CN104073449A - Fast-fermenting bread yeast strain and construction method thereof - Google Patents

Fast-fermenting bread yeast strain and construction method thereof Download PDF

Info

Publication number
CN104073449A
CN104073449A CN201410333534.6A CN201410333534A CN104073449A CN 104073449 A CN104073449 A CN 104073449A CN 201410333534 A CN201410333534 A CN 201410333534A CN 104073449 A CN104073449 A CN 104073449A
Authority
CN
China
Prior art keywords
strain
yeast
bacterial strain
gene
pgm2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410333534.6A
Other languages
Chinese (zh)
Other versions
CN104073449B (en
Inventor
张翠英
肖冬光
林雪
董健
柏晓雯
宋海岩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN201410333534.6A priority Critical patent/CN104073449B/en
Publication of CN104073449A publication Critical patent/CN104073449A/en
Application granted granted Critical
Publication of CN104073449B publication Critical patent/CN104073449B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Bakery Products And Manufacturing Methods Therefor (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a fast-fermenting bread yeast strain and a construction method thereof, and belongs to the technical field of a bioengineering technology. The construction method comprises the following steps: knocking out phosphoglucomutase genes PGM2 completely in the parent bread yeast strain; meanwhile, choosing a strong promoter PGK1 to over-express the complete sequence of H/ACA small nucleolus RNA (SNR84) to acquire the fast-fermenting yeast strain. The CO2 gas production of the fast-fermenting bread yeast strain in a non-sugaring paste for 1 hour reaches to 818mL; compared with the parent strain, the CO2 gas production is improved by 21.2% (the CO2 gas production of the parent strain fermenting in the non-sugaring paste for 1 hour reaches to 675mL); meanwhile, the fermenting time is shortened by 18.0%. The bread yeast strain has a good fermentability during fermenting in the non-sugaring paste, so that the requirement for the 'fast' yeast in a cooked wheaten food processing market is met. Therefore, the bread yeast strain has an extensive application prospect.

