CN104032024A - Single nucleotide polymorphism (SNP) molecular marker primer of pear fruit juice content main effect quantitative trait locus (QTL) and application thereof - Google Patents

Single nucleotide polymorphism (SNP) molecular marker primer of pear fruit juice content main effect quantitative trait locus (QTL) and application thereof Download PDF

Info

Publication number
CN104032024A
CN104032024A CN201410277426.1A CN201410277426A CN104032024A CN 104032024 A CN104032024 A CN 104032024A CN 201410277426 A CN201410277426 A CN 201410277426A CN 104032024 A CN104032024 A CN 104032024A
Authority
CN
China
Prior art keywords
juice content
snp
pear
qjuice
fruit juice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410277426.1A
Other languages
Chinese (zh)
Other versions
CN104032024B (en
Inventor
张绍铃
吴俊�
李雷廷
姚改芳
刘伦
杨雅楠
谢智华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201410277426.1A priority Critical patent/CN104032024B/en
Publication of CN104032024A publication Critical patent/CN104032024A/en
Application granted granted Critical
Publication of CN104032024B publication Critical patent/CN104032024B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a single nucleotide polymorphism (SNP) molecular marker primer of pear fruit juice content main effect quantitative trait locus (QTL) and application thereof. A forward primer sequence of a close linkage SNP mark Pyd05_008 of the pear fruit juice content main effect QTL is shown in SEQ ID NO.1 and a reverse primer sequence is shown in SEQ ID NO.2. The content of the fruit juice is identified by utilizing the specific primer based on a high resolution melting curve and can be parted well, so that the difference of the polymorphism expression fruit juice content on qJuice of QTL is determined. The pear fruit juice content main effect QTL molecular marker can be used for marker-assisted selective breeding of the phenotypic trait of the pear fruit juice content; for quickening the genetic improvement process of the pear species, the SNP molecular marker primer has the important theoretical and practical guiding significance in improving the breeding selection efficiency.

