind CI(N) ^wt -CI(N) ^mut1 heterodimers. In addition, the same as above, in the PDf detection method here, the PDf detection signal of the CI protein dimerization domain CI(C) in the CI(C)-pPIDA1+CI(C)-pPIDK1 dual vector system is used for comparison with baseline values. The DNA binding domain on each vector in this system is wild-type CI(N) ^wt , and the BR sequences are all wild-type specific DNA sequences.

Example 1 Working principle of protein dimerization footprint detection (PDf)

The working principle of protein dimerization footprint detection (PDf) in the present invention is shown in FIG. 2 . After the target protein is expressed in E. coli, it will interact with the specific DNA sequence on the vector through its fused DNA binding domain. If the two proteins interact, their dimers can bind to DNA with high affinity, otherwise they cannot bind or bind with very low affinity. Then, after formaldehyde treatment, the DNA and its associated protein dimers are cross-linked to form a complex. Under the action of MNase enzyme, the carrier is broken into small fragments. After these small fragments are separated and extracted, they are fully digested with DNase I, so as to remove the DNA fragments that are not bound to the protein. The digested sample was decrosslinked with proteinase K and purified to obtain the corresponding target DNA fragment. Quantitative detection based on nucleic acid sequence, such as quantitative PCR, high-throughput sequencing, and DNA microarray, or qualitative detection based on nucleic acid sequence, such as PCR and agarose gel electrophoresis, can obtain the interaction network information based on the target protein on these DNA fragments .

Example 2 Taking the dimerization domain CI(C) of protein CI as the target protein to verify the protein dimerization footprint detection (PDf) method

In order to verify whether the PDf test results can reflect the different strengths of protein interactions, through three control experiments of BR-pSP73 (blank control), pPIDA1 (negative control) and CI(C)-pPIDA1 (positive control) (Figure 3a), we can It was proved that the 12-hour digestion with DNase I could remove the DNA fragments not protected by protein binding, so that the PDf detection results could reflect different protein interaction strengths (the results are shown in Figure 3b).

The establishment of the reaction kinetic model of embodiment 3 PDf detection

In order to discuss the quantitative detection ability of PDf on the strength of protein interaction and the influence of the binding of DNA binding domain monomers and specific DNA sequences on the detection of protein-protein interactions, we start from the kinetic process of protein monomers binding to specific DNA sequences Starting from this paper, the influence of protein dimerization, a related parameter of protein interaction process, on DNA binding kinetics was discussed.

1. Kinetic model of protein monomer DNA binding

Let θ _b be the proportion of specific DNA fragments bound to protein monomers, θ _r be the proportion of specific DNA fragments not bound to protein monomers, C _s be the concentration of protein monomers, k _on be the ratio of protein monomers to specific DNA fragments _koff is the rate constant for the dissociation reaction of protein monomers and specific DNA sequence complexes.

According to the above definition there are:

θ _b + θ _r = 1 (1)

And according to the experimental principle, the rate of change of θ _b is:

$\frac{{\mathrm{<span\; class="notranslate">\; d\&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}}{\mathrm{<span\; class="notranslate">\; dt</span>}}<span\; class="notranslate">\; =</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}{\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; r</span>}}<span\; class="notranslate">\; -</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}{\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 2</span>}<span\; class="notranslate">\; )</span>$

Combining Equation (1) and Equation (2), the boundary conditions of the model can be obtained:

When t=0, that is, when no cross-linking occurs, the system is in an equilibrium state, and it can be obtained Let the value of θ _b at this time be Available:

${\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}^{\mathrm{<span\; class="notranslate">\; 0</span>}}<span\; class="notranslate">\; =</span>\frac{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}}{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 3</span>}<span\; class="notranslate">\; )</span>$

When the cross-linking starts, the above equilibrium state is destroyed, and the value of θ _b increases continuously with the progress of cross-linking, and it reaches the maximum at t=∞:

${\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}^{<span\; class="notranslate">\; \&infin;</span>}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; 1</span>}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 4</span>}<span\; class="notranslate">\; )</span>$

Differentiate Equation (2) with respect to time and combine Equation (1) to get:

$\frac{{\mathrm{<span\; class="notranslate">\; d</span>}}^{\mathrm{<span\; class="notranslate">\; 2</span>}}{\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}}{{\mathrm{<span\; class="notranslate">\; dt</span>}}^{\mathrm{<span\; class="notranslate">\; 2</span>}}}<span\; class="notranslate">\; +</span><span\; class="notranslate">\; (</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}<span\; class="notranslate">\; )</span>\frac{{\mathrm{<span\; class="notranslate">\; d\&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}}{\mathrm{<span\; class="notranslate">\; dt</span>}}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; 0</span>}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 5</span>}<span\; class="notranslate">\; )</span>$

The above differential equation has the following general solution:

${\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; \&alpha;</span>}{\mathrm{<span\; class="notranslate">\; e</span>}}^{{\mathrm{<span\; class="notranslate">\; tr</span>}}_{\mathrm{<span\; class="notranslate">\; 1</span>}}}<span\; class="notranslate">\; +</span>\mathrm{<span\; class="notranslate">\; \&beta;</span>}{\mathrm{<span\; class="notranslate">\; e</span>}}^{{\mathrm{<span\; class="notranslate">\; tr</span>}}_{\mathrm{<span\; class="notranslate">\; 2</span>}}}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 6</span>}<span\; class="notranslate">\; )</span>$

where r ₁ =0, r ₂ =-(k _on C _s +k _off ), then according to the boundary conditions of the model (3) and (4):

${\mathrm{<span\; class="notranslate">\; \&theta;</span>}}_{\mathrm{<span\; class="notranslate">\; b</span>}}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; 1</span>}<span\; class="notranslate">\; -</span>\frac{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{\mathrm{<span\; class="notranslate">\; e</span>}}^{<span\; class="notranslate">\; -</span>\mathrm{<span\; class="notranslate">\; t</span>}<span\; class="notranslate">\; (</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}<span\; class="notranslate">\; )</span>}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 7</span>}<span\; class="notranslate">\; )</span>$

Equation (7) describes the binding of protein monomers to specific DNA during the crosslinking process of the PDf method. Considering that the unsaturation of the specific DNA sequence and the total number of specific DNA sequences are constant during the experiment (see Figure 3c), the PDf signal of the protein monomer binding to the specific DNA sequence can be obtained as:

I _s =εKθ _b (8)

Where εK is the maximum binding number of a specific DNA sequence, ε is a constant, K=k _on /k _off , and (7) is brought into (8) to obtain the complete form of the I _s signal:

${\mathrm{<span\; class="notranslate">\; I</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; \&epsiv;\; K</span>}<span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 1</span>}<span\; class="notranslate">\; -</span>\frac{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{\mathrm{<span\; class="notranslate">\; e</span>}}^{<span\; class="notranslate">\; -</span>\mathrm{<span\; class="notranslate">\; t</span>}<span\; class="notranslate">\; (</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}<span\; class="notranslate">\; )</span>}<span\; class="notranslate">\; )</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 9</span>}<span\; class="notranslate">\; )</span>$

2. DNA binding kinetic model of protein dimerization process

The PDf signal of the protein dimerization process includes the contribution of two parts, one is the binding of protein monomers to specific DNA sequences, and the other is the binding of protein dimers to specific DNA sequences. Therefore, the PDf signal of protein dimerization or protein interaction can be obtained as:

I _sd =I _s +I _d (10)

Among them, I _s is the contribution of protein monomer binding to specific DNA sequence, and its form is shown in (9), and I _d is the contribution of protein dimer binding to specific DNA sequence.

Based on the DNA binding model of protein monomers, the DNA binding kinetic model of protein dimers can be extended. C _d is defined as the concentration of protein dimer, k _ond is the rate constant of the binding reaction of protein dimer and specific DNA sequence, and k _offd is the rate constant of dissociation reaction of protein dimer and specific DNA sequence complex. According to the above definition, the strength of protein dimerization or protein interaction can be expressed as:

K _dimer = C _d /C _s ² (11)

Considering the unsaturation of the specific DNA sequence, the PDf signal contributed by the binding of the protein dimer to the specific DNA sequence can be obtained as:

in ε' is a constant.

Therefore, the PDf signal for protein dimerization or protein interaction process is:

Combined with equation (11), equation (14) can be further obtained:

This is the PDf signal of protein dimerization or interaction process.

Experimental verification and analysis of the reaction kinetic model of embodiment 4 PDf detection

On the basis of the above model, the reaction kinetic model of PDf was experimentally verified and analyzed by using the dual vector expression system X-pPIDA1+GFP-pPIDK1. As shown in Figure 4(a), pPIDA1 and pPIDK1 have the same protein monomer detection performance and the same protein expression ability, so protein X and GFP have similar expression levels. Since GFP exists almost as a monomer in cells, the PDf signal I _s of the system that only expresses GFP can be used to approximate the PDf signal I _s of the target protein X, so that the reporter gene property of GFP can be used to detect protein monomers Effect of binding on protein X dimerization interaction PDf assay results.

In order to further illustrate and verify the above principles:

First, by comparing the experimentally measured value of PDf with the theoretically calculated value based on the above kinetic model (see Figure 4a), it shows that the kinetic model can be consistent with the experimental results, which confirms the reliability of the model.

Then, continue to investigate the impact of protein monomer concentration fluctuations on the PDf signal. According to the kinetic model, assuming that the multiple of protein monomer concentration change is Δ, when the protein concentration changes from Cs to Δ· _Cs , the PDf detection signal I _s ' is:

${{\mathrm{<span\; class="notranslate">\; I</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}}^{<span\; class="notranslate">\; \&prime;</span>}<span\; class="notranslate">\; =</span>\mathrm{<span\; class="notranslate">\; \&epsiv;K</span>}<span\; class="notranslate">\; -</span>\frac{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}<span\; class="notranslate">\; \&CenterDot;</span>\mathrm{<span\; class="notranslate">\; \&Delta;</span>}<span\; class="notranslate">\; \&CenterDot;</span>{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}}{\mathrm{<span\; class="notranslate">\; e</span>}}^{<span\; class="notranslate">\; -</span>\mathrm{<span\; class="notranslate">\; t</span>}<span\; class="notranslate">\; (</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; on</span>}}<span\; class="notranslate">\; \&CenterDot;</span>\mathrm{<span\; class="notranslate">\; \&Delta;</span>}<span\; class="notranslate">\; \&Center\; Dot;</span>{\mathrm{<span\; class="notranslate">\; C</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; )</span><span\; class="notranslate">\; +</span>{\mathrm{<span\; class="notranslate">\; k</span>}}_{\mathrm{<span\; class="notranslate">\; off</span>}}<span\; class="notranslate">\; )</span>}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 15</span>}<span\; class="notranslate">\; )</span>$

So the change multiple of PDf detection signal I _s is

${\mathrm{<span\; class="notranslate">\; \&Delta;I</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}<span\; class="notranslate">\; =</span>\frac{{{\mathrm{<span\; class="notranslate">\; I</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}}^{<span\; class="notranslate">\; \&prime;</span>}}{{\mathrm{<span\; class="notranslate">\; I</span>}}_{\mathrm{<span\; class="notranslate">\; the\; s</span>}}}<span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; -</span><span\; class="notranslate">\; (</span>\mathrm{<span\; class="notranslate">\; 16</span>}<span\; class="notranslate">\; )</span>$

When the protein concentration Cs varied between 0.01-100 fold, the results showed that the upper fold change of the PDf signal was about 10 (see Figure 4b). So, when When , it can be considered that the influence of I _s on I _sd is negligible, that is, I _s ≈0.

At this time, equation (17) can be obtained:

Based on this equation, it can be obtained that for the two proteins A and B to be tested, the PDf detection signal has the following relationship:

That is, the ratio of the respective dimerization intensities of the two proteins can be approximately equal to the ratio of their PDf detection signals. In other words, the protein-protein interaction strength can be expressed by the corresponding specific DNA sequence copy number. By comparing the PDf signals of the positive and negative experimental groups, it was found that when the expression induction time was 8 hours, the value of the positive group (I _sd ) was significantly greater than the value of the negative group (I _s ) 10 times (see Figure 4c), that is to say, The above relationship, therefore selected the induced expression time as the experimental condition of PDf. At the same time, the PDf detection signal of the CI protein dimerization domain CI(C) As a benchmark, it is defined that when the PDf signal I _sd (X) of a certain target protein X<0.1I _sd ^ref , I _sd (X)=0 can be considered as a criterion for judging whether there is an interaction between proteins.

Example 5 Comparison of Static and Dynamic Protein Interaction Detection Based on PDf Method and Existing Protein Interaction Detection Technology

In order to verify the performance of the PDf method for qualitative and quantitative detection of protein interactions, we selected four proteins cheA, cheB, cheZ and cheY in the E. coli chemotaxis system for PDf detection, and the results are shown in Figure 5a. Compared with the results of yeast two-hybrid (Y2H) and fluorescence resonance energy transfer (FRET) experiments, the PDf method can well realize the qualitative and quantitative detection of protein interactions.

cheA sequence (SEQ ID NO: 16):

＞gi|49175990: c1973348-1971384Escherichia coli str.K-12substr.MG1655chromosome, complete genome

GTGAGCATGGATATAAGCGATTTTTATCAGACATTTTTTGATGAAGCGGACGAACTGTTGGCTGACATGGAGCAGCATTTGCTGGTTTTGCAGCCGGAAGCGCCAGATGCCGAACAATTGAATGCCATCTTTCGGGCTGCCCACTCGATCAAAGGAGGGGCAGGAACTTTTGGCTTCAGCGTTTTGCAGGAAACCACGCATCTGATGGAAAACCTGCTCGATGAAGCCAGACGAGGTGAGATGCAACTCAACACCGACATTATCAATCTGTTTTTGGAAACGAAGGACATCATGCAAGAACAGCTCGACGCTTATAAACAGTCGCAAGAGCCGGATGCCGCCAGCTTCGATTATATCTGCCAGGCCTTGCGTCAACTGGCATTAGAAGCGAAAGGCGAAACGCCATCCGCAGTGACCCGATTAAGTGTGGTTGCCAAAAGTGAACCGCAAGATGAGCAGAGTCGCAGTCAGTCGCCGCGACGAATTATCCTTTCGCGCCTGAAGGCCGGGGAAGTCGACCTGCTGGAAGAAGAACTGGGACATCTGACAACGTTAACTGACGTGGTGAAAGGGGCGGATTCGCTCTCGGCAATATTACCGGGCGACATCGCCGAAGATGACATCACAGCGGTACTCTGTTTTGTGATTGAAGCCGATCAGATTACCTTTGAAACAGTAGAAGTCTCGCCAAAAATATCCACCCCACCAGTGCTTAAACTGGCAGCCGAACAAGCGCCAACCGGCCGCGTGGAGCGGGAAAAAACGACGCGCAGCAATGAATCCACCAGCATCCGTGTAGCGGTAGAAAAGGTTGATCAATTAATTAACCTCGTCGGCGAGCTGGTTATCACCCAGTCCATGCTTGCCCAGCGTTCCAGCGAACTGGACCCGGTTAATCATGGTGATTTGATAACCAGCATGGGGCAGTTACAACGTAACGCCCGTGATTTGCAGGAATCAGTGATGTCGATTCGCATGATGCCGATGGAATATGTTTTTA GTCGCTATCCCCGGCTGGTGCGTGATCTGGCGGGAAAACTCGGCAAGCAGGTAGAACTGACGCTGGTGGGCAGTTCTACTGAACTCGACAAAAGCCTGATAGAACGCATTATCGACCCGCTGACCCACCTGGTACGCAATAGCCTCGATCACGGTATTGAACTGCCAGAAAAACGGCTCGCCGCAGGTAAAAACAGCGTCGGAAATTTAATTCTGTCTGCCGAACATCAGGGCGGCAACATTTGCATTGAAGTGACCGACGATGGGGCGGGGCTAAACCGTGAGCGAATTCTGGCAAAAGCGGCCTCGCAAGGTTTGACTGTCAGCGAAAACATGAGCGACGACGAAGTCGCGATGCTGATATTTGCACCTGGCTTCTCCACGGCAGAGCAGGTCACCGACGTCTCCGGGCGCGGCGTCGGCATGGACGTCGTTAAACGTAATATCCAGAAGATGGGCGGTCATGTCGAAATCCAGTCGAAGCAGGGTACTGGCACTACGATCCGCATTTTACTGCCGCTGACGCTGGCCATCCTCGACGGCATGTCCGTACGCGTTGCGGATGAAGTTTTCATTCTGCCGCTGAATGCTGTTATGGAATCACTGCAACCCCGTGAAGCCGATCTCCATCCACTGGCCGGCGGCGAGCGGGTGCTGGAAGTGCGGGGTGAATATCTGCCCATCGTCGAACTGTGGAAAGTGTTCAACGTCGCGGGCGCGAAAACCGAAGCCACCCAGGGAATTGTGGTGATCTTACAAAGTGGCGGTCGCCGCTACGCCTTGCTGGTGGATCAATTAATTGGTCAACACCAGGTTGTGGTTAAAAACCTTGAAAGTAACTATCGCAAAGTCCCCGGCATTTCTGCTGCGACCATTCTTGGCGACGGCAGCGTGGCACTGATTGTTGATGTCTCCGCCTTGCAGGCGATAAACCGCGAACAACGTATGGCGAACACCGCCGCCTGA

CheB sequence (SEQ ID NO: 17):

＞gi|49175990: c1966525-1965476Escherichia coli str.K-12substr.MG1655chromosome, complete genome

ATGAGCAAAATCAGGGTGTTATCTGTCGATGATTCGGCACTGATGCGCCAGATCATGACAGAAATCATCAACAGCCATAGCGACATGGAAATGGTGGCGACCGCGCCTGATCCGCTGGTCGCGCGTGACTTGATTAAGAAATTCAATCCCGATGTGCTGACGCTGGATGTTGAAATGCCGCGGATGGACGGACTGGATTTCCTCGAAAAATTAATGCGTTTGCGTCCAATGCCCGTTGTGATGGTTTCTTCCCTGACCGGCAAAGGGTCAGAAGTCACGCTGCGCGCGCTGGAGCTGGGGGCGATAGATTTTGTCACCAAACCGCAACTGGGTATTCGCGAAGGTATGCTGGCGTATAACGAAATGATTGCTGAAAAGGTGCGTACGGCAGCAAAGGCGAGCCTTGCAGCACATAAGCCATTGTCGGCACCGACAACGCTGAAGGCGGGGCCGTTGTTGAGTTCTGAAAAACTGATTGCGATTGGTGCTTCAACGGGTGGAACTGAGGCAATTCGTCACGTACTGCAACCGTTGCCGCTTTCCAGCCCGGCACTGTTAATTACCCAGCATATGCCGCCCGGTTTCACCCGCTCTTTTGCCGACAGACTTAATAAGCTTTGCCAGATCGGGG TTAAAGAAGCCGAAGACGGAGAACGTGTCTTGCCGGGGCATGCCTATATTGCGCCGGGCGATCGGCATATGGAGCTGTCGCGTAGTGGCGCAAATTACCAAATCAAAATTCACGATGGCCCGGCGGTTAACCGTCATCGGCCTTCGGTAGATGTGTTGTTCCATTCTGTCGCCAAACAGGCGGGGCGTAATGCGGTTGGGGTGATCCTGACCGGTATGGGCAACGACGGCGCGGCGGGAATGTTGGCGATGCGTCAGGCGGGGGCATGGACCCTTGCGCAAAACGAAGCAAGTTGCGTGGTGTTCGGCATGCCGCGCGAGGCCATCAATATGGGTGGTGTCTGCGAAGTGGTCGATCTTAGCCAGGTA AGCCAGCAAATGTTGGCAAAAATTAGTGCCGGACAGGCGATACGTATTTAA

CheY sequence (SEQ ID NO: 18):

＞gi|49175990: c1965072-1965461Escherichia coli str.K-12substr.MG1655chromosome, complete genome

ATGGCGGATAAAGAACTTAAATTTTTGGTTGTGGATGACTTTTCCACCATGCGACGCATAGTGCGTAACCTGCTGAAAGAGCTGGGATTCAATAATGTTGAGGAAGCGGAAGATGGCGTCGACGCTCTCAATAAGTTGCAGGCAGGCGGTTATGGATTTGTTATCTCCGACTGGAACATGCCCAATATGGATGGCCTGGAATTGCTGAAAACAATTCGTGCGGATGGCGCGATGTCGGCATTGCCAGTGTTAATGGTGACTGCAGAAGCGAAGAAAGAGAACATCATTGCTGCGGCGCAAGCGGGGGCCAGTGGCTATGTGGTGAAGCCATTTACCGCCGCGACGCTGGAGGAAAAACTCAACAAAATCTTTGAGAAACTGGGCATGTGA

CheZ sequence (SEQ ID NO: 19):

＞gi|49175990: c1965061-1964417Escherichia coli str.K-12substr.MG1655chromosome, complete genome

ATGATGCAACCATCAATCAAACCTGCTGACGAGCATTCAGCTGGCGATATCATTGCGCGCATCGGCAGCCTGACGCGTATGCTGCGCGACAGTTTGCGGGAACTGGGGCTGGATCAGGCCATTGCCGAAGCGGCGGAAGCCATCCCCGATGCGCGCGATCGTTTGTACTATGTTGTGCAGATGACCGCCCAGGCTGCGGAGCGGGCGCTGAACAGTGTTGAGGCGTCACAACCGCATCAGGATCAAATGGAGAAATCAGCAAAAGCGTTAACCCAACGTTGGGATGACTGGTTTGCCGATCCGATTGACCTTGCCGACGCCCGTGAACTGGTAACAGATACACGACAATTTCTGGCAGATGTACCCGCGCATACCAGCTTTACTAACGCGCAACTGCTGGAAATCATGATGGCGCAGGATTTTCAGGATCTCACCGGGCAGGTCATTAAGCGGATGATGGATGTCATTCAGGAGATCGAACGCCAGTTGCTGATGGTGCTGTTGGAAAACATCCCGGAACAGGAGTCGCGTCCAAAACGTGAAAACCAGAGTTTGCTTAATGGACCTCAGGTCGATACCAGCAAAGCCGGTGTGGTAGCCAGTCAGGATCAGGTGGACGATTTGTTGGATAGTCTTGGATTTTGA

In order to test the performance of the PDf method for the detection of dynamic protein interactions, that is, its time resolution, we selected the PhoB protein in the PhoR/PhoB phosphate signaling system of Escherichia coli to detect its dimerization under different phosphate concentration growth environments. The variation of intensity with reaction time, the results are shown in Figure 5b and Figure 5c. By comparing with the FRET results, PDf can detect the intensity of PhoB dimerization and its evolution with time under different phosphate concentrations, which shows that the PDf method has good time resolution in detecting dynamic protein interactions.

PhoB sequence (SEQ ID NO: 20):

＞gi|388476123:416366-417055Escherichia coli str.K-12substr.W3110, complete genome

ATGGCGAGACGTATTCTGGTCGTAGAAGATGAAGCTCCAATTCGCGAAATGGTCTGCTTCGTGCTCGAACAAAATGGCTTTCAGCCGGTCGAAGCGGAAGATTATGACAGTGCTGTGAATCAACTGAATGAACCCTGGCCGGATTTAATTCTCCTCGACTGGATGTTACCTGGCGGCTCCGGTATCCAGTTCATCAAACACCTCAAGCGCGAGTCGATGACCCGGGATATTCCAGTGGTGATGTTGACCGCCAGAGGGGAAGAAGAAGATCGCGTGCGCGGCCTTGAAACCGGCGCGGATGACTATATCACCAAGCCGTTTTCGCCGAAGGAGCTGGTGGCGCGAATCAAAGCGGTAATGCGCCGTATTTCGCCAATGGCGGTGGAAGAGGTGATTGAGATGCAGGGATTAAGTCTCGACCCGACATCTCACCGAGTGATGGCGGGCGAAGAGCCGCTGGAGATGGGGCCGACAGAATTTAAACTGCTGCACTTTTTTATGACGCATCCTGAGCGCGTGTACAGCCGCGAGCAGCTGTTAAACCACGTCTGGGGAACTAACGTGTATGTGGAAGACCGCACGGTCGATGTCCACATTCGTCGCCTGCGTAAAGCACTGGAGCCCGGCGGGCATGACCGCATGGTGCAGACCGTGCGCGGTACAGGATATCGTTTTTCAACCCGCTTTTAA

Example 6 Direct dynamic detection of protein interaction network

On the basis of the previous experiments, it is considered that in addition to high-efficiency detection, the DNA sequence also has programmable characteristics, that is, by changing the base arrangement of the specific DNA sequence in the sequence, the DNA binding domain is changed for the specific DNA sequence The ability to recognize, and then by designing non-intersecting DNA-binding domain-specific DNA sequence interaction pairs, the PDf method can simultaneously detect multiple pairs of protein interactions in the same system, that is, for the first time, the protein Direct detection of interacting networks becomes possible.

In order to verify the feasibility of the above concept, the following site-directed mutations were performed on the amino acids of the DNA recognition helix in the DNA-binding domain CI(N) ^wt of the wild-type CI protein: QSGVGAL was site-directed mutation to QSAINKA, thereby obtaining the mutant CI(N) ^mut1 . Then, based on the information of the interaction energy between CI(N) ^wt and CI(N) ^mut1 calculated by FoldX software (see Figure 6a), the following DNA sequences were designed:

BR1 (ie the specific DNA sequence corresponding to CI(N) ^wt ) (SEQ ID NO: 21):

AGCAAAAATCAGGGTGTTATCTACCTCTGGCGGTGATAACTTCATCTCTGCCCTGTGG

BR4 (SEQ ID NO: 22):

AGCAAAAATCAGGGTGTTATCTACCTCTGGCCGTGATAACTTCATCTCTGCCCTGTGG

BR5 (SEQ ID NO: 23):

AGCAAAAATCAGGGTGTTATCTACCTCTGGCGGTGCTAACTTCATCTCTGCCCTGTGG

BR6 (SEQ ID NO: 24):

AGCAAAAATCAGGGTGTTATCTACCCCTGGCGGTGATAACTTCATCTCTGCCCTGTGG

BR7 (SEQ ID NO: 25):

AGCAAAAATCAGGGTGTTATCTACCCCTGGCCGTGATAACTTCATCTCTGCCCTGTGG

BR8 (SEQ ID NO: 26):

AGCAAAAATCAGGGTGTTATCTACCCCTGGCTGTGATAACTTCATCTCTGCCCTGTGG

BR9 (SEQ ID NO: 27):

AGCAAAAATCAGGGTGTTATTCTACCCCAGGCCGTGAIAACTTCATCTCTGCCCTGTGG

BR10 (SEQ ID NO: 28):

AGCAAAAATCAGGGTGTTATCTACCCCAGTCCGTGATAACTTCATCTCTGCCCTGTGG

Among them, BR1, 4, 5, 6, and 8 are sequences designed for CI(N) ^wt -CI(N) ^wt and CI(N) ^mut1 -CI(N) ^mut1 homodimers, respectively, and BR7, 9, and 10 are Sequence designed for CI(N) ^wt -CI(N) ^mut1 heterodimer. Using the aforementioned PDf method for detection, as shown in Figure 6b, the sequence BR4 can specifically recognize CI(N) ^wt -CI(N) ^wt homodimer, and the sequence BR6 can specifically recognize CI(N) ^mut1 -CI(N ) ^mut1 homodimer, while the sequence BR10 is more inclined to bind to CI(N) ^wt -CI(N) ^mut1 heterodimer, and the three do not cross each other.

Based on the above results, if you want to detect three pairs of interactions that may exist between protein A and protein B (ie dimerization of AA, dimerization of BB, and dimerization of AB), you can use a CI( In the detection system of N) ^wt -A and CI(N) ^mut1 -B fusion proteins, three different specific DNA sequences of BR4, BR6 and BR10 are used to realize the simultaneous quantitative detection of PDf for the above three pairs of interactions. On the basis of the above-mentioned sequence design and detection methods, optimization (including the binding ability of the DNA binding domain to the corresponding specific DNA sequence and the amount of protein expression) and expansion (the interaction between the DNA binding domain and the specific DNA sequence that do not cross each other) Right), the ability to directly detect protein interaction networks can be extended to a larger scale (schematic diagram shown in Figure 6c).

Claims (10)

1. A method for obtaining information on interactions between proteins, comprising the steps of: (1) expressing a target protein fused with a DNA-binding domain in a host cell, the affinity of the DNA-binding domain to the corresponding specific DNA sequence is significantly higher than that of a monomer when dimerized; (2) Treating with a cross-linking agent under physiological conditions to cross-link the target protein dimer and DNA in the host cell to form a complex; (3) breaking the DNA into small fragments; (4) separate and extract described small fragment, and digest with DNase I; (5) using a decrosslinking agent to decrosslink the product of step (4), and purify to obtain a DNA fragment; (6) Detecting the DNA fragments obtained in step (5). 2. The method according to claim 1, said host cell comprises Escherichia coli, yeast, mammalian cells. 3. The method according to claim 1, wherein said DNA-binding domain comprises the DNA-binding domain of lambda phage protein CI and a mutant that meets the DNA-binding domain properties described in claim 1 step (1), λ The DNA binding domain of phage protein CRO and the mutant that meets the DNA binding domain property described in claim 1 step (1); Described corresponding specific DNA sequence comprises CI binding sequence and their mutated sequence, CRO binding sequence and their mutant sequences. 4. The method according to claim 1, the linking agent used in the step (2) is formaldehyde. 5. The method according to claim 1, using MNase or ultrasonic treatment to break up DNA into small fragments in the step (3). 6. The method according to claim 1, the decrosslinking agent used in the step (5) is proteinase K. 7. The method according to claim 1, the detection in the step (6) comprises qualitative and/or quantitative detection based on nucleic acid sequence, and the quantitative detection comprises quantitative PCR, high-throughput sequencing and/or DNA microarray , said qualitative detection comprises PCR and/or agarose gel electrophoresis. 8. A kit for obtaining protein interaction information, comprising: (1) an expression vector with a DNA binding domain and a corresponding specific DNA sequence, the DNA binding domain has a significantly higher affinity for the corresponding specific DNA sequence when dimerized than when it is monomeric; (2) host cells; (3) Cross-linking agent and its reaction termination solution; (4) Devices or reagents for fragmenting DNA and their reaction buffers; (5) DNase I and its reaction buffer; (6) Removing cross-linking agent; (7) DNA detection device. 9. kit according to claim 8, described cross-linking agent is formaldehyde, and described cross-linking reaction termination liquid is glycine solution, and described de-cross-linking agent is proteinase K, and the reagent of described broken DNA is MNase . 10. test kit according to claim 8, described DNA detection device comprises qualitative and/or quantitative detection device, and described quantitative detection device comprises quantitative PCR device, high-throughput sequencing device or DNA microarray detection device, described Qualitative detection devices include PCR devices or agarose gel electrophoresis devices.