Description

One strain accelerated fermentation baker's yeast bacterial strain and construction process thereof
Technical field:
The invention belongs to technical field of bioengineering, relate to the breeding of industrial microorganism, especially strain accelerated fermentation baker's yeast and a construction process thereof.
Background technology:
Now, wheaten food is of all shapes and colors, and making method is also varied, but no matter taking which kind of making method, the fermenting process of dough is all the important step in whole technique, it directly affects the quality of food made from wheat.The developed country such as American-European considers that health factor generally take salty bread as staple food, and bread is commonly not sugaring or low sugar (sugaring amount is lower than 6%).China is populous, wherein has the population of half left and right to take wheaten food as main, and is mostly the plain doughs such as steamed bun fermentation class wheaten food, and the north approximately has 70% whole meal flour to be used for making steamed bun according to statistics.
The essence of panary fermentation is that flour is under the effect of various enzymes, various disaccharide and polysaccharide are converted into fermentable monose, fermentative action through yeast changes into carbonic acid gas again, makes dough expand and generate other fermented material, makes bread increase the process of local flavor, dough maturity.Panary fermentation ability is to weigh the important indicator of baker's yeast product quality.Good dough works the ability of sending out can shorten the panary fermentation cycle greatly, thereby increases economic efficiency.
In plain doughs, topmost fermentable sugars is maltose.Maltose is transported to and in cell, through maltin, is hydrolyzed to two glucose molecules and enters glycolytic pathway through maltose permease, for cell utilization.G6P is first intermediate of glycolytic cycle, is proceeding various chemical reactions generation CO 2and H 2o, when releasing energy, by phosphoglucomutase (PGM2), change into Cori's eater Cori glycogen biosynthesis, reduce the flux of glycolytic pathway.Therefore, knock out phosphoglucomutase encoding gene PGM2, blocking-up G6P, to the conversion of Cori's eater Cori, can increase the flux of glycolytic pathway, improves CO under aerobic conditions 2output, thereby improve Dough fermentation ability.
SNR84 genes encoding H/ACA snoRNA (little nucleolar RNA).The little nucleolar RNA of most of H/ACA participates in base modification, as the pseudouridine of large subunit rRNA, specifies the formation site of pseudouridine in rRNA; The little nucleolar RNA of small portion H/ACA also plays an important role in shearing pre-rRNA.By inference, SNR84 participates in the function that activates large subunit rRNA pseudouridine, accelerates the ripe speed of large subunit rRNA and the quantity of the large subunit rRNA of raising.When the large subunit rRNA of maturation is when form exponential phase of growth fast, the productive rate of most of relevant enzyme improves.Lee etc. be take semi-lactosi as carbon source, express SNR84 gene improved growth and the alcohol output of yeast saccharomyces cerevisiae in semi-lactosi by mistake.
At present, a lot of research is by improving maltose accretion rate to the transformation of the directly related gene of maltose pathways metabolism, thereby raising Dough fermentation ability, to the transformation of maltose pathways metabolism indirect correlation gene or less to the report of unknown maltose metabolism network adjusting, simultaneously, the at present research for the little nucleolar RNA of H/ACA concentrates on theoretical investigation substantially, about the application of the little nucleolar RNA of H/ACA, only has minority report, and especially the research in seed selection quick fermentation bacterial strain is blank especially.Therefore, the present invention, by knocking out the phosphoglucomutase gene of PGM2 coding completely, crosses the H/ACAsnoRNA that expresses SNR84 genes encoding simultaneously, and seed selection accelerated fermentation baker's yeast bacterial strain, meets the high requirement of yeast application association area to yeast.
Summary of the invention:
One of technical problem solved by the invention is to provide a strain accelerated fermentation baker's yeast bacterial strain.
Described accelerated fermentation baker's yeast bacterial strain is the phosphoglucomutase that knocks out PGM2 coding in the yeast strain that sets out completely, crosses the little nucleolar RNA complete sequence of the H/ACA gained of expressing by SNR84 genes encoding simultaneously.
Its Gene ID of described PGM2 gene is: 855131, and sequence is as shown in SEQ NO:1 in nucleotides sequence list; Its Gene ID of described SNR84 gene is: 9164879, and sequence is as shown in SEQ NO:2 in nucleotides sequence list.
Preferably, the yeast strain that sets out described in is bread yeast (Saccharomyces cerevisiae) CICC31616.
Another technical problem solved by the invention is to provide a kind of construction process of accelerated fermentation baker's yeast bacterial strain, comprises the steps:
(1) PGM2 gene knocks out
1. take plasmid pUC6 as template, pcr amplification KanMX gene;
2. the PCR product of step (1)-1. obtain is imported and set out in yeast strain, obtain KanMX and substitute the recombinant bacterial strain 1 that knocks out PGM2;
3. use pGAP plasmid removing step (1)-2. the obtain KanMX gene in bacterial strain, obtain the recombinant bacterial strain 2 that knocks out PGM2 completely;
(2) crossing of SNR84 gene expressed
1. the total DNA of bread yeast CICC31616 of take is template, pcr amplification SNR84 gene;
2. the PCR product of step (2)-1. obtain is connected on the plasmid that contains PGK1 strong promoter, obtains expression plasmid 1;
3. take expression plasmid 1 as template, by pcr amplification, obtain the junction fragment of SNR84 gene and strong promoter;
4. the fragment of step (2)-3. acquisition is connected on the carrier with KanMX resistance, obtains expression plasmid 2;
5. the expression plasmid of step (2)-4. acquisition 2 is imported in recombinant bacterial strains 2, acquisition knocks out PGM2 completely and crosses the recombinant bacterial strain of expressing SNR84 simultaneously.
The preferred pUC plasmid of the described plasmid that contains PGK1 strong promoter;
The preferred Yep352 carrier of the described carrier with KanMX resistance;
Preferably, the yeast strain that sets out described in is bread yeast (Saccharomyces cerevisiae) CICC31616.
Described bread yeast (Saccharomyces cerevisiae) CICC31616, is the bacterial strain that a strain is stored in Chinese industrial microbial strains preservation administrative center, and the public can obtain by purchase.
Described recombinant bacterial strain can build by aforesaid method, also can obtain with other molecular biology methods.These methods have many bibliographical informations, as Joseph Sambrook etc., < < molecular cloning experiment guide > > second edition, Science Press, 1995.
Bread yeast recombinant bacterial strain of the present invention, its aerogenesis per hour in plain doughs fermentation improves 21.2% compared with parent strain, and fermentation time shortens 18.0%.
Beneficial effect:
1, the invention provides a kind of accelerated fermentation baker's yeast, met the demand of wheaten food processing market to " fast " yeast.
2, accelerated fermentation baker's yeast provided by the invention is to keep under the prerequisite of good basic leavening property, shows higher dough and works the ability of sending out, thereby shorten fermentation time in plain doughs fermentation, increases economic efficiency.
3, accelerated fermentation baker's yeast bacterial strain of the present invention is by knocking out the phosphoglucomutase of PGM2 coding completely, cross the little nucleolar RNA complete sequence of the H/ACA gained of expressing by SNR84 genes encoding simultaneously, to the creatively using of phosphoglucomutase and the little nucleolar RNA of H/ACA, for new field has been opened up in its theoretical investigation and applied research.
4, the bacterial strain that seed selection obtains does not have particular requirement to fermentation equipment and condition, and equipment and the condition of general factory all can be used, thereby have wide practical use, and will drive the development of China's bakery product industry, steamed bun industry and retail trade.
Accompanying drawing explanation:
Fig. 1 is Yep-KPS plasmid construction process;
Fig. 2 is the PCR checking of expression plasmid Yep-KPS
Wherein: (a), M is marker; 1 for take Yep-KPS as template, pcr amplification SNR84 fragment
(b) in, M is marker; 1 for take Yep-KPS as template, pcr amplified fragment PS;
Fig. 3 is the checking that knocks out PGM2 recombinant bacterial strain
Wherein: M is marker; 1 is template for take the genome of recombinant bacterial strain 2, pcr amplification PGM2 fragment; 2 is template for take the bacterium CICC31616 genome that sets out, pcr amplification PGM2 fragment; 3 is template for take the genome of recombinant bacterial strain 2, pcr amplification KanMX fragment; 4 is template for take the genome of recombinant bacterial strain 1, pcr amplification KanMX fragment
Fig. 4 crosses for completely knocking out in the recombinant bacterial strain of PGM2 the checking of expressing SNR84 gene
Wherein: M is marker; 1 in order take, to knock out PGM2 completely and cross the yeast plasmid express SNR84 gene recombination bacterial strain be template, pcr amplification PS fragment; 2 is template for take the bacterium CICC31616 yeast plasmid that sets out, pcr amplification PS fragment.
Embodiment:
Below by specific embodiment narration a kind of accelerated fermentation baker's yeast bacterial strain of the present invention and selection thereof.Method in following embodiment, if no special instructions, is ordinary method.
Embodiment 1: the structure of accelerated fermentation baker's yeast bacterial strain
(1) structure of expression plasmid Yep-KPS
The structure flow process of expression plasmid Yep-KPS as shown in Figure 1;
The total DNA of yeast strain CICC31616 of take is template, pcr amplification SNR84 gene complete sequence, and reaction system is in Table 1:
Upstream primer: 5 '-GGA aGATCTaTTGCACAACTTAAGTTTGTCGAGG-3 ' (SEQ ID NO:3);
Downstream primer: 5 '-GGA aGATCTtAATGTGTCTCTTTGAGTCATGTTCCTT-3 ' (SEQ ID NO:4); Line part is restriction enzyme site;
The pcr amplification of table 1 SNR84 gene
PCR product is connected on the pUC-PGK1 carrier that contains strong promoter, obtains pUC-PGKS; Take pUC-PGKS as template, and pcr amplification obtains inserting the PGK of SNR84 gene p-SNR84-PGK t(PS) fragment, reaction system is in Table 2;
Fragment PS is connected on the Yep352-K carrier with KanMX resistance, obtains expression plasmid Yep-KPS:
Upstream primer: 5 '-CCC aAGCTTtCTAACTGATCTATCCAAAACTGA-3 ' (SEQ ID NO:5);
Downstream primer: 5 '-CCC aAGCTTtAACGAACGCAGAATTTTC-3 ' (SEQ ID NO:6);
Line part is restriction enzyme site;
The pcr amplification of table 2 fragment PS
PCR the result as shown in Figure 2.
(2) knock out PGM2 strain construction completely
Take plasmid pUC6 as template, pcr amplification KanMX gene, reaction system is in Table 3;
Upstream primer:
5’-AACAATAGGATAATAAGAAGAAGATCAACCAATCTTTCTCAGTAAAAAAAGTAACAAAAGTTAACATAAC?CAGCTGAAGCTTCGTACGC-3’(SEQ?ID?NO:7)；
Downstream primer:
5’-TTCTTCTTTACCGTTAATATTCATTGAAAAAGGTGAAAATCATTAAGCCATTAGTAAATCATTCGTTGCATAGGCCA?CTAGTGGATCTG?-3’(SEQ?ID?NO:8)；
The pcr amplification of table 3 KanMX
The method transforming by Lithium Acetate imports bread yeast starting strain CICC31616 by PCR product and obtains recombinant bacterial strain 1, by G418 resistance screening recon, carry out PCR checking, the genome of recombinant bacterial strain 1 of take is template amplification PGM2 fragment, cannot obtain the band of 1700bp left and right, starting strain can increase and obtain this fragment, and PCR the result as shown in Figure 3.
The method transforming by Lithium Acetate turns the pGAPza plasmid with Cre recombinase in recombinant bacterial strain 1, to obtain recombinant bacterial strain 2; Picking mono-clonal is induced 4～5h in semi-lactosi substratum, and dilution spread choose single bacterium colony on YEPD flat board, then photocopy is on G418 resistant panel; The bacterial strain of choosing growth on YEPD flat board and not growing in G418 resistant panel, extract genome and carry out PCR checking, the genome of recombinant bacterial strain 2 of take is template amplification KanMX fragment, cannot obtain the band of 1600bp left and right, recombinant bacterial strain 1 can increase and obtain this fragment, and PCR the result as shown in Figure 3.Result shows, has realized and knock out PGM2 completely in yeast cell.
(3) knock out PGM2 completely and cross expression SNR84 strain construction simultaneously
The method transforming by Lithium Acetate imports recombinant bacterial strain 2 by expression plasmid Yep-KPS, by G418 resistance screening recon, carry out PCR checking, the yeast plasmid of transformant of take is template amplification PS fragment, can obtain the band of 2200bp left and right, starting strain can not increase and obtain this fragment, and PCR the result as shown in Figure 4.Result shows, in yeast cell, realized knock out completely PGM2 simultaneously strong promoter PGK1 cross expression SNR84 gene complete sequence.
Embodiment 2: the experiment of accelerated fermentation baker's yeast strain fermentation
(1) the plain doughs fermenting experiment of recombinant bacterial strain and starting strain
Picking one encircles yeast cell in YEPD substratum, and 30 ℃, standing cultivation 24h; The inoculum size of 10% (v/v) of take proceeds in molasses culture medium (adding 0.5g/L ammonium sulfate, 5g/L yeast powder in the molasses that pol is 10～12Brix), and 30 ℃, 180r/min, cultivates 24h to (OD stationary phase 600be 1.5 left and right); Standing cultivation 2h, under 4000r/min, centrifugal 5min, collects thalline after sterilized water washed twice standby.
Take the yeast 8.0g that above-mentioned centrifugal collection obtains, after mixing with 4.0g Nacl, 150mL water, 280g standard flour, the fermentograph of putting into preheating ferments.Record 1h CO 2gas production rate and the time that reaches maximum gas production rate.
(2) the plain doughs fermenting experiment result of recombinant bacterial strain and starting strain
Starting strain and recombinant bacterial strain plain doughs fermenting experiment the results are shown in Table 1.Result shows, in plain doughs fermentation, the recombinant bacterial strain that only knocks out PGM2 shows stronger gas deliverability, and knock out PGM2, crosses the recombinant bacterial strain of expressing SNR84 simultaneously and can further improve gas deliverability and shorten fermentation time.The 1h CO of recombinant bacterial strain 2gas production rate reaches 818mL, compared with parent strain, has improved 21.2%, and fermentation time has shortened 18.0% simultaneously.By result, found out, knock out PGM2 completely and cross simultaneously and express SNR84 and can improve bread yeast work the ability of sending out in plain doughs, thereby shorten fermentation time.
Table 4 parent strain and recombinant bacterial strain plain doughs fermenting power and fermentation time
Bacterial strain Plain doughs 1h produces CO 2(mL) Fermentation time (min)
CICC31616 675 100
Recombinant bacterial strain 2 (only knocking out PGM2) 750 90
Recombinant bacterial strain (knock out PGM2 and cross expression SNR84) 818 82
Note: shown in data be the mean value of three parallel test results.

Claims (9)

1. a strain accelerated fermentation baker's yeast bacterial strain, is in yeast starting strain, to knock out the encoding gene SNR84 acquisition of crossing the little nucleolar RNA of expression H/ACA in phosphoglucomutase gene PGM2 completely.
2. a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 1, is characterized in that, described starting strain is bread yeast (Saccharomyces cerevisiae) CICC31616.
3. a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 1, is characterized in that, its Gene ID of described PGM2 gene is: 855131, and nucleotide sequence is as shown in SEQ NO:1 in nucleotides sequence list; Its Gene ID of described SNR84 gene is: 9164879, and nucleotide sequence is as shown in SEQ NO:2 in nucleotides sequence list.
4. the preparation method of a strain accelerated fermentation baker's yeast bacterial strain, comprises the following steps:
(1) PGM2 gene knocks out
1. take plasmid pUC6 as template, pcr amplification KanMX gene;
2. the PCR product of step (1)-1. obtain is imported in yeast starting strain, obtain KanMX and substitute the recombinant bacterial strain 1 that knocks out PGM2;
3. use pGAP plasmid removing step (1)-2. the obtain KanMX in bacterial strain, obtain the recombinant bacterial strain 2 that knocks out PGM2 completely;
(2) crossing of SNR84 gene expressed
1. the total DNA of bread yeast CICC31616 of take is template, pcr amplification SNR84 gene;
2. the PCR product of step (2)-1. obtain is connected on the plasmid that contains PGK1 strong promoter, obtains expression plasmid 1;
3. take expression plasmid 1 as template, by pcr amplification, obtain the junction fragment of SNR84 gene and strong promoter;
4. the fragment of step (2)-3. acquisition is connected on the carrier with KanMX resistance, obtains expression plasmid 2;
5. the expression plasmid 2 step (2)-4. being obtained imports in the recombinant bacterial strain 2 of steps (1)-3., obtains to knock out PGM2 completely and cross the recombinant bacterial strain of expressing SNR84 simultaneously.
5. the preparation method of a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 4, is characterized in that, described starting strain is bread yeast (Saccharomyces cerevisiae) CICC31616.
6. the preparation method of a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 4, is characterized in that, described in contain PGK1 strong promoter plasmid be pUC plasmid.
7. the preparation method of a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 4, is characterized in that, the described carrier with KanMX resistance is Yep352 carrier.
8. the preparation method of a strain accelerated fermentation baker's yeast bacterial strain as claimed in claim 4, is characterized in that, the method that described gene fragment and expression plasmid import yeast strain is Lithium Acetate conversion method.
9. the application of accelerated fermentation baker's yeast bacterial strain as claimed in claim 1 in quick fermentation bread is produced.
CN201410333534.6A 2014-07-14 2014-07-14 One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation Active CN104073449B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410333534.6A CN104073449B (en) 2014-07-14 2014-07-14 One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410333534.6A CN104073449B (en) 2014-07-14 2014-07-14 One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation

Publications (2)

Publication Number Publication Date
CN104073449A true CN104073449A (en) 2014-10-01
CN104073449B CN104073449B (en) 2016-08-24

Family

ID=51595056

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410333534.6A Active CN104073449B (en) 2014-07-14 2014-07-14 One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation

Country Status (1)

Country Link
CN (1) CN104073449B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105463019A (en) * 2015-12-30 2016-04-06 中国人民解放军第二军医大学 Method for enhancing proliferative capacity of hUCMSCs and application of method
CN110358693A (en) * 2019-07-26 2019-10-22 海南大学 One plant of high patience yeast strain for being suitable for freezing flour-dough fermentation and its application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100105573A1 (en) * 2008-10-29 2010-04-29 Samsung Electronics Co., Ltd. Vector and microorganism for increasing galactose catabolism and methods therefor
CN103122323A (en) * 2012-12-03 2013-05-29 天津科技大学 Quick-fermentation bread yeast strain and breeding method thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100105573A1 (en) * 2008-10-29 2010-04-29 Samsung Electronics Co., Ltd. Vector and microorganism for increasing galactose catabolism and methods therefor
CN103122323A (en) * 2012-12-03 2013-05-29 天津科技大学 Quick-fermentation bread yeast strain and breeding method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HIGGINS VJ 等: "Genetic evidence that high noninduced maltase and maltose permease activities, governed by MALx3-encoded transcriptional regulators, determine efficiency of gas production by baker"s yeast in unsugared dough", 《APPL ENVIRON MICROBIOL. 》 *
KI-SUNG LEE 等: "Improved Galactose Fermentation of Saccharomyces cerevisiae Through Inverse Metabolic Engineering", 《BIOTECHNOLOGY AND BIOENGINEERING》 *
张燕 等: "快速发酵面包酵母单倍体的筛选及发酵性能研究", 《食品与发酵工业》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105463019A (en) * 2015-12-30 2016-04-06 中国人民解放军第二军医大学 Method for enhancing proliferative capacity of hUCMSCs and application of method
CN105463019B (en) * 2015-12-30 2019-07-26 中国人民解放军第二军医大学 A kind of method and its application enhancing hUCMSCs proliferative capacity
CN110358693A (en) * 2019-07-26 2019-10-22 海南大学 One plant of high patience yeast strain for being suitable for freezing flour-dough fermentation and its application
CN110358693B (en) * 2019-07-26 2022-02-22 海南大学 High-tolerance yeast strain suitable for frozen dough fermentation and application thereof

Also Published As

Publication number Publication date
CN104073449B (en) 2016-08-24

Similar Documents

Publication Publication Date Title
AU2005252266B8 (en) Non-recombinant saccharomyces strains that grow on xylose
Lim et al. Ethanol fermentation from Jerusalem artichoke powder using Saccharomyces cerevisiae KCCM50549 without pretreatment for inulin hydrolysis
CN103333811B (en) Kluyveromyces marxianus as well as composition and application thereof
CN102199556B (en) Saccharomyces cerevisiae genetic engineering bacteria with high ester yield and construction method thereof
Zhang et al. Starch saccharification and fermentation of uncooked sweet potato roots for fuel ethanol production
CN102102084A (en) Issatchenkia orientalis and composition and application thereof
CN105199976A (en) Recombinant saccharomyces cerevisiae strain for efficiently co-fermenting glucose and xylose and application of recombinant saccharomyces cerevisiae strain
CN103403155A (en) New saccharomyces cerevisiae strains
CN104031854A (en) Saccharomyces cerevisiae gene engineering strain for improving ethanol tolerance and construction method of saccharomyces cerevisiae gene engineering strain
CN102373160A (en) Screening and application of high glucose, high alcohol and high acid-resistant saccharomyces cerevisiae ATCC9763
CN102586125A (en) Highly ester producing issatchenkia orientalis yeast and composition as well as application thereof
CN109207373A (en) The method that one plant height produces the microbial strains and its fermentation starch saccharic production citric acid of citric acid
CN107603898B (en) The application of saccharomyces cerevisiae and its breeding mode and industrial fermentation production ethyl alcohol
CN104017742B (en) One plant height patience yeast strain and its construction method
CN104031933A (en) Construction and application method for L-ornithine synthesis bacteria
CN105368730A (en) Saccharomyces cerevisiae strain for producing ethanol by quick fermentation of xylose and construction method
CN105624051B (en) Wood-sugar fermentation yeast strain and construction method based on the building of evolution engineering
CN104073449B (en) One strain is suitable for bakery yeast and the selection thereof of plain doughs fermentation
CN102851224A (en) Actinobacillus succinogenes strain and method for producing succinic acid by screening and fermentation of same
CN102329743A (en) Industrial Saccharomyces cerevisiae strain with low glycerol synthesis and high alcohol tolerance and application thereof
CN101215562A (en) Method for constructing saccharomyces cerevisiae ethanol high-yield bacterial strain
CN101942483A (en) Method for preparing butanol by fermenting pentose with reinforced strains
CN106893682B (en) Method for expanding culture of saccharomycetes by using liquefied mash and application of saccharomycetes and method for fermenting ethanol
CN115478024A (en) Non-transgenic high-nucleic-acid saccharomyces cerevisiae strain and application thereof
CN102747063A (en) Xylose isomerase producing method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant