CN104099413A - Hyphantria cunea constant temperature nucleic acid detection kit and detection method thereof - Google Patents

Abstract

The invention discloses a constant temperature detection kit for Hyphantria cunea nucleic acid and a detection method thereof. The kit includes: 1) a DNA detection device; 2) a Hyphantria cunea nucleic acid constant temperature amplification reaction solution; 3) a positive control, which is a DNA fragment containing a Hyphantria cunea mitochondrion COI gene; and 4) a negative control, which is sterile double distilled water. The detection kit provided by the invention has the characteristics of high specificity, high sensitivity and fast reaction speed. From sample treatment to the end of detection on a single sample, only 1-1.5 hours are needed. The kit can meet middle flux and low flux sample detection, is especially suitable for field detection, and the whole reaction process only needs a constant temperature instrument.

Description

Fall webworms constant temperature nucleic acid detection kit and detection method thereof

Technical field

The invention belongs to fall webworms detection technique field, be specifically related to a kind of detection kit and detection method thereof of fall webworms constant temperature nucleic acid.

Background technology

Fall webworms (Hyphantria cunea) (Drury) have another name called U.S. moths attracted by lamplight (Lagoa), are the worldwide quarantine pest insects attracting worldwide attention.Main harm fruit tree, shade tree and ornamental trees, cause serious harm to ornamental trees and shrubs, economic forest, farmland shelter belt etc.Be put at present the first batch of Invasive Alien Species of China.The topmost expansion approach of fall webworms can be propagated by means of the vehicles with goods by each worm state.The chance of propagating with larvas more than 4 ages and pupa is maximum.Saw repeatly in recent years that this worm, with the tr input China by being transported into, should arouse attention abroad.Fall webworms are invaded after China, have lost the control of original natural enemy, and its population density increases rapidly and spreads causes disaster.According to Wu Jian introduction, statistics demonstration, the loss causing to China Forest because of biotic intrusion every year reaches 66,000,000,000.

In order to administer fall webworms, forward the notice of the Ministry of Agriculture, Ministry of Forestry " about the reports of strengthening fall webworms quarantine and preventing and controlling " as far back as the General Office of the State Council in 1981; Within 1984, State Council, the Military Commission of the CPC Central Committee send " about the urgent message of flutterring rapidly the domestic fall webworms in Shaanxi "; North each province and city government has all set up the fall webworms control leading group that is mainly led participation by place, and after the white moth of nineteen ninety-five Tianjin found America, within 1996, Beijing sets up " being strictly on guard against headquarters ", goes to the capital to stop fall webworms.The methods such as the land productivity use such as Xi'an, Xianyang, Jinzhou are artificial, mechanical, chemical have successfully been controlled the harm of fall webworms.

At present, strengthen Plant Quarantine, must strict quarantine to the nursery stock from epidemic-stricken area, scion, flowers, fresh fruit and tr weighting material and the vehicles etc.All must conscientiously check the timber from epidemic-stricken area, nursery stock, fresh fruit, vegetables and nice food case, weighting material and the vehicles.All things considered, lacks actual effectively can application and on-the-spot detection technique fast and effectively.Detection of nucleic acids is a kind of special detection method fast.Although conventional round pcr possesses the features such as quick, sensitive, special, because polluting, laboratory amplified material very easily cause false positive results to limit its widespread use clinically.And import diagnostic reagent is long, expensive owing to purchasing delivery cycle, grass-roots unit is difficult to conventional application.The quantitative fluorescent PCR growing up (Fluorescence Quantitative PCR in recent years, FQ-PCR) technology is highly sensitive with it, speed is fast, the advantages such as high specificity have a wide range of applications in gene test level, but not yet have about fall webworms immue quantitative detection reagent box on domestic market.Although FQ-PCR has easy, fast, sensitive advantage, it detects needs expensive instrument, and easily causes the problems such as false positive.

Summary of the invention

Goal of the invention: for the deficiencies in the prior art, the object of the present invention is to provide a kind of detection kit of fall webworms constant temperature nucleic acid, utilize cross primer nucleic acid constant-temperature amplification and closed nucleic acid amplification thing rapid detection fall webworms.Another object of the present invention is to provide the detection method of mentioned reagent box.

Technical scheme: in order to realize foregoing invention object, the technical solution adopted in the present invention is:

A Constant Temperature Detection test kit for fall webworms nucleic acid, composition comprises:

(1) fall webworms nucleic acid constant-temperature amplification reaction solution;

(2) DNA detection device;

(3) positive control: for containing the DNA fragmentation of fall webworms mitochondrial COI gene;

(4) negative control: be aseptic double-distilled water;

Wherein, consisting of of fall webworms nucleic acid constant-temperature amplification reaction solution: 0.01～0.05 μ mol primer just to the periphery; The reverse peripheral primer of 0.01～0.05 μ mol; The reverse cross primer of 0.01～0.05 μ mol; 0.1～0.5 μ mol forward probe; The reverse probe of 0.1～0.5 μ mol; 3～6mmol MgSO ₄; 0.2～0.4mmol dNTPs solution; 6～10U Gst archaeal dna polymerase; 2 μ L Betaine(5M); 2 μ L 10 × Thermol buffer; Aseptic double-distilled water is supplied 18 μ L;

Primer sequence is just to the periphery: AGCAGGAACTGGATGAACA; Reverse peripheral primer sequence is: GTATGGTAATAGCTCCAGC; Oppositely cross primer sequence is: ATTACTACAATCATTAACATACGATTTTCCTACTGCTCATACGAA; Forward probe is 5 ' end mark Biotin sequence: ATTACTACAATCATTAACATACGATT; Oppositely probe is the sequence of 5 ' end flag F itC: AATTTATCATTTGATCAAATACCT.

Described fall webworms nucleic acid constant-temperature amplification reaction solution, preferred group becomes: 0.03～0.05 μ mol primer just to the periphery; The reverse peripheral primer of 0.03～0.05 μ mol; The reverse cross primer of 0.03～0.05 μ mol; 0.3～0.5 μ mol forward probe; The reverse probe of 0.3～0.5 μ mol; 5～6mmol MgSO ₄; 0.3～0.4mmol dNTPs solution; 8～10U Bst archaeal dna polymerase; 2 μ L 10 × Thermol buffer; Aseptic double-distilled water is supplied 18 μ L.

The composition of described fall webworms nucleic acid constant-temperature amplification reaction solution, then be preferably: 0.05 μ mol primer just to the periphery; The reverse peripheral primer of 0.05 μ mol; The reverse cross primer of 0.05 μ mol; 0.5 μ mol forward probe; The reverse probe of 0.5 μ mol; 6mmol MgSO ₄; 0.4mmol dNTPs solution; 2 μ L Betaine(5M); 10U Gst archaeal dna polymerase; 2 μ L 10 × Thermol buffer; Aseptic double-distilled water is supplied 18 μ L.

The KCl, (NH of 10mM that described 10 × Thermol buffer contains Tris-HCl, 10mM that volumetric molar concentration is 20mM ₄) ₂sO ₄, 2mM MgSO ₄and mass concentration be 0.1% Triton X-100, pH8.8.

Described DNA detection device is full closed target nucleic amplifier fast testing device, and the test strip using is the test strip of surveying for nucleic acid amplification quality testing.

The DNA fragmentation that contains fall webworms mitochondrial COI gene of described positive control, its nucleotide sequence is as shown in SEQ ID NO.6.

A method for the detection fall webworms of the detection kit of described fall webworms nucleic acid, concrete steps are:

A) use conventional DNA extraction method from sample to be detected, to extract DNA sample;

B) step a) is extracted to the DNA sample obtaining and joined in the PCR pipe that isothermal amplification reactions liquid is housed as template, amplified reaction 60～65 minutes at 60～65 DEG C, adds respectively standard positive template and standard negative template in contrast PCR pipe;

C) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid and is detected, sentence read result after 15 minutes.

In step b), amplified reaction 60 minutes at 63 DEG C.

Fall webworms DNA preparation method in fall webworms positive control, comprises the following steps:

(1) utilize two peripheral primers to carry out pcr amplification and obtain goal gene;

(2) pcr amplification product step (1) being obtained carries out purifying;

(3) amplified production after purifying step (2) being obtained builds the complete plasmid sequence that contains goal gene by plasmid transfection test kit;

(4) by the plasmid of institute's extracting quantitatively and be diluted to 10 ⁶copy/μ L ,-20 DEG C of preservations.

Wherein, in step (2), adopt the PCR purification kit of Promega to carry out purifying to pcr amplification product; In step (3), adopt the T-easy plasmid transfection test kit of Promega.

Beneficial effect: compared with prior art, advantage of the present invention is as follows: detection kit specificity of the present invention is high, highly sensitive; Speed of response is fast, and single sample, from sample process to completing detection, only needs 1 ~ 1.5 hour; The sample detection of flux and small throughput in can simultaneously meeting, is particularly suitable for Site Detection and uses, and whole reaction process only needs a thermostatical instrument.

Brief description of the drawings

Fig. 1 is the detection line result figure of test strip;

Fig. 2 utilizes detection kit to detect the experimental result picture of the sensitivity of fall webworms; In figure, sequence number 1-7 is followed successively by 10 ⁴individual bacterium/μ L, 10 ³individual bacterium/μ L, 10 ²individual bacterium/μ L, 10 ¹individual bacterium/μ L, 10 ⁰the bacterium liquid of individual bacterium/μ L, TB positive reference substance (10 ⁴copy/mL), blank.

Embodiment

Below in conjunction with specific embodiment, the present invention is further described.

Composition and the preparation of embodiment 1 detection kit

(1) DNA detection device: the test strip of disclosed nucleic acid membrane chromatographic fast detecting method in CN1811447A, disclosed full closed target nucleic amplifier fast testing device in CN1888902A.

(2) fall webworms nucleic acid constant-temperature amplification reaction solution: two peripheral primers (0.05 μ mol), two probes (0.5 μ mol), and amplification cross primer (0.5 μ mol), 10 × Thermol buffer, MgSO ₄(6mmol), dNTPs solution (0.4mmol), Bst archaeal dna polymerase (10U) and aseptic double-distilled water composition, it is 18 μ L that total reaction liquid amasss.Wherein: the primer sequence just to the periphery of two peripheral primers is 5 '-AGCAGGAACTGGATGAACA-3 ', reverse peripheral primer sequence is 5 '-GTATGGTAATAGCTCCAGC-3 '; Article two, the sequence of probe is respectively: forward 5 ' end Biotin label probe 5 '-biotin-ATTACTACAATCATTAACATACGATT-3 ', reverse 5 ' end marked by fluorescein isothiocyanate probe 5 '-FitC-AATTTATCATTTGATCAAATACCT-3 '; Article one, amplification cross primer is: 5 '-ATTACTACAATCATTAACATACGATTTTCCTACTGCTCATACGAA-3 '.

The composition of 10 × Thermol buffer: 20mM Tris-HCl(pH8.8), 10mM KCl, 10mM(NH ₄) ₂sO ₄, 2mM MgSO ₄, 0.1% Triton X-100.

All primers and probe are synthetic by the Shanghai biological company limited of raw work.

Positive control: fall webworms DNA profiling (for the DNA fragmentation that contains fall webworms mitochondrial COI gene, sequence shown in SEQ ID NO.6).Preparation process: utilize two peripheral primers and carry out pcr amplification with the genomic dna template of fall webworms to obtain goal gene; Pcr amplification product is carried out to purifying with the PCR purification kit of Promega; Amplified production after purifying, by the T-easy plasmid kit of Promega, is built to the plasmid that contains goal gene fragment; With spectrophotometric instrumentation A ₂₈₀quantitatively and be diluted to 10 ⁶copy/μ L ,-20 DEG C of preservations.

Negative control: aseptic double-distilled water.

The test kit of embodiment 2 use embodiment 1 detects the method for fall webworms nucleic acid

Using 16 kinds of Arctiidae insects including fall webworms as supplying test-object originally, these 16 kinds of Arctiidae insects become larva to be all difficult to distinguish with fall webworms in formalness.Originally refer to table 1 for test-object.

Table 1 for test-object originally

1) extraction of the preparation of DNA: DNA adopts GenMagBio zooblast tissue/cell genomic dna magnetic bead extraction test kit to extract.Detailed process is as follows:

Directly clip is put into 2mL test tube for this foot of test-object and chest 30mg, and soaked in absolute ethyl alcohol is preserved sample sterile distilled water and rinsed immersion 4 ~ 5 times, abandons water; Suck dry moisture after exsiccata sterile distilled water immersion 3h.Be placed in 2mL centrifuge tube, in MM400 ball milling instrument, shake and mill (30 times/s) 30s, add 180 μ L Lysis Buffer, 20 μ L Proteinase K, concussion mixes, normal temperature spends the night, 55 DEG C of concussion temperature are bathed 3-5h, and the centrifugal 10min of 12000rpm, gets supernatant, add 200 μ L Binding Buffer and 200 μ L dehydrated alcohols, fully mix, add 20 μ L magnetic beads, softly put upside down and mix 10min.Centrifuge tube is placed in magnetic frame, liquid in pipe is abandoned in suction, retain magnetic bead, Wash Buffer 500uL puts upside down and mixes 2min and be placed in magnetic frame, discard liquid in pipe, the same washed twice of Wash Buffer II, centrifuge tube is still placed on magnetic frame, slowly add Wash Buffer III, after 1min, remove liquid in pipe.Add 20 μ L Elution Buffer, the DNA adsorbing on 55 DEG C of water-bath 10min wash-out magnetic beads, 4 DEG C store for future use.

2) DNA detected sample being extracted joins in the PCR pipe that fall webworms nucleic acid constant-temperature amplification reaction solution is housed as template, carries out amplified reaction 90 minutes at 60 DEG C, wherein specimen dna 4 μ L, reaction solution 16 μ L; In contrast PCR pipe, add respectively positive control template and negative control template.

3) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid and is detected, sentence read result after 15 minutes.As shown in Figure 1, in the time that detected sample is fall webworms, the detection line of test strip is two, is positive, and other samples and negative control detection line are 1, are negative.

Repeatedly repeat to test 3 times, detected result there was no significant difference, illustrates that the detected result between the different batches of this test kit has comparability, has good repeatability.Above-described embodiment explanation, detects reproduciblely with test kit of the present invention, and only need within 2 hours, just can complete to the detection of sample, greatly shortens detection time.This test kit only needs 1 people just can complete all operating process simultaneously, can one of disposable detection arrive hundreds of samples, has so also reduced the waste of manpower.

Embodiment 3

The DNA that extracts the fall webworms of cultivating, carries out quantitatively it, and being diluted to respectively concentration is 10 ⁴copy/μ L, 10 ³copy/μ L, 10 ²copy/μ L, 10 ¹copy/μ L, adopts method described in embodiment 2 to determine the sensitivity of test kit of the present invention for detection of fall webworms nucleic acid.

As shown in Figure 2, in figure, 1-4 represents respectively 10 to result ⁴copy/μ L, 10 ³copy/μ L, 10 ²copy/μ L, 10 ¹copy/μ L, the 5th, negative control, can find that this test kit can detect 10 copies in each reaction system, has very high sensitivity, can meet the requirement (copy is clone unit) of rapid detection fall webworms.

SEQUENCE LISTING

Exotic pests prevention and control technique center, <110> Suzhou City

<120> fall webworms constant temperature nucleic acid detection kit and detection method thereof

<130> 100

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> Artificial

<220>

<223> is primer sequence just to the periphery

<400> 1

agcaggaact ggatgaaca 19

<210> 2

<211> 19

<212> DNA

<213> Artificial

<220>

The reverse peripheral primer sequence of <223>

<400> 2

gtatggtaat agctccagc 19

<210> 3

<211> 26

<212> DNA

<213> Artificial

<220>

<223> forward 5' end Biotin label probe

<400> 3

attactacaa tcattaacat acgatt 26

<210> 4

<211> 24

<212> DNA

<213> Artificial

<220>

The reverse 5' end of <223> marked by fluorescein isothiocyanate probe

<400> 4

aatttatcat ttgatcaaat acct 24

<210> 5

<211> 45

<212> DNA

<213> Artificial

<220>

The <223> cross primer that increases

<400> 5

attactacaa tcattaacat acgattttcc tactgctcat acgaa 45

<210> 6

<211> 261

<212> DNA

<213> Hyphantria cunea

<400> 6

caggaactgg atgaacagtt tatccccccc tttcctctaa tattgctcat ggtggaagat 60

cagttgattt agctattttt tctcttcatt tagcaggaat ttcttcaatt ttaggagcaa 120

ttaattttat tactacaatc attaacatac gattaaataa tttatcattt gatcaaatac 180

ctttattcgt atgagcagta ggaattacag cttttctatt acttctttct cttcctgttt 240

tagctggagc tattaccata c 261

Claims (6)

1. a Constant Temperature Detection test kit for fall webworms nucleic acid, is characterized in that, composition comprises:

(1) fall webworms nucleic acid constant-temperature amplification reaction solution;

(2) DNA detection device;

(3) positive control: for containing the DNA fragmentation of fall webworms mitochondrial COI gene;

(4) negative control: be aseptic double-distilled water;

Wherein, consisting of of fall webworms nucleic acid constant-temperature amplification reaction solution: 0.01～0.05 μ mol primer just to the periphery; The reverse peripheral primer of 0.01～0.05 μ mol; The reverse cross primer of 0.01～0.05 μ mol; 0.1～0.5 μ mol forward probe; The reverse probe of 0.1～0.5 μ mol; 3～6mmol MgSO ₄; 0.2～0.4mmol dNTPs solution; 6～10U Gst archaeal dna polymerase; 2 μ L Betaine(5M); 2 μ L 10 × Thermol buffer; Aseptic double-distilled water is supplied 18 μ L;

Primer sequence is just to the periphery: AGCAGGAACTGGATGAACA; Reverse peripheral primer sequence is: GTATGGTAATAGCTCCAGC; Oppositely cross primer sequence is: ATTACTACAATCATTAACATACGATTTTCCTACTGCTCATACGAA; Forward probe is 5 ' end mark Biotin sequence: ATTACTACAATCATTAACATACGATT; Oppositely probe is the sequence of 5 ' end flag F itC: AATTTATCATTTGATCAAATACCT.

2. the detection kit of fall webworms nucleic acid according to claim 1, is characterized in that: the consisting of of described fall webworms nucleic acid constant-temperature amplification reaction solution: 0.03～0.05 μ mol primer just to the periphery; The reverse peripheral primer of 0.03～0.05 μ mol; The reverse cross primer of 0.03～0.05 μ mol; 0.3～0.5 μ mol forward probe; The reverse probe of 0.3～0.5 μ mol; 5～6mmol MgSO ₄; 0.3～0.4mmol dNTPs solution; 8～10U Bst archaeal dna polymerase; 2 μ L 10 × Thermol buffer; Aseptic double-distilled water is supplied 18 μ L.

3. the detection kit of fall webworms nucleic acid according to claim 1 and 2, is characterized in that: described DNA detection device is full closed target nucleic amplifier fast testing device, and the test strip using is the test strip of surveying for nucleic acid amplification quality testing.

4. the detection kit of fall webworms nucleic acid according to claim 1, is characterized in that: the DNA fragmentation that contains fall webworms mitochondrial COI gene of described positive control, its nucleotide sequence is as shown in SEQ ID NO.6.

5. a method for the detection fall webworms of the detection kit of fall webworms nucleic acid described in claim 1, is characterized in that, concrete steps are:

A) use conventional DNA extraction method from sample to be detected, to extract DNA sample;

B) step a) is extracted to the DNA sample obtaining and joined in the PCR pipe that isothermal amplification reactions liquid is housed as template, amplified reaction 60～65 minutes at 60～65 DEG C, adds respectively standard positive template and standard negative template in contrast PCR pipe;

C) reacted PCR pipe is placed in the anti-pollution proofing unit of nucleic acid and is detected, sentence read result after 15 minutes.

6. the method for the detection fall webworms of the detection kit of fall webworms nucleic acid according to claim 5, is characterized in that, in step b), and amplified reaction 60 minutes at 63 DEG C.