CN104073425A - LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method - Google Patents
LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method Download PDFInfo
- Publication number
- CN104073425A CN104073425A CN201410271298.XA CN201410271298A CN104073425A CN 104073425 A CN104073425 A CN 104073425A CN 201410271298 A CN201410271298 A CN 201410271298A CN 104073425 A CN104073425 A CN 104073425A
- Authority
- CN
- China
- Prior art keywords
- sensing device
- dna
- capture probe
- lspr
- dna capture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/55—Specular reflectivity
- G01N21/552—Attenuated total reflection
- G01N21/553—Attenuated total reflection and using surface plasmons
- G01N21/554—Attenuated total reflection and using surface plasmons detecting the surface plasmon resonance of nanostructured metals, e.g. localised surface plasmon resonance
Abstract
The invention provides an LSPR (localized surface plasma resonance) sensing device. The LSPR sensing device comprises a substrate, wherein the substrate is provided with a metal layer, the metal layer is in an XI shape, and the size of XI is of a nano grade. The LSPR sensing device prepared through the method establishes an asymmetric XI nano gold structure, a specific peak in the LSPR phenomenon can be produced independently by the X and I structure; after the XI structure is formed by combining the X structure and I structure, the spectrum of the two structures can be collectively heterozygozed, and a multipeak phenomenon occurs; the XI structure can have a coupling effect, so that the heterozygosis peak is deviated; the DNA detection precision and sensitivity can be greatly improved; the noise caused by the nonuniform structure caused by a traditional method can be avoided, the situation that the peak is widened due to the disorder structure can be avoided, the heterozygosis of the specific spectrums of the two structures is resonated with Fano produced by the asymmetric structure, so that the LSPR sensor is more accurate in detection.
Description
Technical field
The invention belongs to biochemistry detection technical field, be specifically related to a kind of LSPR sensing device based on local surface plasma resonance technology and preparation method thereof and DNA detection method.
Background technology
Detecting conventionally comparatively accurate feasible employing molecular biology method for bacterium at present carries out.Such as the PCR method and the gene chip that conventionally adopt, be all the DNA by extracting tested bacteria, then DNA is carried out to detection validation, thereby just can learn the result of tested bacteria.
The PCR method and the gene chip that wherein conventionally adopt; PCR method increases the DNA extracting from bacterium to bacterial gene in a large number with PCR, detects amplified production, thereby realize Bacteria Detection in PCR process by the gene probe of the target gene specific design based on bacterium; This method need to be carried out the various steps such as DNA extraction, amplification, design of primers in the time implementing, bacterium complex pretreatment, and be difficult to high pass quantification.Gene chip adopts using multiple specific few core former times acid fragments or gene fragment as probe, arrange and be fixed on upholder (as silicon chip, slide, plastic sheet) regularly, then hybridize by base pairing principle with the gene of mark sample extraction to be measured, by laser co-focusing fluorescence detecting system etc., chip is scanned, and be equipped with computer system the fluorescent signal on each probe is made comparisons and detected, thereby draw rapidly the measurement information for the treatment of of bacterium.Genechip detection is relatively accurate, but technical costs is high, and complicated operation is difficult to high pass and quantizes.
Therefore the defect based on DNA detection in above-mentioned existing method, utilize based on LSPR (Localized Surface Plasmon Resonance, local surface plasma resonance) biosensor of principle is owing to having highly sensitive for this in DNA detection aspect, is fireballingly a little therefore widely adopted.What but traditional LSPR sensor used is more consistent symmetrical structure, thereby incident light is produced to single absorption peak, although these symmetrical structures have met the detection to most of biomacromolecule, still lack enough sensitivity for the biological micromolecule of this class of DNA of bacteria.
Summary of the invention
The object of the embodiment of the present invention is to overcome the above-mentioned deficiency of prior art, and a kind of LSPR sensing device making method, sensing device and DNA detection method of the asymmetry nanostructure that can realize accurate DNA detection is provided.
In order to realize foregoing invention object, the technical scheme of the embodiment of the present invention is as follows:
A kind of LSPR sensing device, comprises substrate, and described substrate is provided with nano level metal coating, and described metal plating is XI shape.
The LSPR sensing device that the inventive method is prepared has constructed asymmetry XI type nanometer gold structure, has and in LSPR phenomenon, produce distinctive peak in X and the independent situation of I structure; When in conjunction with formation XI structure, together heterozygosis of the spectrum of two structures, produces multimodal phenomenon; XI structure can produce coupling simultaneously, thereby makes the peak that its heterozygosis forms produce skew; DNA detection tolerance range and sensitivity are greatly promoted; The noise of having avoided uneven texture that traditional method brings to produce, the situation of having avoided disordered structure to cause crest to broaden, the hybridization of the peculiar spectrum by two structures makes LSPR sensor make detection more accurate with the method promise resonance that unsymmetrical structure produces.
The present invention further proposes well a kind of preparation method of above-mentioned LSPR sensing device, comprises and obtains substrate, and in described substrate, resist layer is set;
Obtaining ordered arrangement has the imprint mold plate of nano level XI shape;
By template be provided with the substrate pressing of resist layer, resist layer surface is formed have the groove with the nano level XI shape of impression face adaptation;
Add protective layer on resist layer surface;
The substrate with protective layer and resist layer is carried out to the removal that is etched of resist layer that plasma etch processes makes to be positioned at groove part, and the substrate surface that makes to be positioned at concave part is exposed;
The substrate after plasma etching with resist layer is carried out to electron beam evaporation plating processing, and the exposed surface that makes substrate be positioned at concave part generates metal plating;
Remove suprabasil resist layer, obtain LSPR sensing device.
For deficiency of the prior art, the present invention further also proposes a kind of DNA detection method based on LSPR sensing device, comprises the steps:
Obtain DNA sample to be measured;
Fixed dna capture probe on LSPR sensing device, and in 800nm～1800nm optical wavelength absorbance spectrum;
On the LSPR sensing device that is fixed with DNA capture probe, add DNA sample to be measured, then in 800nm～1800nm optical wavelength absorbance spectrum;
Obtain DNA information to be measured according to the variation of absorption spectrum after interpolation DNA to be measured.
The DNA detection method of the LSPR sensing device based on asymmetry of the present invention, based on LSPR technology, has LSPR phenomenon in X and the independent situation of I structure, produces distinctive peak; When in conjunction with formation XI structure, together heterozygosis of the spectrum of two structures, produces multimodal phenomenon; XI structure can produce coupling simultaneously, thereby makes the peak that its heterozygosis forms produce skew; DNA detection tolerance range and sensitivity are greatly promoted.
Brief description of the drawings
Below in conjunction with drawings and Examples, the invention will be further described, in accompanying drawing:
Fig. 1 is the structural representation of XI shape platen in embodiment of the present invention LSPR sensing device preparation process;
Fig. 2 is the groove structure schematic diagram forming on resist layer surface after platen and substrate pressing in embodiment of the present invention LSPR sensing device preparation process;
Fig. 3 be after impression block shown in Fig. 2 and substrate pressing A-A to schematic cross-section;
Fig. 4 deposits the structural representation after protective layer in Fig. 3;
Fig. 5 will carry out the structural representation after plasma etching in Fig. 4;
Fig. 6 generates the structural representation after metallic membrane by having in Fig. 4 in the substrate of resist layer;
Fig. 7 is by the LSPR sensing device structural representation of gained after resist layer in removal Fig. 5;
Fig. 8 is the spectrogram of the asymmetric nanostructure LSPR sensing device of the present invention in different refractivity solution;
Fig. 9 is the schematic diagram that the asymmetric nanostructure LSPR sensing device of the present invention detects X part and I part spectrum stack formation multimodal spectrum in spectrum;
Figure 10 is the spectrogram that the asymmetric nanostructure LSPR sensing device of the embodiment of the present invention carries out gram positive bacterium DNA detection.
Embodiment
In order to make object of the present invention, technical scheme and advantage clearer, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein, only in order to explain the present invention, is not intended to limit the present invention.
Example of the present invention provides a kind of DNA detection method of LSPR sensing device of the asymmetry based on local surface plasma resonance technology, comprises the steps:
S10, extracts DNA to be measured;
S20, carries out pcr amplification to the DNA to be measured extracting;
S30, makes the LSPR sensing device with asymmetry nanometer gold structure;
S40, fixed dna capture probe on LSPR sensing device;
S50, detects DNA to be measured.
The spectrum change of DNA that adopts asymmetrical nm gold particles to produce based on 800～1800nm wavelength lower surface plasma resonance on ultraviolet spectrophotometer in the present invention, thus the detection of carrying out the DNA of tested bacteria judges bacteria types to be measured.
In step S10 for the present invention in the identification specificity of sequence to DNA of bacteria consider, adopt following step to extract the 16srRNA gene of tested bacteria;
Step is as follows:
S11, the bacterium liquid sample of tested bacteria, carries out high speed centrifugation and from sediment, obtains thalline; Certainly,, for the thalline cleaning that makes to obtain, can repeat in EP pipe with centrifugal again after damping fluid RB washing; Finally again the thalline of collecting is resuspended in to RB damping fluid, for subsequent use;
S12, carries out cracking to the thalline of collecting in S10, and thalline inclusion is discharged, and obtains inclusion mixed solution;
Be gram-positive microorganism if consider bacterium to be measured, can, to the appropriate N,O-Diacetylmuramidase of the thalline obtaining, guarantee effective cracking of bacterium; Add 37 DEG C of temperature of N,O-Diacetylmuramidase to bathe 30-60min; After abandoning supernatant after high speed centrifugation, cell oscillation or piping and druming are resuspended in damping fluid RB again;
S13, adds RNaseA solution in the inclusion mixed solution obtaining to S12 step, and vibration mixes, and room temperature is placed 5-10min; The mixed solution being removed after RNA;
S14, adds in conjunction with liquid CB in the mixed solution obtaining to S13 step, then adds after Virahol, fully mixes and obtains turbid solution;
S15, adds step S14 gained turbid solution in adsorption column AC, and high speed centrifugation discards waste liquid; In centrifugally operated, adsorption column AC can be put into collection tube, facilitate the carrying out of centrifugal process;
S16 adds inhibition removal liquid IR in centrifugal rear adsorption column AC, and high speed centrifugation is abandoned waste liquid again; The adsorption column AC of the DNA cloning that is removed inhibition;
S17 adds rinsing liquid WB in adsorption column AC, discards waste liquid after high speed centrifugation, adds rinsing liquid WB, discards waste liquid after high speed centrifugation; And rinsing liquid WB is cleaned to adsorption column AC afterwards and put back in sky collection tube, after high speed centrifugation, remove rinsing liquid, in order to avoid residual ethanol suppresses downstream reaction in rinsing liquid;
S18, inserts adsorption column AC in centrifuge tube, adds elution buffer EB in post on adsorption film, and room temperature is placed 3-5min, the centrifugal 1min of 12000rpm; Collect the elute soln obtaining after wash-out;
S19, rejoins the elute soln obtaining in centrifugal adsorbing column, and room temperature is placed 2min, just can obtain DNA sample to be measured after the centrifugal 1min of 12000rpm, and can be placed in-20 DEG C and save backup.
The 16srRNA gene obtaining in this step S10, it is the corresponding DNA sequence dna of rRNA of encoding on bacterium, be present in the germy genome of institute, there is conservative property and the specificity of height, compare other random gene fragment and there is higher accuracy, therefore in the present invention, preferably adopt this gene to carry out.
Further in step S20 to S10 in the DNA to be measured of gained carry out pcr amplification, based on above-mentioned 16srRNA gene, according to the primer of the synthetic tested bacteria 16S rRNA of design of primers and gyrase (gyrB) gene, be diluted to working concentration with ddH2O.
In step S20, utilize the primer of design to carry out pcr amplification the DNA obtaining, with foot demand to be measured, certainly in pcr amplification, needing provides archaeal dna polymerase, base raw material etc., so that PCR can carry out.PCR response procedures is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, according to each primer annealing annealing temperature 30s, 72 DEG C are extended 2min (according to amplified production length 1000bp/min), set 32 circulations, and last 72 DEG C are extended 10min; Certainly, in carrying out, reaction can adopt the PCR reaction system of standard to carry out pcr amplification, in system, control 20 μ l standard amplification systems and carry out, specifically comprise: standard specimen, 0.5 μ l upstream primer, 0.5 μ l downstream primer, 0.2 μ l Easy Taq, 2 μ l dNTPs, 2 μ l10 × Easy Taq Buffer, the 14 μ l ddH2O of the DNA to be measured that 1 μ l extracts.
Certainly the product that carries out pcr amplification after above-mentioned steps S20 uses containing 1% sepharose of Gelred nucleic acid dye carrying out electrophoresis containing in TAE damping fluid electrophoresis chamber, 120 volts of voltages, the DNA chain that the length existing in product is differed carries out separation and purification, and exist the good DNA of band to get a little to the glue after electrophoresis, again dissolve as DNA sample to be measured for subsequent use.
After DNA sample preparation to be measured in early stage completes, need to prepare the LSPR sensing device that detects needed asymmetry nm gold particles in the present invention; The particular procedures being prepared in step S30 comprises the steps:
S31, chooses clean quartz glass plate as substrate 1, and it is carried out to cleaning-drying; In this step, substrate 1 is the base material as carrying asymmetry nm gold particles, except above-mentioned preferred silica glass, in its spectrum effects of guarantee, can also select plastic sheet, acrylic sheet etc.; The optical property the best of quartz glass plate own, and the hardness of its product can
S32 arranges one deck resist layer 2 in substrate 1, and these resist layer 2 materials are generally elected resin as;
S33, obtains an impression block 3, and this impression block 3 is nano level, and is shaped as XI shape, comprises X structure 31 and I structure 32 two portions, and this shape can be shown in Figure 1; X structure 31 comprises four branch parts 311 of mutual intersection composition X-shaped shape; The length of branch part 311 is that 150～230nm, width are 35～40nm, and angle between adjacent two branch parts 311 is 50～70 degree or 110～130 degree; I structural area 32 length are 250～350nm, and width is 35～40nm.
In preparation process, this impression block 3 is placed in to resist layer 2 surfaces and carries out pressing with substrate 1, referring to Fig. 2-3; After pressing, the surface of resist layer 2 just forms with the shape of impression block 3 as suitable groove structure 21 so;
Certainly, it is pointed out that in substrate 1 in the present invention and can form multiple asymmetric X I structures, be not restricted to only form an XI nanostructure; And rule is arranged when multiple XI nanostructure, several XI nanostructures are regularly arranged contribute to after the repetition of product property and the lifting of the optimum rate of product.
S34, will carry out protective layer 4 depositing treatment on the resist layer after above-mentioned pressing and forming 2, because its surface has the XI shaped recesses structure 21 after pressing, do not deposit protective layer 4 in the groove structure 21 on resist layer 2 surfaces so in depositing treatment; But not can deposit protective layer 4 on the surface of groove structure 21, and post-depositional structural representation is referring to Fig. 4;
S35, then will after deposition protective layer 4, carry out plasma etch processes with the resist layer 2 of substrate 1; Because the surperficial matcoveredn 4 of non-groove structure 21 is protected, therefore can not be etched; And groove structure 21 is owing to not existing protective layer 4 to protect, therefore corresponding to the etched removal of resist layer 2 meeting in groove structure 21, make substrate 1 surface exposure corresponding with groove structure 21 positions out; Structural representation after etching processing is referring to Fig. 5;
S36, removes previous step the substrate 1 use electron beam evaporation plating of the interior resist layer 2 of groove structure 21, makes to plate uniformly layer of metal film 5 on the surface of resist layer 2 and substrate 1 surface corresponding to groove structure 21, and its structure is shown in Figure 6; Finally remaining resist layer 2 after etching is all removed, make substrate 1 surface there is the asymmetrical Ti/Au nanostructure of one deck X-shaped shape and I combination of shapes, referring to Fig. 7; Wherein the formation of XI shape is that impression block 3 own is XI shape due to the forming of impression block 3, the nanostructure of the asymmetrical Ti/Au film of generation after etching is removed so, and its shape is also XI shape type shape.Adopt Ti/Au to form asymmetrical nm gold particles structure, its spectrum under above-mentioned wavelength region of material of comparing other is more accurate.
In the mode of above-mentioned electron beam evaporation plating, the titanium of first evaporation 1nm, then the gold of evaporation 20nm, be the Metal coating that substrate 1 surface forms two metal single layer stacks in the present invention; The Ti film of 1nm is the adhesivity in order to increase substrate 1 and Au, thereby makes the Stability Analysis of Structures of overall nano level metal layer 5, the character of improving product and performance.Certainly, in the present invention the metal level 5 here also can adopt with existing LSPR in the precious metals ag, the Pt etc. that conventionally adopt also passable, just cannot reach the obtained impact of performance of above-mentioned Ti/Au membrane structure.And, adopt in the above-described embodiment the mode of electron beam evaporation plating to form Ti/Au membrane structure, in the time that those of ordinary skill in the art implement, also can adopt the mode of ion sputtering, hot evaporation to generate according to same object, all can; The nanometer level of the metal level 5 that wherein electron beam evaporation plating forms is better.
Adopt the mode of printing to carry out the making of asymmetric nm gold particles, its step is comparatively simple, and adopts the auxiliary asymmetry imprinting moulding of resist layer 2, other processing mode relatively, and shape matching rule is stable.
After obtaining above-mentioned asymmetrical nanometer gold structure, this asymmetrical nanometer gold structure fixed dna capture probe for step S40, for carrying out DNA detection to be measured, specifically comprises at step S40:
S41, gets the substrate with asymmetrical Ti/Au nanostructure 1 obtaining in step S36, uses ultrapure water to rinse well, and uses nitrogen to be dried, for subsequent use;
S42, will activate processing to DNA capture probe; In this step, DNA capture probe is the oligonucleotide sequence itself adopting according to the reverse complemental of the target gene design of known definite bacteria culture, therefore, when the bacteria types belonging to when bacteria types and this DNA capture probe of DNA to be measured matches, DNA capture probe limit can be in conjunction with DNA to be measured so; This DNA capture probe can design for the specific sequence of virus to be measured or bacterium.
Such as containing specific sequence in the known DNA sequence dna containing in HIV virus for " GACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAG CTGCAGAATGGGATAGAGTGCATCCAGT ", so just, can choose wherein part special, make reverse complementary sequence as DNA capture probe, as oligonucleotide sequence " TCATTGATGGTCTCTTTTAACA " for identifying HIV fragment.
After prepared by DNA capture probe, in order to ensure that its stability prevents that base, structure from changing, therefore can after preparation, carry out sulfydryl modification to DNA capture probe, the present invention removes before use it and modifies sulfydryl, and it is activated; Can in DNA capture probe, add TCEP, thereby the mercapto groups reducing wherein activates DNA capture probe.
S43, is added to the DNA capture probe after above-mentioned activation in damping fluid, to form DNA capture probe buffered soln; Again DNA capture probe buffered soln is dropped in substrate 1, under room temperature, leave standstill 1 hour; And use ultrapure water flushing substrate 1 rear dry by nitrogen gas stream.
In this step, damping fluid adopts the pH7.4 buffer system that 10mM Tris-HCl+1mM EDTA+0.1M NaCl+10mM TCEP is mixed with in the present invention, and complexing functional group is beneficial to the character that keeps DNA capture probe more more.
S44, is placed in MCH solution by the substrate of the above-mentioned DNA of being added with capture probe 1 and processes, and re-uses ultrapure water and rinses substrate 1, and use nitrogen gas stream dry, completes fixing.
S45, uses ultraviolet spectrophotometer in 800nm～1800nm optical wavelength, to measure its absorption spectrum to the substrate 1 of fixed dna capture probe.
Wherein above-mentioned nitrogen, as the shielding gas in drying process, is protected DNA capture probe, prevents that it is oxidized, decomposes etc., and for this purpose, the gas of nitrogen can also carry out with other gas that meets protection object.
Further, after above-mentioned steps completes, carry out the detection of DNA to be measured, concrete steps S50 comprises:
S51, gets above-mentioned pcr amplification DNA sample to be measured afterwards, after choosing consumption, drops in the substrate 1 of the above-mentioned DNA of being fixed with capture probe, leaves standstill approximately 1 hour; Re-use ultrapure water and rinse substrate 1, and use nitrogen gas stream dry;
If the type described in bacteria types and DNA capture probe described in the DNA to be measured detecting in this course meets, DNA so to be measured and DNA capture probe can be in conjunction with.
S52, use ultraviolet spectrophotometer to step S51 substrate 1 after treatment in 800nm～1800nm optical wavelength, measure its absorption spectrum.
The collection of illustrative plates of the absorption spectrum that the absorption spectrum obtaining by contrast step S52 and step S45 obtain changes, and just can obtain the detected result of DNA to be measured.
In the present invention, adopt above-mentioned steps to carry out the specific detection of DNA; based on LSPR technology; in the time that light incides on the nano particle being made up of precious metal; if when the body vibration frequency of incident photon frequency and metal nanoparticle or metal island conduction electron matches; nano particle or metal island can produce very strong sorption to photon energy; local surface plasma resonance phenomenon will occur, and its result can be analyzed and obtain from absorption spectrum.
And existing LSPR sensing device carries out in DNA detection, need to promote from two aspects the accurate precision of side chain; First is to ensure the offset amplitude of spectrum, when sensing device surveyed area changes, and the skew that the spectrum of LSPR generation should be large as far as possible, this index is usually used " departure distance/variations in refractive index δ λ
lSPR/ δ n " weigh, be the departure distance of its crest in the time that the specific refractory power of the liquid of LSPR sensor surface in contact produces unit change, the sensitivity of the larger sensor of this parameter is higher; Second index is the width of the crest in producing spectrum, and in the time that crest is narrower, the specificity of its detection is higher, and the noise signal of generation is less.In existing LSPR sensing detection, the noise producing due to uneven texture in detection, causes disordered structure to cause crest to broaden; Detect in small molecule DNA, the cheap amplitude of absorption peak lacks enough sensitivity.
In the present invention, use nanometer embossing, constructed rule, orderly, asymmetry XI type nanometer gold structure uniformly, the noise of having avoided uneven texture that traditional method is brought to produce, the situation of having avoided disordered structure to cause crest to broaden.The exclusive XI type gold nano structure of Project design, makes LSPR sensor more responsive to the variation of sensing interface by the hybridization of peculiar spectrum and the method promise resonance of unsymmetrical structure generation of two structures.Traditional LSPR sensitivity generally at 100～500nm/RIU, only a few structure can reach 800～900nm/RIU as special constructions such as Au branches.And this structure has improved its sensitivity by many-side, reach as high as 1000nm/RIU, exceed the best result that traditional method can reach.Compare existing symmetric LSPR sensor, can not produce spectrum stack, and also do not have method promise resonance.
And the hyperchannel that the method promise producing in the LSPR sensing device based on asymmetry nanostructure of the present invention resonance is quantum number defect is multiple wave function, growing mutually or disappearing mutually can appear in wave function stack, namely the passage of various quantum losss can superpose mutually, there will be the situation of certain wave function amplitude maximum thereby there is resonance, corresponding certain quantum loss is the most obvious.Therefore the coupling between individual nano particle, makes spectrum there will be asymmetrical peak type.In the present invention for this situation, the asymmetric nanometer gold structure of design, wherein has oneself LSPR phenomenon in X and the independent situation of I structure, produce own distinctive peak; When in conjunction with formation XI structure, together heterozygosis of the spectrum of two structures, produces multimodal phenomenon; XI structure can produce coupling simultaneously, thereby makes the peak that its heterozygosis forms produce skew; The result that this spectrum produces can be referring to shown in Fig. 8-Fig. 9.
In order to make aforesaid method of the present invention clearer, also easy to understand more, describes method steps of the present invention by the following examples:
Embodiment 1
In the present invention, select gram positive bacterium to carry out operation of the present invention as bacterium standard specimen:
S11, gets 0.5-2ml and cultivates bacterium liquid after EP pipe, and high speed centrifugation 30s, abandons supernatant; Resuspended with damping fluid RB in EP pipe, after high speed centrifugation, abandon supernatant; This step repeats 2～3 times;
S12, adds appropriate N,O-Diacetylmuramidase, puts upside down and mixes, and 37 DEG C of temperature are bathed 30-60min; After abandoning supernatant after high speed centrifugation, cell oscillation or piping and druming are resuspended in damping fluid RB;
S13, adds RNase A (25mg/ml) solution 20 μ l to step S13 in the solution obtaining, vibration mixes, and room temperature is placed 5-10min;
S14, adds in conjunction with liquid CB, then adds a small amount of Virahol, now there will be cotton-shaped sediment, and vortex vibration at once fully mixes, and obtains mixture;
S15, adds mixture in adsorption column AC, and adsorption column is put into collection tube, and high speed centrifugation 30-60s, discards waste liquid;
S16, then add inhibition removal liquid IR in adsorption column AC, high speed centrifugation 30s, abandons waste liquid;
S17, adds rinsing liquid WB, discards waste liquid after high speed centrifugation, adds 500 μ l rinsing liquid WB, discards waste liquid after high speed centrifugation; And adsorption column AC is put back in sky collection tube, after high speed centrifugation, remove rinsing liquid, in order to avoid residual ethanol suppresses downstream reaction in rinsing liquid;
S18, takes out adsorption column AC, puts into a clean centrifuge tube, adds 100 μ l elution buffer EB carry out wash-out in the middle part of the adsorption film of adsorption column AC, and room temperature is placed 3-5min, and the centrifugal 1min of 12000rpm collects elutriant;
S19, rejoins the elutriant obtaining in centrifugal adsorbing column, and room temperature is placed 2min, the centrifugal 1min of 12000rpm, and just obtaining DNA sample to be measured is the gram positive bacterium 16srRNA gene extracting;
Obtain can being not interposing in-20 DEG C and preserving after the 16srRNA gene of gram positive bacterium, directly enter following step and use;
S20, the DNA to be measured that above-mentioned S19 is obtained carries out pcr amplification; Still adopt 20 μ l standard amplification systems to carry out; DNA1 μ l to be measured, 0.5 μ l upstream primer, 0.5 μ l downstream primer, 0.2 μ l Easy Taq, 2 μ l dNTPs, 2 μ l10 × Easy Taq Buffer, 14 μ l ddH2O that step S19 obtains.
Wherein upstream primer and downstream primer are synthetic right according to the 16srRNA gene design of gram positive bacterium, are diluted to working concentration with ddH2O.
Carry out 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, according to each primer annealing annealing temperature 30s, 72 DEG C are extended 2min (according to amplified production length 1000bp/min), set 32 circulations, and last 72 DEG C are extended 10min.
After above-mentioned PCR end of processing, pcr amplification product is used containing 1% sepharose of Gelred nucleic acid dye carrying out electrophoresis containing in TAE damping fluid electrophoresis chamber, 120 volts of voltages, after electrophoresis completes, use gel imaging system is taken pictures.
S30, makes asymmetrical XI shape nm gold particles, carries out in accordance with the following steps:
S31, selects quartz glass plate that 2*2cm is clean as substrate 1, and it is carried out to cleaning-drying; Obtain the XI shape convex formwork with nano level unsymmetric structure; Wherein this XI type convex formwork can be referring to the description of above-mentioned impression block 3.
S32 arranges one deck resin layer as resist layer 2 in substrate 1; By the nano level unsymmetric structure of convex formwork facing to resin layer surface and quartz glass plate 1 pressing; The groove of the XI shape of formation and convex formwork shape adaptation on the surface of resin layer 2, takes away convex formwork after pressing.
S33, at room temperature, by tilting the quartz glass plate with resin layer after above-mentioned pressing 45 degree, the chromium (Cr) that then deposits one deck 20nm on resin layer as protective layer 4; After deposition, the non-groove location of resin layer surface can be covered by chromium layer, and therefore its groove surfaces depression does not have chromium deposition.
S34, at room temperature, by the quartz glass plate with resin layer after complete the deposition of S33 gained chromium, in horizontal and rubber washing machine, use oxygen gas plasma rinses, etching; The resin corresponding with groove location is etched away, thereby the quartz glass plate surface exposure that is positioned at this position out;
S35, at room temperature, by the placement of the quartz glass plate level with resin layer after treatment S34, use electron beam evaporation plating, the gold of the titanium of 1nm and 20nm is distinguished to uniform evaporation in order on sample, make to plate one deck Ti/Au film on surface that the surface of resin layer and above-mentioned quartz glass plate are exposed.
Finally the resin layer on quartz glass plate is all removed, obtained the asymmetrical Ti/Au nanostructure of one deck X structure and I textural association on quartz glass plate surface.
S40, fixed dna capture probe on the quartz glass plate of asymmetrical Ti/Au nanostructure, adopt " NH2-T12-AAGGGGCATGATGATTTGACGTC " sequence capture probe as the 16srRNA gene of gram positive bacterium here, then carry out capture probe and fix:
S41, adds the DNA capture probe of the 0.2mM of 99ml to carry out probe activation the 1mM TCEP of 1ml;
S42, then add I-buffer damping fluid to form buffered soln the capture probe of 4ml, then drop on quartz glass plate, under room temperature, leave standstill 1 hour; Use ultrapure water to rinse electrode, and use nitrogen gas stream dry;
Wherein I-buffer damping fluid is the pH7.4 buffer system that 10mM Tris-HCl+1mM EDTA+0.1M NaCl+10mM TCEP is mixed with;
S43, infiltrates room temperature in the MCH of 100ml solution by quartz glass plate and leaves standstill 2 hours, re-uses ultrapure water and rinses electrode, and use nitrogen gas stream dry;
S44, uses ultraviolet spectrophotometer in 800nm～1800nm optical wavelength, to measure its absorption spectrum to the quartz glass plate of handling well.
S51, the DNA solution 4uL to be measured that gets 1uM concentration drops on the quartz glass plate of the above-mentioned DNA of being fixed with capture probe, and leaves standstill 1 hour; Re-use afterwards ultrapure water and rinse quartz glass plate, and use nitrogen gas stream dry;
S52, uses ultraviolet spectrophotometer in 800nm～1800nm optical wavelength, to measure its absorption spectrum to the quartz glass plate of handling well.
The variation at the spectral absorption peak that obtains from above-mentioned S44 and in two steps of S52, just can draw the result of DNA to be measured.
Shown in Figure 10, Figure 10 is the spectrogram that the asymmetric nanostructure LSPR sensor of the embodiment of the present invention carries out gram positive bacterium DNA detection; In result, find that the absorption peak that its absorption peak in step S52 is compared in S44 is offset to the right, so show that the probe that DNA is fixing with LSPR sensor (being the quartz glass plate of above-mentioned asymmetry XI nanometer metal structure) surface combines, and shows that institute's tested for pathogens is the corresponding germ of this probe;
Embodiment 2
Based on above-mentioned contrast, in embodiment 2, adopt and from golden yellow glucose coccus, extract DNA and carry out the step in embodiment 1 as DNA to be measured, DNA capture probe still adopts the sequence capture probe of the 16srRNA gene of the gram positive bacterium in embodiment 1; Carrying out detecting step carries out according to the step identical with embodiment 1.
In last absorption spectrum, its absorption peak obtaining does not occur mobile, be because the DNA to be measured probe fixing with LSPR sensor (being the quartz glass plate of above-mentioned asymmetry XI nanometer metal structure) surface can not combine, show that institute's tested for pathogens is not the corresponding germ of this probe.
Certainly, in above-described embodiment repeatedly repeats to implement, the result that likely exists its absorption peak to be moved to the left, is because show to come off at the probe fixing, and causes absorption peak to be moved to the left; So again, repeat to detect again after capture probe fixing step.
And; above-mentioned sensing device of the present invention can also carry out detection by quantitative to DNA to be measured; because local surface plasma resonance is metal nanoparticle or discontinuous metal Nano structure excited by incident light after; the collaborative concussion of its internal freedom electronics produces local surface plasma resonance; the local electromagnetic field on metal Nano structure surface is greatly strengthened, and represents strong surface plasma body resonant vibration and absorbs.When nano grain surface is modified specific capture probe, the vibration frequency of nano particle itself in the detection plane of the hybridization/affine combination meeting change sensor of DNA to be measured and capture probe, thereby the absorption peak that sensor is produced incident light changes, and the big or small degree of variation and the concentration of detection material are proportionate.Therefore, the size of the peak value based in spectrum, just can calculate the concentration of detection material, quantitative to DNA to be measured.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments of doing within the spirit and principles in the present invention, be equal to and replace and improvement etc., within all should being included in protection scope of the present invention.
Claims (10)
1. a LSPR sensing device, comprises substrate, it is characterized in that, described substrate is provided with metal level, and described metal level is XI shape, and described XI geomery is nano level.
2. LSPR sensing device as claimed in claim 1, is characterized in that, the X structural area of described metal level comprises four branch parts; The length of described branch part is that 150～230nm, width are 35～40nm, and angle between adjacent two branch parts is 50～70 degree or 110～130 degree;
The I structural area length of described metal level is 250～350nm, and width is 35～40nm.
And/or described metal level comprises and is positioned at suprabasil Ti layer and is positioned at the Au layer on described Ti layer.
And/or described substrate is quartz glass plate, acrylic sheet or plastic sheet.
3. LSPR sensing device as claimed in claim 1 or 2, is characterized in that, is fixed with DNA capture probe on described metal level.
4. a preparation method for LSPR sensing device, is characterized in that, comprises the steps:
Obtain substrate, and in described substrate, resist layer is set;
Obtain template, described template has the model of XI shape, and described XI geomery is nano level;
By described template and the substrate pressing that is provided with resist layer, make the groove of the model adaptation of the formation of resist layer surface and described XI shape;
In the non-groove surfaces of described resist layer, form protective layer;
The described substrate with described protective layer and resist layer is carried out to plasma etch processes, and the resist layer etching that makes to be positioned at groove part is removed, and the substrate surface that makes to be positioned at concave part is exposed;
On the described substrate surface that is positioned at concave part, generate metal level;
Remove described suprabasil described resist layer.
5. LSPR sensing device making method as claimed in claim 4, is characterized in that, on the described substrate surface that is arranged in concave part, generates metal level step, adopts the mode of electron beam evaporation plating to generate described metal level.
6. LSPR sensing device making method as claimed in claim 5, is characterized in that, described in remove described suprabasil described resist layer step after, be also included in fixed dna capture probe on described metal level.
7. LSPR sensing device making method as claimed in claim 6, is characterized in that, described on described metal level fixed dna capture probe step comprise:
DNA capture probe is added and in damping fluid, forms DNA capture probe buffered soln;
DNA capture probe buffered soln is dropped on LSPR sensing device, after washing and under protective atmosphere, be dried;
By being added with after the LSPR sensing device MCH solution-treated of DNA capture probe, again dry under protective atmosphere after washing.
8. a DNA detection method for the LSPR sensing device based on described in claim 1 or 2, is characterized in that, comprises the steps:
Obtain DNA sample to be measured;
Fixed dna capture probe on LSPR sensing device, and in 800nm～1800nm optical wavelength absorbance spectrum;
On the LSPR sensing device that is fixed with DNA capture probe, add DNA sample to be measured, then in 800nm～1800nm optical wavelength absorbance spectrum;
Obtain DNA information to be measured according to the variation of absorption spectrum after interpolation DNA to be measured.
9. the DNA detection method based on LSPR sensing device as claimed in claim 8, is characterized in that, on described LSPR sensing device, fixed dna capture probe step comprises:
DNA capture probe is added and in damping fluid, forms DNA capture probe buffered soln;
DNA capture probe buffered soln is dropped on LSPR sensing device, after washing and under protective atmosphere, be dried;
By being added with after the LSPR sensing device MCH solution-treated of DNA capture probe, again dry under protective atmosphere after washing.
10. the DNA detection method based on LSPR sensing device as claimed in claim 8 or 9, is characterized in that, described DNA capture probe is added and forms DNA capture probe buffered soln step in damping fluid before, also comprise DNA capture probe activated to processing;
And/or describedly DNA capture probe is activated to treatment step comprise DNA capture probe TCEP is processed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410271298.XA CN104073425A (en) | 2014-06-17 | 2014-06-17 | LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410271298.XA CN104073425A (en) | 2014-06-17 | 2014-06-17 | LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104073425A true CN104073425A (en) | 2014-10-01 |
Family
ID=51595034
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410271298.XA Pending CN104073425A (en) | 2014-06-17 | 2014-06-17 | LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104073425A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104634763A (en) * | 2015-02-11 | 2015-05-20 | 浙江大学 | SPR sensor chip and preparation method thereof |
| CN105181653A (en) * | 2015-10-09 | 2015-12-23 | 太原理工大学 | Polarization state modulation based plasmon biosensor, device and application method |
| CN108169181A (en) * | 2016-12-08 | 2018-06-15 | 东莞东阳光科研发有限公司 | A kind of optical bio chip preparation method |
| WO2019134547A1 (en) * | 2018-01-03 | 2019-07-11 | 京东方科技集团股份有限公司 | Gene sequencing substrate and preparation method therefor, gene sequencing device, and gene sequencing method |
| WO2021179622A1 (en) * | 2020-03-13 | 2021-09-16 | 量准（上海）医疗器械有限公司 | Digital plasma immunosorbent kit, manufacturing method therefor and detection method therefor |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008076313A (en) * | 2006-09-22 | 2008-04-03 | Japan Advanced Institute Of Science & Technology Hokuriku | Tip for analysis, its manufacturing method, and apparatus and method for analysis |
| JP2009222401A (en) * | 2008-03-13 | 2009-10-01 | Tokyo Metropolitan Industrial Technology Research Institute | Localized surface plasmon resonance imaging apparatus |
| CN201408192Y (en) * | 2009-01-22 | 2010-02-17 | 吴群林 | LSPR sensor chip for detecting blood coagulation factor and D dipolymer in blood |
| CN102081095A (en) * | 2011-01-04 | 2011-06-01 | 长沙理工大学 | LSPR (Localized Surface Plasmon Resonance) sensing chip for detecting plasmid DNA (deoxyribonucleic acid) containing oncogene C-myc antigen fragment |
| US20110166045A1 (en) * | 2009-12-01 | 2011-07-07 | Anuj Dhawan | Wafer scale plasmonics-active metallic nanostructures and methods of fabricating same |
| CN202033369U (en) * | 2011-01-04 | 2011-11-09 | 长沙理工大学 | Local surface plasma resonance (LSPR) sensing chip for detecting plasmid deoxyribonucleic acid (DNA) containing oncogene C-myc antigenic segment |
| US20130112857A1 (en) * | 2011-11-03 | 2013-05-09 | Agency For Science, Technology And Research | Sensor and Method of Detecting a Target Analyte |
-
2014
- 2014-06-17 CN CN201410271298.XA patent/CN104073425A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008076313A (en) * | 2006-09-22 | 2008-04-03 | Japan Advanced Institute Of Science & Technology Hokuriku | Tip for analysis, its manufacturing method, and apparatus and method for analysis |
| JP2009222401A (en) * | 2008-03-13 | 2009-10-01 | Tokyo Metropolitan Industrial Technology Research Institute | Localized surface plasmon resonance imaging apparatus |
| CN201408192Y (en) * | 2009-01-22 | 2010-02-17 | 吴群林 | LSPR sensor chip for detecting blood coagulation factor and D dipolymer in blood |
| US20110166045A1 (en) * | 2009-12-01 | 2011-07-07 | Anuj Dhawan | Wafer scale plasmonics-active metallic nanostructures and methods of fabricating same |
| CN102081095A (en) * | 2011-01-04 | 2011-06-01 | 长沙理工大学 | LSPR (Localized Surface Plasmon Resonance) sensing chip for detecting plasmid DNA (deoxyribonucleic acid) containing oncogene C-myc antigen fragment |
| CN202033369U (en) * | 2011-01-04 | 2011-11-09 | 长沙理工大学 | Local surface plasma resonance (LSPR) sensing chip for detecting plasmid deoxyribonucleic acid (DNA) containing oncogene C-myc antigenic segment |
| US20130112857A1 (en) * | 2011-11-03 | 2013-05-09 | Agency For Science, Technology And Research | Sensor and Method of Detecting a Target Analyte |
Non-Patent Citations (4)
| Title |
|---|
| NIELS VERELLEN ET AL: "Plasmon Line Shaping Using Nanocrosses for High Sensitivity Localized Surface Plasmon Resonance Sensing", 《NANO LETTERS》 * |
| NIELS VERELLEN ET AL: "Plasmon Line Shaping Using Nanocrosses for High Sensitivity Localized Surface Plasmon Resonance Sensing", 《NANO LETTERS》, no. 11, 31 December 2011 (2011-12-31), pages 391 - 397 * |
| TAERIN CHUNG ET AL: "Plasmonic Nanostructures for Nano-scale Bio-Sensing", 《SENSORS》 * |
| 茅敬雨等: "基于局域表面等离子体共振效应生物传感器的制备方法及应用", 《材料导报：综述篇》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104634763A (en) * | 2015-02-11 | 2015-05-20 | 浙江大学 | SPR sensor chip and preparation method thereof |
| CN104634763B (en) * | 2015-02-11 | 2018-01-23 | 浙江大学 | A kind of SPR sensorgram chip and preparation method thereof |
| CN105181653A (en) * | 2015-10-09 | 2015-12-23 | 太原理工大学 | Polarization state modulation based plasmon biosensor, device and application method |
| CN105181653B (en) * | 2015-10-09 | 2019-03-15 | 太原理工大学 | Phasmon biosensor, device and application method based on polarization state modulation |
| CN108169181A (en) * | 2016-12-08 | 2018-06-15 | 东莞东阳光科研发有限公司 | A kind of optical bio chip preparation method |
| WO2019134547A1 (en) * | 2018-01-03 | 2019-07-11 | 京东方科技集团股份有限公司 | Gene sequencing substrate and preparation method therefor, gene sequencing device, and gene sequencing method |
| US11708604B2 (en) | 2018-01-03 | 2023-07-25 | Beijing Boe Optoelectronics Technology Co., Ltd. | Gene sequencing substrate and method for manufacturing the same, gene sequencing device and gene sequencing method |
| WO2021179622A1 (en) * | 2020-03-13 | 2021-09-16 | 量准（上海）医疗器械有限公司 | Digital plasma immunosorbent kit, manufacturing method therefor and detection method therefor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104073425A (en) | LSPR (localized surface plasma resonance) sensing device and preparation method thereof as well as DNA detection method | |
| Jalandra et al. | Strategies and perspectives to develop SARS-CoV-2 detection methods and diagnostics | |
| Chen et al. | Nucleic acid amplification free biosensors for pathogen detection | |
| Saadati et al. | Recent advances on application of peptide nucleic acids as a bioreceptor in biosensors development | |
| Choi et al. | Clustered regularly interspaced short palindromic repeats-mediated amplification-free detection of viral DNAs using surface-enhanced Raman spectroscopy-active nanoarray | |
| Cheng et al. | Aptamer-based biosensors for label-free voltammetric detection of lysozyme | |
| CN1898398B (en) | Methods for determining nucleotide sequence information | |
| Shi et al. | Development of SPR biosensor for simultaneous detection of multiplex respiratory viruses | |
| JP4727109B2 (en) | Methods for sequencing nucleic acids | |
| Razmi et al. | Localized surface plasmon resonance biosensing of tomato yellow leaf curl virus | |
| JP7449269B2 (en) | Modular visual nucleic acid detection using enzyme-based nanotechnology | |
| JPWO2020102610A5 (en) | ||
| CN101592627A (en) | The making integrated approach of multichannel high-sensitive biosensor | |
| JP2004504036A5 (en) | ||
| WO2008018859A3 (en) | Diagnostic kit for determining genotypes of a human papilloma virus and method of using thereof | |
| Gilbride | Molecular methods for the detection of waterborne pathogens | |
| CN102352350A (en) | Same sequence primer transpositional nucleic acid amplification technology | |
| CN101464456A (en) | Method for virus detection by surface plasma resonance technology and chip used in the same | |
| Asghar et al. | Advancements in testing strategies for COVID-19 | |
| Li et al. | Overcoming the limitations of COVID-19 diagnostics with nanostructures, nucleic acid engineering, and additive manufacturing | |
| Khan et al. | Multichannel microfluidic virus sensor for rapid detection of respiratory viruses using virus-imprinted polymer for digital livestock farming | |
| Lee et al. | Enhanced bioaffinity sensing using surface plasmons, surface enzyme reactions, nanoparticles and diffraction gratings | |
| Messner et al. | Laser-fabricated cell patterning stencil for single cell analysis | |
| Xiang et al. | Graphene oxide and molecular beacons-based multiplexed DNA detection by synchronous fluorescence analysis | |
| CN100378228C (en) | False complementary peptide nucleic acid probe biochip and detection method based on SPR principle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Kezheng Inventor after: Wu Yuliang Inventor before: Li Kezheng Inventor before: Wu Yuliang Inventor before: Yu Hongyu |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160105 Address after: 518000, room 5, 601 west shore village, Shenzhen, Guangdong, Baoan District Applicant after: Li Kezheng Address before: Silver Star Technology Building No. 1301 Longhua District of Guangdong city of Shenzhen Province Tourism Road 518000 6 floor Applicant before: SHENZHEN WEIXIN HUACHUANG SCIENCE & TECHNOLOGY CO., LTD. |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160510 Address after: Zhenjiang City, Jiangsu Province, 212000 Jingkou District Road No. 118 building 211 room two Applicant after: Zhenjiang WeThink Biological Technology Co., Ltd. Address before: 518000, room 5, 601 west shore village, Shenzhen, Guangdong, Baoan District Applicant before: Li Kezheng |
|
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141001 |
|
| RJ01 | Rejection of invention patent application after publication |