CN104059994A - Kit based on serum miRNA as well as use method and application of kit - Google Patents

Abstract

The invention belongs to the technical field of biology and in particular relates to a kit based on serum miRNA as well as a use method of the kit and application of the kit to early infection detection of fever with thrombocytopenia syndrome viruses. MiRNA molecules comprise hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and hsa-miR-511-3p. The expression of the four miRNAs in early attack of the fever with thrombocytopenia syndrome viruses is specifically and remarkably increased through identification by adopting a Taqman low-density chip and a qRT-PCR (quantitative reverse transcription polymerase chain reaction) method. The four serum miRNAs are used as molecular targets, and a quick, sensitive and specific detection method for acute infection of the fever with thrombocytopenia syndrome viruses is built. The hsa-miR-188-3p, the hsa-miR-517a-3p, the hsa-miR-518f-5p and the hsa-miR-511-3p are applied to early diagnosis of fever with thrombocytopenia syndrome virus infection, and the kit is used for detecting the hsa-miR-188-3p, the hsa-miR-517a-3p, the hsa-miR-518f-5p and the hsa-miR-511-3p.

Description

A kind of test kit and using method and application based on serum miRNA

Technical field

The invention belongs to biological technical field, be specifically related to a kind of test kit and using method and application in heating companion thrombopenia syndrome virus early infection detects based on serum miRNA.

Background technology

Heating companion's thrombopenia syndrome (severe fever with thrombocytopenia syndrome, SFTS) is the newfound a kind of hemorrhagic diseases being caused by bunyavirus of China recent years, and cause of disease is referred to as SFTS virus.The rural area of the main distribution mountain area of this disease and hilly country, is and distributes, the general susceptible of crowd.Clinical manifestation is heating, and body temperature is many more than 38 DEG C, accompanies weak, nauseating, vomiting etc., and some cases has headache, sore muscle, diarrhoea etc.Overwhelming majority patient prognosis bona, but the some cases state of an illness is critical, there are the disturbance of consciousness, the dermal ecchymosis, digestive tract hemorrhage, pulmonary apoplexy etc., can be because of MOFE death such as shock, respiratory insufficiency, disseminated intravascular coagulations, severe mortality ratio is up to 15-30%.At present all find SFTS case at Henan, Hubei, Shandong, Anhui, Liaoning, Jiangsu, the zhejiang and other places of China.All found in Japan, Korea S and the U.S. case being caused by SFTS correlated virus in the recent period, shown that viral distribution range is wider, SFTS has become threat human health and sanitarian important emerging infectious disease.

At present mainly contain viral separation, serological method and viral nucleic acid detection method etc. for the diagnostic method of SFTS.Virus separates time and effort consuming, and the requirement of the Biosafety of test operation is high, and common laboratory is difficult to carry out.The serological method of detection specificity IgG antibody is applicable to retrospective diagnosis and epidemiology survey, and the method susceptibility of detection early antibody IgM is poor.The viral nucleic acid of PCR-based detects quick, special and responsive feature, but will depend on the appearance of viremia.Therefore, set up a kind of for the early stage diagnostic method of SFTS virus infection, significant for clinical treatment and the prevention and control of disease.MicroRNA (miRNA) is an anthropoid interior naturally occurring non-coding RNA, at post-transcriptional level, gene is carried out to negative regulation, the multiple important vital movement that participates in regulating cell, comprises growth, differentiation, growth, stable state, stress reaction, apoptosis, immuno-stimulating and tumour generation etc.In the various diseases evolution of (comprising virus disease), miRNA is also playing the part of key player.From the angle of medical diagnosis on disease, the miRNA of unconventionality expression can be used as the molecular target of medical diagnosis on disease, and the research of this respect at present mainly concentrates on the aspect such as cancer, metabolic disease.MiRNA also plays an important role in virus infection, and research shows the infection such as influenza virus, enterovirus, hepatitis B virus, can cause the differential expression of miRNA in human serum.In serum, ripe miRNA molecule has the stability of height, and still can detect after viremia disappears.Therefore, set up a kind of detection method based on serum miRNA, significant for the early diagnosis of SFTS virus acute infection.

Summary of the invention

The problem that the present invention need to solve is to provide a kind of test kit and using method and application in heating companion thrombopenia syndrome virus early infection detects based on serum miRNA.

The test kit of detection heating companion thrombopenia syndrome virus acute infection specificity miRNA provided by the invention is made up of AMV reverse transcription system, PCR reaction system, miR-16 internal reference, negative quality control product and 4 kinds of miRNA Auele Specific Primer probes; 4 kinds of miRNA titles and sequence be respectively: hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA,

Hsa-miR-517a-3p AUCGUGCAUCCCUUUAGAGUGU, hsa-miR-518f-5pCUCUAGAGGGAAGCACUUUCUC and hsa-miR-511-3p AAUGUGUAGCAAAAGACAGA.

The using method of a kind of test kit based on miRNA of the present invention in heating companion thrombopenia syndrome virus early infection detects:

The detection of SFTS acute infection serum miRNA differential expression: collect 6 parts of SFTS Patients with Acute serum, 6 parts of healthy normal serums, two groups of serum (every part of 200 μ L) are mixed respectively, adopt phenol chloroform method to extract total RNA.The detection of miRNA differential expression adopts TaqMan ArrayHuman v3.0 chip (Applied Biosystems, USA) to detect.Total RNA reverse transcription of extracting adopts Taqman MiRNA ReverseTranscription Kit (Applied Biosystems, USA).The cDNA obtaining carries out PCR, then carries out qRT-PCR reaction.. adopt SDS software v2.3 and RQ Manager v1.2.1 (Applied Biosystems) software to carry out data analysis.CT value is more than or equal to 40 and is defined as and does not detect

Serum differential expression miRNA checking: the remarkable miRNA of SFTS acute infection person serum differential expression is verified by qRT-PCR.The miRNA Auele Specific Primer probe of checking has U.S. Applied Biosystems design synthetic, adopts the strand miR-16 of synthetic as standard substance.Test-results adopts SPSS18.0 software to carry out statistical analysis, and data representation method is median soil SD, relatively adopts t inspection between group, and P<0.05 is significant difference.Result filters out 6 kinds of miRNA and can be used as the molecular target of early diagnosis that SFTS infects.

Compared with prior art, the invention has the beneficial effects as follows:

Express by detecting the serum miRNA that SFTS virus infection is relevant, can make early diagnosis to virus infection, and do not rely on the appearance of viremia, there is the features such as quick, responsive, special, for clinical treatment and disease control provide a kind of new detection method and important experimental basis.

Brief description of the drawings

Fig. 1 qRT-PCR detects the expression level of hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and hsa-miR-511-3p in acute infection serum

Fig. 2 ROC curve is evaluated hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and the diagnostic value of hsa-miR-511-3p in SFTSV acute infection

Embodiment

Provide specific embodiment further to set forth technical scheme of the present invention below, but the application of the technology of the present invention is not limited to embodiment.

Embodiment 1: the total RNA of serum extracts

Collect 6 parts of SFTS Patients with Acute serum, 6 parts of healthy normal serums, two groups of serum (every part of 200 μ L) are mixed respectively, adopt phenol chloroform method to extract total RNA, concrete steps: 1. get 100ul serum sample and add in the 1.5ml EP that contains 300ul DEPC water, after add 1ul10f/ul cel-miR-238 for parametric calibration, after fully mixing, add 200ul water-saturated phenol, concuss mixes, leave standstill 3min, add 200ul chloroform, fully concussion mixes rear 16000g room temperature centrifugal 15 minutes again.Draw supernatant liquor, add the Virahol of twice supernatant volume, then add the about 40ul of 1/10 supernatant volume 3M sodium-acetate, fully mix after-20 DEG C of standing 2h, after at 4 DEG C, 16000g, centrifugal 20min.3. abandon supernatant, add 75% ethanol 1ml, 4 DEG C, 16000g, centrifugal 20min.4. abandon supernatant, drying at room temperature, adds 20ul DEPC water dissolution RNA.

Embodiment 2:SFTS acute infection serum miRNA differential expression detects

Adopt TaqMan Array Human v3.0 chip (Applied Biosystems, USA) to detect.Every group of sample detects 212 kinds of miRNA on Array A plate, and internal reference is selected U6snRNA.1. reverse transcription adopts Taqman MiRNA Reverse Transcription Kit (AppliedBiosystems, USA): total 50ng RNA is added to 4.5ul Megaplex pool reverse transcription mixed solution, comprise Megaplex RT Primers (10 ×) 0.8 μ l, dNTPs0.2 μ l, (50U/ μ is 1.5 μ l l) for MultiScribe Reverse Transcriptase, RT Buffer (10 ×) 0.8 μ l, MgCl2 (25mM) 0.9 μ l, (20U/ μ is 0.1 μ l l), Nuclease-free water0.2 μ l for RNase inhibitor.2. amplification in advance: TaqMan PreAmp Mastermix (2 ×) 12.5 μ l and Megaplex PreAmp Primer (10 ×) 2.5 μ l carry out, reverse transcription product 2.5 μ l, Nuclease-free water7.5 μ l.3.qRT-PCR reaction on 7900HT instrument (Applied Biosystems) is carried out: dilute 4 times of pre-amplification reaction solutions with 0.1 × TE pH8.0, each cut back 9 μ l mix with TaqMan2 × Universal PCR Master Mix450 μ l, Nuclease-free water441 μ l, get 100 μ l reaction mix and add sampling point on Array A plate, centrifugal 2 times of 1200rpm, each 1min.4. data analysis: adopt SDS software v2.3, the analysis of miRNA expression level adopts RQ Manager v1.2.1 (Applied Biosystems), CT value is more than or equal to 40 and is defined as and does not detect.

Result show, compared with Healthy Human Serum, the specific expressed rise of SFTS acute infection person serum miRNA have 30.

Embodiment 3: serum differential expression miRNA checking

30 kinds of miRNA that the SFTS acute infection person serological specificity obtaining in embodiment 2 is expressed carry out qRT-PCR checking.Confirmatory experiment is selected 58 parts of serum, and wherein 29 parts is SFTS acute stage of infection serum, and 29 parts is Healthy Human Serum.Detecting 30 kinds of miRNA Auele Specific Primer probes has U.S. Applied Biosystems design synthetic, adopts the strand miR-16 of synthetic as reference gene standard substance.The every increment that detects miRNA in 22 originally all does three repetitions, and differential expression is 2-(Δ CtmiRNA-Δ Ctcontrol) calculating for level.This experiment adopts SPSS18.0 software to carry out statistical analysis, and data representation method is median soil SD, relatively adopts t inspection between group, and P<0.05 is significant difference.

The differential expression of SFTS patient and Zheng ordinary person Xue Cheongju miRNA contrast in table 1 case group and control group.

The result shows, compared with normal healthy controls group serum, in SFTS acute infection serum, hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and hsa-miR-511-3p expression level significantly raise, as shown in Figure 1.ROC tracing analysis also shows, hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and hsa-miR-511-3p, in infecting and detecting with the discriminating of healthy serum, have good specificity and susceptibility, as shown in Figure 2.Therefore, these four kinds of miRNA can be used as the molecular target of the early diagnosis of SFTS infection.

Embodiment 3: the preparation of detection kit

Application quantitative fluorescent PCR (qRT-PCR) principle, prepare a kind of companion of the heating based on serum miRNA thrombopenia syndrome virus early infection detection kit, the integral part of test kit is AMV reverse transcription system, PCR reaction system, miR-16 internal reference, negative quality control product and 4 kinds of serum miRNA (hsa-miR-188-3p, hsa-miR-517a-3p, hsa-miR-518f-5p and hsa-miR-511-3p) Auele Specific Primer probe.Concrete detecting step:

(1) reverse transcription: the mother liquor according to AMV reverse transcription system configurations except RNA, RT-Primer, mixes 7 μ l mother liquors, 2 μ lRNA with 1 μ l primer.Response procedures is: the first step: 16 DEG C, and 15min; Second step: 42 DEG C, 60min; The 3rd step: 85 DEG C, 5min; The 4th step: be cooled to 4 DEG C.Negative control cDNA preparation is carried out with sample cDNA preparation simultaneously, with DEPC water replacement RNA.

(2) qRT-PCR detects: the mother liquor in configuration qRT-PCR system except cDNA and probe.1 μ l cDNA, 0.33 μ l Probe are evenly mixed with 14.77 μ l mother liquors, and every kind of miRNA of each sample detects three multiple holes, add in 96 hole PCR plates, in every plate, add respectively the multiple hole of miR-16 sample system mixture each three of 10-3,10-4,10-5,10-6, mix.On ABI7900 quantitative real time PCR Instrument, carry out qRT-PCR reaction, reaction conditions is 95 DEG C of 5min; 95 DEG C of 15s, 60 DEG C of 1min, 40 circulations.

(3) result is judged: detect between sample and negative control and relatively adopt t inspection, P<0.05 is significant difference, is judged to the Samples detection positive.

<110> Jiangsu Prov. Disease Preventing and Controlling Center

<120> companion's thrombopenia syndrome virus early infection detection kit of the heating based on serum miRNA and application

<160>9

<210>1

<211>50

<212>DNA

<213> artificial sequence

<400>1

hsa-miR-188-3p （CUCCCACAUGCAGGGUUUGCA）

<210>2

<211>29

<212>DNA

<213> artificial sequence

<400>2

hsa-miR-517a-3p（AUCGUGCAUCCCUUUAGAGUGU）

<210>3

<211>47

<212>DNA

<213> artificial sequence

<400>3

hsa-miR-518f-5p（CUCUAGAGGGAAGCACUUUCUC

<210>4

<211>30

<212>DNA

<213> artificial sequence

<400>4

hsa-miR-518f-5p（CUCUAGAGGGAAGCACUUUCUC

Claims (3)

1. the test kit based on serum miRNA, the integral part that it is characterized in that test kit is AMV reverse transcription system, PCR reaction system, miR-16 internal reference, negative quality control product and 4 kinds of miRNA Auele Specific Primer probes; 4 kinds of miRNA titles and sequence be respectively: hsa-miR-188-3pCUCCCACAUGCAGGGUUUGCA, hsa-miR-517a-3p AUCGUGCAUCCCUUUAGAGUGU, hsa-miR-518f-5pCUCUAGAGGGAAGCACUUUCUC and hsa-miR-511-3p AAUGUGUAGCAAAAGACAGA.

2. a kind of using method of the test kit based on serum miRNA according to claim 1, is characterized in that being made up of following steps:

(1) reverse transcription: the mother liquor according to AMV reverse transcription system configurations except RNA, RT-Primer, 7 μ l mother liquors, 2 μ lRNA are mixed with 1 μ l primer, response procedures is: the first step: 16 DEG C, 15min; Second step: 42 DEG C, 60min; The 3rd step: 85 DEG C, 5min; The 4th step: be cooled to 4 DEG C, negative control cDNA preparation is carried out with sample cDNA preparation simultaneously, with DEPC water replacement RNA;

(2) qRT-PCR detects: the mother liquor in configuration qRT-PCR system except cDNA and probe, 1 μ l cDNA, 0.33 μ l Probe are evenly mixed with 14.77 μ l mother liquors, and every kind of miRNA of each sample detects three multiple holes, add in 96 hole PCR plates, in every plate, add respectively the multiple hole of miR-16 sample system mixture each three of 10-3,10-4,10-5,10-6, mix, carry out qRT-PCR reaction on ABI7900 quantitative real time PCR Instrument, reaction conditions is 95 DEG C of 5min; 95 DEG C of 15s, 60 DEG C of 1min, 40 circulations;

(3) result is judged: detect between sample and negative control and relatively adopt t inspection, P<0.05 is significant difference, is judged to the Samples detection positive.

3. the application of a kind of test kit based on serum miRNA in heating companion thrombopenia syndrome virus early infection detects described in claim 1.