Description

SNP molecule marker primer and the application thereof in a kind of pear fruit juice content main effect QTL site
Technical field
The invention belongs to molecular genetic breeding field, relate to SNP molecule marker primer and the application thereof in a kind of pear fruit juice content main effect QTL site.
Background technology
China is one of world's pear (Pyrus L.) topmost area of origin of plant, and genetic diversity is abundant.The cultivar of pears is widely distributed, except Hainan Province and Taiwan Province, has cultivation.The tender and crisp succulence of pear flesh, sweet and sour taste, is liked by human consumer deeply.The content of the operatic circle juice not only affects the local flavor of fresh fruit, also contain the abundant nutritive ingredient that is conducive to HUMAN HEALTH, for example pear juice is cool in nature and energy heat-clearing is calm, in summer, there is the effect of quenching one's thirst and relieving summer heat, the composition such as contained glycoside and tannic acid in pear juice, energy expelling phlegm for arresting cough, has maintenance action to throat; In pear juice, also contain compared with polysaccharose substance and VITAMIN, be easily absorbed by the body, improve a poor appetite, liver is had to provide protection; Pectin content in pear juice is very high, contributes to digestion, tonneau stool.One of important evaluation index when therefore, the number of juice content is seed selection New pear variety.
Because most pears kinds are self-incompatible, the genetic composition apparent altitude heterozygosity of pears; Meanwhile, because the economical character majority of perennial fruit tree shows as Inheritance of Quantitative Characters feature, the important character genetic development research of relevant pears relatively lags behind, and is also difficult to carry out the genetic improvement of objective trait.In recent years, appearance along with the developing rapidly of molecular marking technique, highdensity molecular genetic linkage map, and quantitative character drawing method is constantly perfect, make quantitative trait locus (QTL) location become reality, also for improving possibility, accuracy and the foresight of destination number proterties excellent genes type selection, lay a good foundation.Utilize molecule marker location quantitative character QTL, its essence is exactly the linkage relationship between analyzing molecules mark and objective trait QTL, utilize the molecule marker at known seat to locate the QTL at unknown seat, by calculating the exchange rate between molecule marker and QTL, determine the particular location of QTL.Marker genetype separation based on obtaining and the relation between quantitative character phenotype, can directly determine the character site of controlling the size, and exploitation can be applicable to the technology of molecular marker assisted selection breeding, and this has obtained successful Application on many important farm crop.
The QTL Position Research of at present relevant pears quantitative character still belongs to the starting stage, existing research is mainly for some diseases or growth traits, and the Application and Development research of the polymorphism on the QTL location of pear juice content proterties and detection QTL site being expressed to the SNP molecule marker of juice content difference not yet has report.Therefore, carry out the QTL location of pear juice content proterties, based on corresponding sequence information development SNP molecule marker, and set up the early stage assisted Selection technical system of filial generation, for improving pear fruit quality, improve breeding efficiency, save production cost and seem particularly important.
Summary of the invention
The object of the invention is to locate pear fruit juice content main effect QTL, according to contribution site sequence information development, identify the SNP specific mark Pyd05_008 of pear fruit juice content based on high resolving power solubility curve, the polymorphism detecting on the qJuice of QTL site is expressed the difference of juice content.By this molecule marker, can predict the height of pear juice content, for realizing early stage evaluation and the screening of juice content proterties, provide the technical support of molecule assisted Selection.
Object of the present invention can be achieved through the following technical solutions:
With the closely linked SNP labeled primer in pear fruit juice content main effect QTL site, wherein:
Forward primer JUICE ?F:5 ’ ?ACACGCTGAATAGTTGGACTT ?3 ' (SEQ ID NO.1),
Reverse primer JUICE ?R:5 ’ ?GGTACGACTGAGAAGCTTTAAGT ?3 ' (SEQ ID NO.2).
SNP labeled primer of the present invention is to the application in pears molecular breeding, utilize the 123191st the base place of the pears genome sequence scaffold171.0 that described primer pair is AJSU00000000 based on high resolving power solubility curve identification and detection accession number whether to have a QTL site qJuice relevant to pear fruit juice content, the polymorphism simultaneously detecting on the qJuice of QTL site is expressed the difference of fruit juices content, the height of prediction pear fruit juice content, to realize early stage evaluation and the screening of pear fruit juice content proterties.
Wherein, described pear fruit juice content refers to that the fruit juice weight ratio that every 100g pulp squeezes is more than or equal to 40% more, and pear fruit juice content refers to that the fruit juice weight ratio that every 100g pulp squeezes is less than 20% less.
SNP labeled primer of the present invention is to the application in detecting pear fruit juice content main effect QTL site qJuice and SNP polymorphism thereof.
Primer of the present invention is for detection of the SNP marking method in pear fruit juice content main effect QTL site: utilize the SNP labeled primer described in claim 1 to carry out HRM reaction to pears genomic dna, if amplified production sequence size at 215bp, shows to exist a QTL site qJuice relevant to pear juice content; After PCR loop ends, melt, last, in the Gene Scanning software of 480II, 1.5version generates the melting curve of amplified production automatically, the upper juice content kind how of expressing of QTL site qJuice that the known pear juice content of take is respectively relevant is contrast with the few kind of expression juice content, and the polymorphism detecting on the qJuice of QTL site is expressed the difference of juice content.If the melting curve of the amplified production that unknown kind obtains is identical with the color of contrast, line style is similar, the juice content that is illustrated in the polymorphism expression on juice content main effect QTL site qJuice is similar with contrast.
Wherein, it is ' Dangshan pear ' that the upper polymorphism of described known relevant to pear juice content QTL site qJuice is expressed the kind that juice content is many, and expressing the few kind of juice content is ' BAYUEHONG '.
The reaction system of described HRM reaction according to specification sheets in 480High Resolution Melting Master test kit carries out, HRM analyze be on 480II quantitative real time PCR Instrument, carry out; 10 μ L reaction systems: contain 2ng μ L ?1pears genomic dna template, 1 * Master Mix, 2.0mmolL ?1mgCl 2, 0.2mmolL ?1primer claimed in claim 1; Amplification program adopts PCR:95 ℃ of denaturation 10min of landing-type, then 95 ℃ of sex change 10s, 60～55 ℃, and every circulation declines 0.5 ℃, and annealing 15s, 72 ℃ of programs of extending 12s are carried out 45 circulations; The program melting after PCR loop ends is: 95 ℃ of 1min, and 40 ℃ of 1min, 65 ℃ of 1s, then from 65 ℃ of continuous warmings to 95 ℃, 0.04 ℃ of every rising, collects fluorescence 1 time, is finally cooled to 40 ℃.
With the closely linked SNP mark of pear fruit juice content main effect QTL site qJuice, this molecule marker is by primer pair: forward primer JUICE ?F:SEQ ID NO.1 and reverse primer JUICE ?R:SEQ ID NO.2 amplification pears genomic dna obtain.
SNP of the present invention is marked at the application in pears molecular breeding, this molecule marker is positioned at the 11.5cM place of the 5th linkage group of pears, Kruskal-Wallis statistical test value is 16.238, remarkable under the conspicuous level of α=0.001, the LOD value of utilizing Interval Mapping is 3.15, explains 15.6% heritable variation.
SNP of the present invention is marked at the application detecting in pear fruit juice content main effect QTL site qJuice and SNP polymorphism thereof.
SNP mark of the present invention is for detection of the SNP marking method of pear fruit juice content main effect QTL site qJuice: utilize the SNP labeled primer described in claim 1 to carry out HRM reaction to pears genomic dna, if amplified production sequence size at 215bp, shows to exist a QTL site qJuice relevant to pear juice content; After PCR loop ends, melt, last, in the Gene Scanning software of 480II, 1.5version generates the melting curve of amplified production automatically, the upper juice content kind how of expressing of QTL site qJuice that the known pear juice content of take is respectively relevant is contrast with the few kind of expression juice content, and the polymorphism detecting on the qJuice of QTL site is expressed the difference of juice content.If the melting curve of the amplified production that unknown kind obtains is identical with the color of contrast, line style is similar, the juice content that is illustrated in the polymorphism expression on juice content main effect QTL site qJuice is similar with contrast; Wherein, it is ' Dangshan pear ' that the upper polymorphism of described known relevant to pear juice content QTL site qJuice is expressed the kind that juice content is many, and expressing the few kind of juice content is ' BAYUEHONG '.
Beneficial effect
(1) the present invention is first to determining that the quantitative trait locus of ' BAYUEHONG ' and ' Dangshan pear ' fruit juices content has carried out QTL location, the QTL site of location is to the extremely remarkable incidence relation (α=0.0001) of the existence of this quantitative character, and contribution rate is higher, the contribution rate in site is 15.6%.This is to realize the improvement of marker assisted selection controlled by multiple genes character inheritance to have established important basis and necessary prerequisite.
(2) generally believe at present and can be applicable to the linked marker of molecule assisted Selection and the distance need≤5cM of objective trait, in the present invention, juice content main effect QTL location is directly targeted on SNP mark, and Kruskal ?Wallis test value be 16.238, remarkable under the conspicuous level of α=0.0001, it is 3.15 that interval mapping detects LOD value, linksystem and reliability are high, and this is significant for the accuracy and efficiency that improves molecular marker assisted selection.
(3) the present invention detects the SNP labeled primer Pyd05_008 of pear juice content according to the pear juice content proterties main effect QTL site exploitation of location, be used for predicting that qJuice upper polymorphism in QTL site expresses juice content difference, for the selection in advance of pear fruit juice content provides reliable molecule marker source.
(4) the SNP labeled primer of exploitation, ' BAYUEHONG ' and ' Dangshan pear ' 37 strain hybrid Populations are carried out to the upper polymorphism of QTL site qJuice and express the detection of juice content Differential genotype, hybrid Population can be divided into two groups, many and juice content has higher coincidence rate less with the juice content of fruit actual observation.Population experiment shows, the SNP mark special primer of exploitation can carry out good somatotype (Fig. 2) to offspring's juice content, therefore, has good using value, can realize selection in advance and assistant breeding to pear fruit juice content proterties.
Accompanying drawing explanation
Fig. 1 is pear juice content main effect QTL interval and the position of SNP marker site Pyd05_008 in the 5th linkage group.What LG5 represented is the 5th linkage group that ' BAYUEHONG ' and ' Dangshan pear ' merges genetic linkage maps.SNP mark title is initiated with the representative of ' Pyb ' from the SNP mark of ' BAYUEHONG ', initial name is called the representative of ' Pyd ' from the SNP mark of ' Dangshan pear ', and initial name is called the representative while of ' Pybd ' from the SNP mark of ' BAYUEHONG ' and ' Dangshan pear '.
The numeral in linkage group left side is the genetic distance between mark, and unit is cM.The solid rectangle indication QTL mapping on linkage group right side is interval.The LOD distribution plan that the graphic representation on the right is QTL.Pyd05_008 mark in the corresponding linkage group in fruit juices content QTL site, it is positioned at the 5th linkage group 11.5cM place, and LOD value is 3.15.
Fig. 2 is the HRM specific mark primer according to SNP mark Pyd05_008 exploitation, the solubility curve detecting in 37 individualities of ' BAYUEHONG ' and ' Dangshan pear ' offspring, well somatotype.Melting curve: line style 1-red curve, 21 strains are individual, and wherein 19 strain juice contents are many; Line style 2-blue curve, 16 strains are individual, and wherein 12 strain juice contents are few.The coincidence rate of two groups is respectively 90% and 75%.
Embodiment
Embodiment 1:
The molecule marker of pear fruit juice content main effect QTL linkage, obtains by the following method:
A) (kind is public to utilize ' BAYUEHONG ' and ' Dangshan pear ', see document: Zhang Ruiping etc., the QTL location of pears AFLP mark genetic map construction and fruit correlated character, gardening journal, 2011,38 (10): 1991 – 1998) hybridization obtains its 102 strain F 1offspring's individual plant.
B) utilize RADseq method high-flux sequence, ' BAYUEHONG ' and ' Dangshan pear ' and offspring are analyzed, and the hereditary form of statistical study pleomorphism site in progeny population, χ utilized 2whether each mark separation of test Analysis meets the Mendelian inheritance segregation ratio of 3:1 or 1:1.
C) with Joinmap4.0 analysis software, build the Genetic Linkage Map spectrum of ' BAYUEHONG ' and ' Dangshan pear '.By b) the polymorphism mark site that obtains in step imports Joinmap4.0 by the form that is suitable for CP colony composition in Joinmap4.0 analysis software, get rid of the too much site of missing data and remarkable partially separated site, the P value that card side is detected is 0.05, selects Kosambi mapping function to build genetic linkage map.
D) to ' BAYUEHONG ' and ' Dangshan pear ' and F thereof 1the fruit juices content of colony's individual plant is evaluated.To test fruit peeling chopping, evenly mix, and adopt quartering to get the pulp of certainweight, weigh fruit juice weight after squeezing into juice with juice extractor.Juice content (%)=fruit juice weight/pulp weight.Pear fruit juice content refers to that the fruit juice weight ratio that every 100g pulp squeezes is more than or equal to 40% more, and juice content refers to that the fruit juice weight ratio that every 100g pulp squeezes is less than 20% less.
E) associated documents of the phenotypic number of juice content and label information are imported to MapQTL5.0 software, select Interval Mapping, take LOD value >=3.0 as standard, the juice content of pears is carried out to qtl analysis and location.Result shows, the main effect QTL site qJuice (Fig. 1) of juice content in the 5th linkage group of ' BAYUEHONG ' and ' Dangshan pear ', detected, to the contribution rate of this proterties, be 15.6%, the genetic distance of its corresponding SNP mark Pyd05_008 in linkage group is 11.5cM, and LOD value is 3.15.
F) utilize SNP marker site Pyd05_008 exploitation HRM special primer.
By the full genome database of pears (http://peargenome.njau.edu.cn/), the pears genome sequence scaffold171.0 that is AJSU00000000 from accession number, search out the DNA sequence dna of SNP mark Pyd05_008 in the 5th linkage group, the sequence of 300bp before and after this site of choosing, according to design of primers principle, development and Design SNP labeled primer.Forward primer sequence JUICE ?F be ' 5 ?ACACGCTGAATAGTTGGACTT ?3 '; Reverse primer JUICE ?R be 5 ‘ ?GGTACGACTGAGAAGCTTTAAGT ?3 '.Amplified production sequence size 215bp, utilizes the SNP labeled primer of design in the enterprising performing PCR amplification of genomic dna of ' BAYUEHONG ' and ' Dangshan pear ', and primer all increases normally, and PCR product meets prediction size.Therefore, this primer can be used as the certification mark of pear juice content proterties.
G) utilize HRM technology to carry out somatotype to pear fruit juice content.
HRM reaction system according to specification sheets in 480High Resolution Melting Master test kit carries out, HRM analyze be on 480II quantitative real time PCR Instrument, carry out.
10 μ L reaction systems: contain 2ng μ L ?1pears genomic dna template, 1 * Master Mix, 2.0mmolL ?1mgCl 2, 0.2mmolL ?1primer JUICE ?F/JUICE ?R; Amplification program adopts landing-type PCR (touchdown PCR): 95 ℃ of denaturation 10min, then 95 ℃ of sex change 10s, 60～55 ℃ of (every circulation declines 0.5 ℃) annealing 15s, 72 ℃ of programs of extending 12s are carried out 45 circulations.
After PCR loop ends, melt, its program is: 95 ℃ of 1min, and 40 ℃ of 1min, 65 ℃ of 1s, then from 65 ℃ of continuous warmings to 95 ℃, 0.04 ℃ of every rising, collects fluorescence 1 time, is finally cooled to 40 ℃.
Finally, exist in the Gene Scanning software of 480II, 1.5version generates the melting curve of amplified production automatically
Utilizing g) the SNP labeled primer that obtains in step carries out HRM analysis (Fig. 2) to the 37Ge filial generation colony of ' BAYUEHONG ' * ' Dangshan pear '.
Line style 1-red curve, 21 individual line styles are similar, and wherein 19 individualities are that juice content is many;
Line style 2-blue curve, 16 individual line styles are similar, and wherein 12 individualities are that juice content is few.
Statistical study shows, 37 individual somatotypes are two kinds of genotype, and segregation ratio is 21:16.According to the upper polymorphism of QTL site qJuice, express juice content differential gene somatotype result 37 individual juice content phenotypic datas are carried out to chi square test (P=0.00005), test result shows that juice content is how many relevant with genotype, and the coincidence rate of two groups is respectively 90% and 75%.Therefore,, by the comparative analysis of the phenotype test result to juice content proterties and HRM somatotype result, prove that this special SNP mark can detect the difference of the polymorphism expression juice content on the qJuice of QTL site, to the good somatotype of pear fruit juice content.

Claims (10)

1. with the closely linked SNP labeled primer of pear fruit juice content main effect QTL site qJuice, it is characterized in that: forward primer JUICE ?F:SEQ ID NO.1, reverse primer JUICE ?R:SEQ ID NO.2.
2. SNP labeled primer claimed in claim 1 is to the application in pears molecular breeding, it is characterized in that utilizing the 123191st the base place of the pears genome sequence scaffold171.0 that described primer pair is AJSU00000000 based on high resolving power solubility curve identification and detection accession number whether to have a QTL site qJuice relevant to pear fruit juice content, the polymorphism simultaneously detecting on this QTL site is expressed the difference of fruit juices content, the height of prediction pear fruit juice content, to realize early stage evaluation and the screening of pear fruit juice content proterties.
3. SNP labeled primer claimed in claim 1 is to the application in detecting pear fruit juice content main effect QTL site qJuice and SNP polymorphism thereof.
4. primer claimed in claim 1 is for detection of the SNP marking method of pear fruit juice content main effect QTL site qJuice, it is characterized in that: utilize the SNP labeled primer described in claim 1 to carry out HRM reaction to pears genomic dna, if amplified production sequence size at 215bp, shows to exist a QTL site qJuice relevant to pear juice content; After PCR loop ends, melt, last, in the Gene Scanning software of 480II, 1.5version generates the melting curve of amplified production automatically, the upper juice content kind how of expressing of QTL site qJuice that the known pear juice content of take is respectively relevant is contrast with the few kind of expression juice content, and the polymorphism detecting on the qJuice of QTL site is expressed the difference of juice content.If the melting curve of the amplified production that unknown kind obtains is identical with the color of contrast, line style is similar, the juice content that is illustrated in the polymorphism expression on juice content main effect QTL site qJuice is similar with contrast.
5. SNP marking method according to claim 4, it is characterized in that: it is ' Dangshan pear ' that the upper polymorphism of described known relevant to pear juice content QTL site qJuice is expressed the kind that juice content is many, and expressing the few kind of juice content is ' BAYUEHONG '.
6. SNP marking method according to claim 4, is characterized in that: the reaction system of described HRM reaction according to specification sheets in 480High Resolution Melting Master test kit carries out, HRM analyze be on 480II quantitative real time PCR Instrument, carry out; 10 μ L reaction systems: contain 2ng μ L ?1pears genomic dna template, 1 * Master Mix, 2.0mmolL ?1mgCl 2, 0.2mmolL ?1primer claimed in claim 1; Amplification program adopts PCR:95 ℃ of denaturation 10min of landing-type, then 95 ℃ of sex change 10s, 60～55 ℃, and every circulation declines 0.5 ℃, and annealing 15s, 72 ℃ of programs of extending 12s are carried out 45 circulations; The program melting after PCR loop ends is: 95 ℃ of 1min, and 40 ℃ of 1min, 65 ℃ of 1s, then from 65 ℃ of continuous warmings to 95 ℃, 0.04 ℃ of every rising, collects fluorescence 1 time, is finally cooled to 40 ℃.
7. with the closely linked SNP mark of pear fruit juice content main effect QTL site qJuice, it is characterized in that this molecule marker is by primer pair: forward primer JUICE ?F:SEQ ID NO.1 and reverse primer JUICE ?R:SEQ ID NO.2 amplification pears genomic dna obtain.
8. SNP claimed in claim 7 is marked at the application in pears molecular breeding, it is characterized in that this molecule marker is positioned at the 11.5cM place of the 5th linkage group of pears, Kruskal-Wallis statistical test value is 16.238, remarkable under the conspicuous level of α=0.001, the LOD value of utilizing Interval Mapping is 3.15, explains 15.6% heritable variation.
9. SNP claimed in claim 7 is marked at the application detecting in pear fruit juice content main effect QTL site qJuice and SNP polymorphism thereof.
10. SNP mark claimed in claim 7 is for detection of the SNP marking method of pear fruit juice content main effect QTL site qJuice, it is characterized in that: utilize the SNP labeled primer described in claim 1 to carry out HRM reaction to pears genomic dna, if amplified production sequence size at 215bp, shows to exist a QTL site qJuice relevant to pear juice content; After PCR loop ends, melt, last, in the Gene Scanning software of 480II, 1.5version generates the melting curve of amplified production automatically, the upper juice content kind how of expressing of QTL site qJuice that the known pear juice content of take is respectively relevant is contrast with the few kind of expression juice content, and the polymorphism detecting on the qJuice of QTL site is expressed the difference of juice content.If the melting curve of the amplified production that unknown kind obtains is identical with the color of contrast, line style is similar, the juice content that is illustrated in the polymorphism expression on juice content main effect QTL site qJuice is similar with contrast; Wherein, it is ' Dangshan pear ' that the upper polymorphism of described known relevant to pear juice content QTL site qJuice is expressed the kind that juice content is many, and expressing the few kind of juice content is ' BAYUEHONG '.
CN201410277426.1A 2014-06-19 2014-06-19 The SNP marker primer in a kind of pear fruit juice content main effect QTL site and application thereof Active CN104032024B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410277426.1A CN104032024B (en) 2014-06-19 2014-06-19 The SNP marker primer in a kind of pear fruit juice content main effect QTL site and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410277426.1A CN104032024B (en) 2014-06-19 2014-06-19 The SNP marker primer in a kind of pear fruit juice content main effect QTL site and application thereof

Publications (2)

Publication Number Publication Date
CN104032024A true CN104032024A (en) 2014-09-10
CN104032024B CN104032024B (en) 2017-01-04

Family

ID=51463018

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410277426.1A Active CN104032024B (en) 2014-06-19 2014-06-19 The SNP marker primer in a kind of pear fruit juice content main effect QTL site and application thereof

Country Status (1)

Country Link
CN (1) CN104032024B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164368A (en) * 2017-07-19 2017-09-15 中国农业科学院郑州果树研究所 The molecular labeling Marker37152 in the operatic circle heart size main effect QTL site and its primer pair and application
CN107267504A (en) * 2017-06-23 2017-10-20 南京农业大学 A kind of SNP marker and its application that the high Stone cell content of pear flesh is identified based on high-resolution solubility curve

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103740828A (en) * 2014-01-14 2014-04-23 南京农业大学 SNP (Single Nucleotide Polymorphism) molecular marking method for major QTL (Quantitative Trait Locus) in fruit stem length of pear fruit and application thereof
CN103740829A (en) * 2014-01-14 2014-04-23 南京农业大学 SNP marking method on main effect QTL site of longitudinal diameter of pear fruit and application thereof
CN103773864A (en) * 2014-01-14 2014-05-07 南京农业大学 SNP (Single Nucleotide Polymorphism) marking method of pear fruit transverse diameter main-effect QTL (Quantitative Trait Locus) and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103740828A (en) * 2014-01-14 2014-04-23 南京农业大学 SNP (Single Nucleotide Polymorphism) molecular marking method for major QTL (Quantitative Trait Locus) in fruit stem length of pear fruit and application thereof
CN103740829A (en) * 2014-01-14 2014-04-23 南京农业大学 SNP marking method on main effect QTL site of longitudinal diameter of pear fruit and application thereof
CN103773864A (en) * 2014-01-14 2014-05-07 南京农业大学 SNP (Single Nucleotide Polymorphism) marking method of pear fruit transverse diameter main-effect QTL (Quantitative Trait Locus) and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ZHANG R-P ET AL.: "An AFLP, SRAP, and SSR Genetic Linkage Map and Identification of QTLs for Fruit Traits in Pear", 《PLANT MOLECULAR BIOLOGY REPORTER》 *
韩明丽 等: "梨遗传连锁图谱的构建及部分果实性状QTL的定位", 《园艺学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107267504A (en) * 2017-06-23 2017-10-20 南京农业大学 A kind of SNP marker and its application that the high Stone cell content of pear flesh is identified based on high-resolution solubility curve
CN107267504B (en) * 2017-06-23 2020-07-24 南京农业大学 SNP (Single nucleotide polymorphism) marker for identifying pear pulp high stone cell content based on high resolution dissolution curve and application of SNP marker
CN107164368A (en) * 2017-07-19 2017-09-15 中国农业科学院郑州果树研究所 The molecular labeling Marker37152 in the operatic circle heart size main effect QTL site and its primer pair and application
CN107164368B (en) * 2017-07-19 2020-12-04 中国农业科学院郑州果树研究所 Molecular Marker37152 of pear fruit heart size major QTL site and primer pair and application thereof

Also Published As

Publication number Publication date
CN104032024B (en) 2017-01-04

Similar Documents

Publication Publication Date Title
CN106755483A (en) A kind of SSR molecular marker II for identifying Gala apple Progeny plants and its application
CN103740828B (en) SNP (Single Nucleotide Polymorphism) molecular marking method for major QTL (Quantitative Trait Locus) in fruit stem length of pear fruit and application thereof
CN103740829B (en) SNP marking method on main effect QTL site of longitudinal diameter of pear fruit and application thereof
Hu et al. Population structure of Betula albosinensis and Betula platyphylla: evidence for hybridization and a cryptic lineage
CN103773864B (en) A kind of SNP marker method of pear fruit transverse diameter main effect QTL site and application thereof
CN102140455B (en) Molecular marker for single fruit weight main-effect quantitative trait loci (QTL) of Dangshansu pear fruit and application thereof
CN106591460B (en) Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application
Alessandri et al. Genetic characterization of Italian and Spanish wild and domesticated chestnut trees
CN105296472B (en) The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely
CN102154273B (en) Molecular marker of single fruit weight major quantitative trait loci (QTL) of August red pyrus L. fruits and application of molecular marker
CN104004749B (en) Chain SSR labeled primer and the application thereof of cucumber black fruit Ci Jiyin B
CN102599047A (en) Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat
CN106460063A (en) SNP combination for Chinese cabbage genetic resources diversity analysis and molecular breeding and application thereof
CN104032024B (en) The SNP marker primer in a kind of pear fruit juice content main effect QTL site and application thereof
CN107760798B (en) SSR molecular marker of seedless major QTL (quantitative trait locus) of grape fruit
CN105803083A (en) Molecular marker of pear fruit single fruit weight main-effect QTL (quantitative trait loci) site MSF, and application thereof
CN113462813B (en) Site linked with pear peel red character, molecular marker and application thereof
CN104032018B (en) The SNP marker primer in a kind of melonidum skin smoothness main effect QTL site and application thereof
CN104762298A (en) Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof
CN104032021B (en) SNP molecular labeling primer and the application thereof in a kind of pear fruit seed amount main effect QTL site
CN102071194B (en) Molecular marker of major quantitative trait locus (QTL) of fruit stone cell content of Dangshan pear
CN105713983B (en) A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage
CN104762299B (en) A kind of rice seedling resistant gene of salt qST2 and its molecule labelling method
CN113481320A (en) Site linked with pear peel red character, molecular marker and application thereof
Wang et al. Genetic relationships among Cucurbita pepo ornamental gourds based on EST-SSR markers.

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant