CN104099252A - Cellulose degradation fungus in intestinal tract of dragonfly larva and application thereof - Google Patents
Cellulose degradation fungus in intestinal tract of dragonfly larva and application thereof Download PDFInfo
- Publication number
- CN104099252A CN104099252A CN201410325510.6A CN201410325510A CN104099252A CN 104099252 A CN104099252 A CN 104099252A CN 201410325510 A CN201410325510 A CN 201410325510A CN 104099252 A CN104099252 A CN 104099252A
- Authority
- CN
- China
- Prior art keywords
- qtyc
- trichoderma
- cellulose
- application
- cellulase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses Trichoderma sp. QTYC-44 with the preservation number of CCTCC (China center for type culture collection) NO: M2014267. The invention further discloses an application of the Trichoderma sp. QTYC-44 in production of cellulose, and discloses an application of the Trichoderma sp. QTYC-44 in degradation of biomass such as the cellulose and the like.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of dragonfly larva enteron aisle cellulose degradation new species of fungi Trichoderma sp.QTYC-44 and in production of cellulose enzyme and the application in the biomass degradations such as Mierocrystalline cellulose.
Background technology
Insect fungal component long-term with insect maintenance symbiotic relationship, be the microorganism that a class has special ecological effect.The diversity of insect species and the complicacy of habitat have determined the rich and unique of insect fungal component species, are the important sources of microorganism new species.But such special border microorganism not yet obtains abundant development and utilization.There is following occurrence characteristic as host's insect: (1) kind quantity is many; According to estimates, tellurian insect approximately has 3,000,000 kinds, and the insect of having reported at present has more than 100 ten thousand kinds, accounts for 2/3 of known animal species, and the Known Species of plant only has 1/3 left and right of caste.(2) individual amount is large; Insect not only kind is many, and individual amount of the same race is very surprising, and as one tree can have 100,000 bull aphid individualities, an ant colony can reach more than 50 ten thousand individualities.(3) have a very wide distribution; Insect can inhabit nearly all corner on the earth.It is reported why insect can develop into the natural group that in animal kingdom, quantity is maximum, individual amount is maximum, distribution range is the widest, outside the Pass the strong and mouthpart specialization of this and its reproductivity etc. has, also can help insect digest food and opposing pathogenic bacterium etc. relevant (Zhang et al, 2008) with insect gut bacterium.The diversity of caste, quantity and distribution range means the diversity of insect gut bacterium.These a large amount of insect gut bacterium are important sources of microorganism novel species, in 650 bacterial strains identifying as Suh etc., have that to exceed 200 be novel species from beetle enteron aisle, in 25 kinds of fungies that White etc. identify from aquatic insect enteron aisle, have that to exceed 9 be novel species, one of them is gen et sp nov, and these novel species may be new microbe resource important sources.Although have a lot about the research report of cellulose degradation strain both at home and abroad, but it is little that the research that derives from the cellulose degradation microorganism of insect gut bacterium is reported, therefore should strengthen excavation and the utilization to biomass resources such as cellulose degradation microorganisms in insect gut bacterium.
Along with environmental problem becomes increasingly conspicuous, the biological degradation to organic pollutants such as stalk, municipal wastes, plastics, Mierocrystalline cellulose, petroleum resources, organic pesticide and utilization are studied, and have become the key character target of social sustainable development.United States Government is the target that oneself has specified necessary realization by legislation form: within 2022, will produce 36,000,000,000 gallons of recyclable fuels, wherein about half will lean on cellulosic ethanol; The year two thousand thirty substitutes 30% liquid fossil fuel with recyclable fuel.For realizing above-mentioned target, United States Government has strengthened corresponding dynamics of investment: within 2007, announce more than 10 hundred million dollars of investments, comprise: drop into 3.75 hundred million dollars and set up 3 bioenergy research centres simultaneously, attract First-class University and research institution to participate in relevant fundamental research, simultaneously, invest 3.85 hundred million dollars, attract 1: 2 coupling of enterprise, 1,200,000,000 dollars of gross investments, the biological refinery of Mierocrystalline cellulose construction for 6 more than ton, (side brags to wish to utilize the superpower status of developing new forms of energy and keeping oneself, Deng. the progress that cellulase and lignocellulose biological degradation transform. biotechnology journal, 2010, 26 (7): 864-869.).China is large agricultural country, can produce every year a large amount of stalk celluloses, but is mainly to utilize by simply burning mode of tradition, and energy utilization rate is extremely low, and environmental pollution is larger.How to utilize efficiently cellulose resource to become the important issue that concerns national energy security.Because microorganism is in the unique advantage aspect cellulose utilization, find new cellulose utilization bacterial classification and exploitation High Cellulase Production bacterial classification, be the efficient key of utilizing of cellulose resource.
The people such as Zeng Hualan reported that tangerine green trichoderma (Trichoderma citrinoviride) had good preventive effect to red sage root maize ear rot, can be used for preventing and treating red sage root maize ear rot, but its cellulase-producing activity is not studied to (Zeng Hualan, Deng. utilize the research of wooden mould control red sage root maize ear rot. Sichuan Agricultural University's journal, 2003,21 (2): 142-144.).
Summary of the invention
The technical problem to be solved in the present invention is to provide one new species of fungi---wooden mould Trichoderma sp.QTYC-44 and uses thereof that filter out, that have higher cellulose degradation activity from yellow dragonfly (Pantala flavescen) larva enteron aisle.
In order to solve the problems of the technologies described above, the invention provides a kind of wooden mould Trichoderma sp.QTYC-44, its preserving number is CCTCC NO:M2014267.
The present invention also provides the application of the mould Trichoderma sp.QTYC-44 of above-mentioned wood in cellulase-producing simultaneously.
The present invention also provides the application of the mould Trichoderma sp.QTYC-44 of above-mentioned wood in biomass degradation simultaneously.
The improvement of the application as the mould Trichoderma sp.QTYC-44 of wood of the present invention in biomass degradation: described biomass are Mierocrystalline cellulose.
This bacterium is preserved in Chinese Typical Representative culture collection center, address: Wuhan, China Wuhan University, preservation title Trichoderma sp.QTYC-44, deposit number: CCTCC NO:M2014267, preservation date on June 17th, 2014.
Cellulose degradation new species of fungi in yellow dragonfly larva enteron aisle of the present invention: wooden mould Trichoderma sp.QTYC-44 is the bacterium filtering out in a kind of yellow dragonfly (Pantala flavescen) larva enteron aisle.
Bacterial classification is described: on MA (wort agar) substratum, colony growth is very fast, and lower 3 days colony diameter 60-65mm of 28 DEG C of dark conditions, near the visible white conidium bunch of part of colony edge.Conidium bunch arrangement is comparatively sparse, does not produce diffustivity pigment, there is no obvious smell.Conidiophore directly produces bottle stalk or produces second branch, and second branch tends to life.Conidium ellipse, light green, wall is smooth.This bacterial strain can be grown in the test tube taking Xinhua's filter paper as sole carbon source, and obvious disintegration occurred filter paper in 5 days, be better than the green wooden enzyme of Chinese DSMZ (Wuhan University) cellulase-producing reference culture (being numbered AF93255) under equal conditions.Show to there is higher biomass degradation activity.
Extract genomic dna according to ordinary method from the pure growth of the mould Trichoderma sp.QTYC-44 of wood, use the specific primer I TS1/ITS4 of rDNA the Internal Transcribed Spacer (ITS) sequence, obtain ITS sequence by pcr amplification and sequencing analysis.
In GenBank database, choose the part representative gene order higher with measuring sequence similarity, with Neibor-joining method constructing system evolutionary tree (seeing Fig. 3), carry out Phylogenetic Analysis by Clustal-X software and Mega software.Can find out wooden mould Trichoderma sp.QTYC-44 and known fungi tangerine green trichoderma (Trichoderma citrinoviride) from phylogenetic tree) there is larger otherness.Its rDNA the Internal Transcribed Spacer (ITS) sequence reaches 723bp, its BLAST sequence alignment fraction of coverage approximately only has 76%, and Trichoderma citrinoviride (HM776434.1) sequence similarity nearer with its sibship only has 95%.In conjunction with its morphological feature, we determine that it is a fungal strain novel species, are classified to Hypocreaceae (Hypocreaceae), the mould Trichoderma sp.QTYC-44 of called after wood.This bacterium is preserved in Chinese Typical Representative culture collection center (CCTCC), address: Wuhan, China Wuhan University, preservation title Trichoderma sp.QTYC-44, deposit number: CCTCC NO:M2014267, preservation date on June 17th, 2014.
Cellulase activity (CMC enzyme is lived) research to the mould Trichoderma sp.QTYC-44 of bacterial strain of the present invention wood shows: wooden mould Trichoderma sp.QTYC-44 is liquid fermenting under 28 DEG C, pH7.0 condition, and the cellulase activity of fermented liquid reaches 1654.6U/mL in the work of 6d secondary fermentation juice cellulase.Carry out Xinhua's filter paper Degrading experiment with the bacterium liquid formulation that contains wooden mould Trichoderma sp.QTYC-44 simultaneously.Result shows: through the degraded place Xinhua filter paper disintegration completely of 5 days, illustrate that thus wooden mould Trichoderma sp.QTYC-44 has the biomass degradation activity such as good Mierocrystalline cellulose.Therefore second object of the present invention is to provide the application of wooden mould Trichoderma sp.QTYC-44 in cellulase-producing.
In sum, the invention provides a kind of new species of fungi: wooden mould Trichoderma sp.QTYC-44, this bacterium has cellulase-producing activity, can be used for production of cellulose enzyme, and therefore the production to cellulase and utilization have important value.Bacterial strain provided by the invention has good inulinase-producing activity and can be applicable to production of cellulose enzyme.
Brief description of the drawings
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is Trichoderma sp.QTYC-44 bacterium colony growing state on solid malt extract medium;
Fig. 2 is Trichoderma sp.QTYC-44 conidiophore picture;
Fig. 3 is Trichoderma sp.QTYC-44 site plan in the unrooted phylogenetic tree of rDNA the Internal Transcribed Spacer (ITS);
Fig. 4 is through Trichoderma sp.QTYC-445 days degraded place Xinhua filter paper disintegration degree;
The test tube of 1-4 is from left to right blank group (not connecing bacterium); The test tube of 5-10 is from left to right sp.QTYC-445 days degraded place Xinhua filter paper disintegration degree pictorial diagram of inoculation Trichoderma.
Embodiment
Below in conjunction with specific embodiment, the present invention will be further explained.
The separation screening of embodiment 1, bacterial strain
Pick up near river, Zhejiang Normal University campus for the yellow dragonfly larva of examination.By 75% (volume %) alcohol surface sterilization 2min for yellow health dragonfly larva, aseptic water washing 3 times, the enteron aisle obtaining after dissection is put to aseptic mortar and is ground, and lapping liquid gradient dilution is become to 10 with sterilized water
-1, 10
-2, 10
-3, get respectively each gradient dilution liquid 0.2mL and coat on MEA substratum (formula: Fructus Hordei Germinatus 20g, sucrose 20g, agar 20g, peptone 1g, distilled water is settled to 1L, pH7.0) flat board, in 28 DEG C of thermostat containers, cultivate.After bacterium colony grows, from a small amount of mycelia of colony edge picking, again transfer on MEA culture medium flat plate, obtain therefrom a strain bacterial strain pure growth, called after QTYC-44, be stored in storage medium (formula is: Fructus Hordei Germinatus 20g, sucrose 20g, agar 20g, peptone 1g, distilled water 1L, pH7.0,120 DEG C of sterilizing 20min).
The qualification of embodiment 2, fungi QTYC-44
1, Morphological Identification
The morphology preliminary evaluation of bacterial strain is according to " partly knowing fungi identification handbook ".As shown in Figure 1, on MA (wort agar) substratum, colony growth is very fast, and lower 3 days colony diameter 60-65mm of 28 DEG C of dark conditions, near the visible white conidium bunch of part of colony edge.Conidium bunch is arranged fine and close, does not produce diffustivity pigment, there is no obvious smell.Conidiophore directly produces bottle stalk or produces second branch, and second branch tends to life.Conidium ellipse, light green, wall is smooth.This bacterial strain can be grown in the test tube taking Xinhua's filter paper as sole carbon source, and obvious disintegration occurred filter paper in 5 days, shows to have higher biomass degradation activity.
2, bacterial strain molecular biology identification
The DNA extraction of bacterial strain, the sequential analysis of pcr amplification and amplified production: using the new fresh thalli of cultivating 4d as DNA extraction material, adopt novel quick-speed plant genome DNA extracting reagent kit (Beijing hundred Tyke Bioisystech Co., Ltd) to extract strain gene group DNA, 1% agarose gel electrophoresis detects purity.Taking the genomic dna of said extracted as template, with primer I TS1 (forward): ITS1 (5-'TCCGTAGGT GAACCTGCG G-3'), ITS4 (reverse): ITS4 (5-'TCCTCCGCTTATTGATATGC-3') carries out pcr amplification to the ITS region of strains tested rDNA.Reaction solution volume 50 μ L, comprising: 38.8 μ L ddH
2o, 4.0 μ L10 × PCRbuffer, 4.0 μ L d NTPs, the each 1.0 μ L of ITS1, ITS4, strain gene group template 1.0 μ L, 0.2 μ L Taq archaeal dna polymerase.PCR response procedures: 94 DEG C of denaturation 2min; 94 DEG C of sex change 1min, 55 DEG C of renaturation 1min, 72 DEG C are extended 1min, carry out 35 circulations; Last 72 DEG C are extended 5min, 16 DEG C of preservations.PCR product is surveyed its purity with 2% sepharose.Pcr amplification product is delivered to afterwards after testing Shanghai Sheng Gong biotechnology company limited and is checked order, and sequencing primer is ITS1.
Sequencing result is as follows:
GGGCCTCGAGTTAACTCCAAACCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCCTACGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCCCCCCCGAAATACGATGGCGGTTTCGCCCCACCCTCGCCTGCATGGTAGTTTGCACACTCGAACCGGCCGGCGCGGACGACCACGCCCAGGAAACACCCCGAACTCGGAAATGTTGACCTCGGAAGTGGTAAGAACGCCGATGATCCTTCCGCAGTCGCTAACAGAGGGACTAGTACCGAGTGTGCATATCCCAAACAAAAGGTGAACGTTACAATCTGTTGCTCGTCGGGATTCTCTGCCCGGGCGCGACACACCCGGTATCCAGGAGGCGTGAAAGACAAATCAACCT
In GenBank database, choose the part representative gene order higher with measuring sequence similarity, with Neibor-joining method constructing system evolutionary tree (seeing Fig. 3), carry out Phylogenetic Analysis by Clustalx1.83 software and MEGA5.0 software.Can find out that from phylogenetic tree wooden mould Trichoderma sp.QTYC-44 and known fungi have larger otherness.Its rDNA the Internal Transcribed Spacer (ITS) sequence reaches 723bp, its BLAST sequence alignment fraction of coverage approximately only has 76%, and Trichoderma citrinoviride (HM776434.1) sequence similarity nearer with its sibship only has 95%.In conjunction with its morphological feature, we determine that it is a fungal strain novel species, are classified to Hypocreaceae (Hypocreaceae), the mould Trichoderma sp.QTYC-44 of called after wood.
This bacterium is preserved in to Chinese Typical Representative culture collection center (CCTCC), address: Wuhan, China Wuhan University, preservation title Trichoderma sp.QTYC-44, deposit number: CCTCC NO:M2014267, preservation date on June 17th, 2014.
The mensuration of embodiment 3, cellulase activity (CMC enzyme is lived)
The 6 mould Trichoderma sp.QTYC-44 of wood bacterium cakes (diameter is 6mm) are inoculated in to 250ml fermention medium (formula: Fructus Hordei Germinatus 20g, sucrose 20g, peptone 1g, distilled water 1L, pH7.0,120 DEG C of sterilizing 20min) in, under 28 DEG C, pH7.0 condition, fermentation 6d, the fermented liquid taking a morsel is measured the cellulase activity of fermented liquid.Fermented liquid is through the centrifugal 20min of 4500r/min, and supernatant liquor is as crude enzyme liquid.Get 4 test tubes, 1 arm is made blank, 3 arms are made Duplicate Samples QC, in every sample hose, add the thick enzyme solution of 1mL, be placed in 50 DEG C of water-bath preheating 2min, then (preparation method of substrate solution is: accurately take 0.625g sodium carboxymethyl-cellulose in 3 test tubes, to add respectively 4mL to be preheated to the substrate solution of 50 DEG C, be dissolved in 100mL sodium acetate buffer solution (0.2mol/L, pH value is 4.6), heated and stirred makes it to dissolve), in water-bath, heat 30min, (preparation method of DNS nitrite ion is: weigh 90.996g Seignette salt and be dissolved in 250mL distilled water in vitro to add 1.5mL DNS nitrite ion toward 4, heating, add while hot 3 of 3.1565g, 5-dinitrosalicylic acid (DNS), another preparation 2mol/LNaOH solution, getting 131ml adds in above-mentioned solution, weighing 2.564g phenol and 2.532g sodium sulphite anhydrous 99.3 moves in the solution configuring, distilled water is settled to 500mL), shake up be placed in boiling water bath, heat 5min after flowing water cooling, distilled water is settled to 25mL, under 520nm, measure the OD value of each pipe, contrast glucose typical curve, draw reducing sugar content.Under this condition, every 30min produces the required enzyme amount of 1 μ g reducing sugar and is defined as 1 enzyme activity unit (U/mL).Experimental result shows that the work of wooden mould Trichoderma sp.QTYC-44 fermentation 6d secondary fermentation juice cellulase reaches 1654.6U/mL.Show that thus the mould Trichoderma sp.QTYC-44 of wood of the present invention has cellulase-producing activity.
Embodiment 4, the test of cellulose biomass degrading activity
Mould wood Trichoderma sp.QTYC-44 is inoculated on solid PDA flat board, waits bacterium colony to grow to after a certain size to get three pure culture biscuits involvng inoculations with 6cm punch tool to be inoculated into respectively that in the Xinhua's filter paper degradation experiment substratum that contains 5mL, (preparation method is: filter paper bar substratum: (NH
4)
2sO
41g, KH
2pO
41g, MgSO47H
2o0.7g, NaCl0.5g, adds water to 1000mL.Each test tube packing 5mL filter paper bar substratum, places 6cm × 1cm Xinhua quantitative filter paper article, 120 DEG C of sterilizing 20min), 28 DEG C, 180r/min shakes training 5d, the complete disintegration of Xinhua's filter paper.
Contrast experiment 1:
Replace the mould Trichoderma sp.QTYC-44 of above-mentioned wood with the green wooden enzyme of Chinese DSMZ (Wuhan University) cellulase-producing reference culture (being numbered AF93255), detect according to above-described embodiment 3 and embodiment 4, result is: while shaking training 5d, Xinhua's filter paper disintegration is 89%.When shaking training 6d, Xinhua's filter paper is disintegration completely.The work of fermentation 6d secondary fermentation juice cellulase reaches 1575.2U/mL.
, under equal conditions, the mould Trichoderma sp.QTYC-44 of wood of the present invention bacterial strain has the biomass degradation activity such as good Mierocrystalline cellulose with respect to AF93255.
Contrast experiment 2,
Contrast experiment, detects tangerine green trichoderma according to method described in above-described embodiment 3, embodiment 4, acquired results is respectively: after fermentation 6d, tangerine green trichoderma fermented liquid cellulase activity reaches 654.6U/mL; Tangerine green trichoderma shakes training 8d, and Xinhua's filter paper is disintegration completely.
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
Claims (4)
1. wooden mould Trichoderma sp.QTYC-44, is characterized in that: preserving number is CCTCC NO:M2014267.
2. the application of the mould Trichoderma sp.QTYC-44 of wood according to claim 1 in cellulase-producing.
3. the application of the mould Trichoderma sp.QTYC-44 of wood according to claim 1 in biomass degradation.
4. the application of the mould Trichoderma sp.QTYC-44 of wood according to claim 3 in biomass degradation, is characterized in that: described biomass are Mierocrystalline cellulose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410325510.6A CN104099252B (en) | 2014-07-09 | 2014-07-09 | Dragonfly larva enteron aisle cellulose degradation fungi and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410325510.6A CN104099252B (en) | 2014-07-09 | 2014-07-09 | Dragonfly larva enteron aisle cellulose degradation fungi and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104099252A true CN104099252A (en) | 2014-10-15 |
| CN104099252B CN104099252B (en) | 2016-04-13 |
Family
ID=51667798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410325510.6A Expired - Fee Related CN104099252B (en) | 2014-07-09 | 2014-07-09 | Dragonfly larva enteron aisle cellulose degradation fungi and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104099252B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113308380A (en) * | 2021-04-21 | 2021-08-27 | 安徽农业大学 | Antibacterial activity of trichoderma aureoviride and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131639A (en) * | 2011-11-23 | 2013-06-05 | 中国农业科学院作物科学研究所 | Trichoderma longibrachiatum strain and application thereof |
-
2014
- 2014-07-09 CN CN201410325510.6A patent/CN104099252B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131639A (en) * | 2011-11-23 | 2013-06-05 | 中国农业科学院作物科学研究所 | Trichoderma longibrachiatum strain and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| MAURICIO H ET AL: "Culture and manipulation of insect facultative symbionts", 《TRENDS IN MICROBIOLOGY》 * |
| 阮周波 等: "纤维素酶产生菌的筛选、鉴定和产酶条件优化", 《湖北农业科学》 * |
| 马如箭 等: "家蚕肠道纤维素酶菌株的筛选及产酶条件的优化研究", 《基因组学与应用生物学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113308380A (en) * | 2021-04-21 | 2021-08-27 | 安徽农业大学 | Antibacterial activity of trichoderma aureoviride and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104099252B (en) | 2016-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102369272A (en) | Compositions and methods for degrading lignocellulosic biomass | |
| CN105670958A (en) | Low-temperature biocontrol bacterial strain and application thereof | |
| CN103436450A (en) | Alkaline-tolerant and halophilic aspergillus strain and application thereof in environmental management | |
| Li et al. | A new species of Epichloë symbiotic with Chinese grasses | |
| CN104560816A (en) | Bacillus licheniformis with biomass hydrolase activity and application thereof | |
| CN108913604A (en) | A kind of screening technique of the effectively hydrolyzing bacterial strain of spirit distiller grain | |
| CN102559508B (en) | Trichodermaviride used for producing cellulose degrading enzyme and its application in urban landscaping waste degradation | |
| Zhang et al. | Microdochium paspali, a new species causing seashore paspalum disease in southern China | |
| CN108570433A (en) | One plant of acid proof defence pseudomonad CLP-6 and its application | |
| CN104893996A (en) | Method for producing kelp alcohol beverage by using efficient kelp degradation strain | |
| CN105368866A (en) | Application of improved ATMT (Agrobacterium Tumefaciens-Mediated Transformation) to construction of trichoderma atroviride T23 deltaCrel | |
| CN102363748B (en) | New fungus Acremonium sp. DPZ-SYz-2-3 for high efficiency cellulose degradation and application thereof | |
| CN104195050A (en) | Lecanicillium attenuatum and application of lecanicillium attenuatum to control of crop nematodes and bemisia tabaci | |
| CN103305496A (en) | Method for extracting chondrosulphatase through microbe fermentation | |
| Davey et al. | Saprobic and parasitic interactions of Coniochaeta velutina with mosses | |
| CN104560732B (en) | It is a kind of can the rainbow conk keyhole bacterium of high-efficiency pretreatment lignin raw material and its application in the basic conditions | |
| CN109112072A (en) | A kind of Trichoderma is promoting the application in plant growth | |
| CN106635885B (en) | A kind of entomopathogenic nematode symbiotic bacteria and its application | |
| CN104860401A (en) | Application of Rhizopus oryzae strain JHSW01 to the fermentation of organic waste liquid and forestry and agricultural waste | |
| CN104099252B (en) | Dragonfly larva enteron aisle cellulose degradation fungi and application thereof | |
| CN104560817A (en) | Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102 | |
| CN106434488A (en) | Entomopathogenic nematode symbiotic bacteria with soybean phytophthora root rot inhibiting function and application | |
| CN110499254A (en) | A kind of salt resistance alkali Aspergillus ochraceus bacterial strain W1 and its microbial inoculum and application | |
| CN104726388A (en) | Pullulanase enzyme-producing strain and method for improving enzyme-producing capacity thereof | |
| CN110527634A (en) | One plant of Tibet source produces trichoderma harzianum strain and its application of cellulase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160413 Termination date: 20170709 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |