CN104032004B - A kind of method for identifying molecules of Islamic meat product - Google Patents

A kind of method for identifying molecules of Islamic meat product Download PDF

Info

Publication number
CN104032004B
CN104032004B CN201410259544.XA CN201410259544A CN104032004B CN 104032004 B CN104032004 B CN 104032004B CN 201410259544 A CN201410259544 A CN 201410259544A CN 104032004 B CN104032004 B CN 104032004B
Authority
CN
China
Prior art keywords
primer
carnis
degree
znyr
islamic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410259544.XA
Other languages
Chinese (zh)
Other versions
CN104032004A (en
Inventor
曹晓虹
陈海魁
于淑坤
龚波林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
North Minzu University
Original Assignee
North Minzu University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by North Minzu University filed Critical North Minzu University
Priority to CN201410259544.XA priority Critical patent/CN104032004B/en
Publication of CN104032004A publication Critical patent/CN104032004A/en
Application granted granted Critical
Publication of CN104032004B publication Critical patent/CN104032004B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the method for identifying molecules of a kind of Islamic meat product, the method for identifying molecules of this Islamic meat product includes: take detected sample 25mg, use universal pillar genome to extract test kit and extract genomic DNA, in operating procedure during Proteinase K digestion, take overnight to process, digestion time more than 10 hours；Use primer 16SA-SB-ZNYF and the 16SA-SB-ZNYR of design, the DNA extracted carried out pcr amplification, 94 degree of 4min of PCR response procedures, 94 degree of 30s, 53 degree of 30s, 72 degree of 1.5min, 72 degree 10 minutes；Then by amplified production, intergrowth thing order-checking company use 3730 sequencer；By order-checking product and the sequence association provided, use Clustalx software to compare, and build NJ tree, identify and whether have the non-Islamic composition of Carnis Sus domestica Carnis Canitis and Carnis Equi Asini to exist.The present invention is directed to Carnis Sus domestica and newly devise special-purpose amplification primer, it is possible to high efficiency amplification Carnis Sus domestica DNA, even if food can also be identified containing trace Carnis Sus domestica, Carnis Canitis or Carnis Equi Asini DNA, it is possible to accurately distinguish out Carnis Sus domestica, Carnis Canitis or Carnis Equi Asini composition.

Description

A kind of method for identifying molecules of Islamic meat product
Technical field
The invention belongs to technical field of food detection, particularly relate to the method for identifying molecules of a kind of Islamic meat product.
Background technology
The step of existing detection technique is more, and operation sequence is relatively complicated, and the dynamics containing trace pork detection in food be there is no guarantee that.
Summary of the invention
The purpose of the embodiment of the present invention is in that to provide the method for identifying molecules of a kind of Islamic meat product, it is intended to the step solving existing detection technique is more, and operation sequence is relatively complicated, the problem that the dynamics containing trace pork detection in food be there is no guarantee that.
The embodiment of the present invention is achieved in that the method for identifying molecules of a kind of Islamic meat product, and the method for identifying molecules of this Islamic meat product comprises the following steps:
The first step, takes detected sample 25mg, uses universal pillar genome to extract test kit and extracts genomic DNA, in operating procedure during ProteinaseK digestion, takes overnight to process, digestion time more than 10 hours；
Second step, uses primer 16SA-SB-ZNYF and the 16SA-SB-ZNYR of design, and the DNA extracted carried out pcr amplification, 94 degree of 4min of PCR response procedures, 94 degree of 30s, 53 degree of 30s, 72 degree of 1.5min, 72 degree 10 minutes；
3rd step, then by amplified production, intergrowth thing order-checking company use 3730 sequencer；
Whether the 4th step, by order-checking product and the sequence association provided, use Clustalx software to compare, and build NJ tree, identify and have the non-Islamic composition of Carnis Sus domestica Carnis Canitis and Carnis Equi Asini to exist.
Further, in second step, the 5 '-3 of 16SA-SB-ZNYF primer ' gene order is:
CGGCCGCGGTATTCTGACCGTGC。
Further, in second step, the 5 '-3 of 16SA-SB-ZNYR primer ' gene order is:
GATCACGTAGGACTTTAATCGTTG。
Further, in the third step, if there is the situation that sequencing result peak type is more random, use extra three pairs of primers (16SA-Zhu &16SA-SB-ZNYR, 16SA-Gou &16SA-SB-ZNYR, 16SA-Lv &16SA-SB-ZNYR, amplification intergrowth thing order-checking company uses 3730 sequencer respectively；
If still sequencing result is chaotic, using instead and PCR primer is connected to cloning vehicle, extract plasmid after conversion, selected clone checks order no less than 6.
Further, in the third step, the 5 '-3 of 16SA-pig primer ' gene order is:
TTAACTATTCCAAAAGTTAAAC；
The 5 '-3 of 16SA-Canis familiaris L. primer ' gene order is:
TTAACTAACCCAAACTTATGGAT；
The 5 '-3 of 16SA-donkey primer ' gene order is:
TTAACTGATTCACAAAAAACAACATAC。
The method for identifying molecules of Islamic meat product provided by the invention, by taking detected sample 25mg, extracts genomic DNA；Use primer 16SA-SB-ZNYF and the 16SA-SB-ZNYR of design, the DNA extracted is carried out pcr amplification；Then by amplified production, intergrowth thing order-checking company use 3730 sequencer；Use Clustalx software to compare, and build NJ tree, identify and whether have the non-Islamic composition of Carnis Sus domestica Carnis Canitis and Carnis Equi Asini to exist.Food the present invention is directed to Carnis Sus domestica and newly devises special-purpose amplification primer, it is possible to high efficiency amplification Carnis Sus domestica DNA, even if can also be identified containing trace Carnis Sus domestica, Carnis Canitis or Carnis Equi Asini DNA；Amplified production direct Sequencing or cloning and sequencing, the sequencing result obtained is high to the resolution of pig, Canis familiaris L., donkey, cattle, sheep etc., it is possible to accurately distinguish out Carnis Sus domestica, Carnis Canitis or Carnis Equi Asini composition；Accurately whether detection meat product contains Carnis Sus domestica, Carnis Canitis or Carnis Equi Asini.
Accompanying drawing explanation
Fig. 1 is the method for identifying molecules flow chart of the Islamic meat product that the embodiment of the present invention provides.
Detailed description of the invention
In order to make the purpose of the present invention, technical scheme and advantage clearly understand, below in conjunction with embodiment, the present invention is further elaborated.Should be appreciated that specific embodiment described herein is only in order to explain the present invention, is not intended to limit the present invention.
Below in conjunction with drawings and the specific embodiments, the application principle of the present invention is further described.
As it is shown in figure 1, the method for identifying molecules of the Islamic meat product of the embodiment of the present invention comprises the following steps:
S101: take detected sample 25mg, uses universal pillar genome to extract test kit and extracts genomic DNA, in operating procedure during ProteinaseK digestion, take overnight to process, digestion time more than 10 hours；
S102: use the primer of design, 16SA-SB-ZNYF and 16SA-SB-ZNYR, the DNA extracted is carried out pcr amplification, 94 degree of 4min of PCR response procedures, 94 degree of 30s, 53 degree of 30s, 72 degree of 1.5min, 72 degree 10 minutes；
S103: by amplified production, intergrowth thing order-checking company uses 3730 sequencer；
Whether S104: by order-checking product and the sequence association provided, use Clustalx software to compare, and build NJ tree, identify and have the non-Islamic composition of Carnis Sus domestica Carnis Canitis and Carnis Equi Asini to exist.
The present invention concretely comprises the following steps:
1, take detected sample 25mg, use universal pillar genome to extract test kit (model C W2298) and extract genomic DNA, operating procedure is slightly made optimize: during ProteinaseK digestion, take overnight to process, digestion time more than 10 hours；
2, the primer (16SA-SB-ZNYF and 16SA-SB-ZNYR) of design is used, as shown in table 1；The DNA extracted is carried out pcr amplification (use the ExTaq that TaKaRa company produces to carry out pcr amplification, 94 degree of 4min of PCR response procedures (94 degree of 30s, 53 degree of 30s, 72 degree of 1.5min), 72 degree 10 minutes)；
Table 1
Primer Primer sequence (5 '-3 ')
16SA-SB-ZNYF CGGCCGCGGTATTCTGACCGTGC
16SA-SB-ZNYR GATCACGTAGGACTTTAATCGTTG
16SA-pig TTAACTATTCCAAAAGTTAAAC
16SA-Canis familiaris L. TTAACTAACCCAAACTTATGGAT
16SA-donkey TTAACTGATTCACAAAAAACAACATAC
3, following three kinds of situations are divided:
A is by then by the amplified production of 2, and intergrowth thing order-checking company uses 3730 sequencer；
B is if there is the more random situation of sequencing result peak type, use extra three pairs of primers (16SA-Zhu &16SA-SB-ZNYR, 16SA-Gou &16SA-SB-ZNYR, 16SA-Lv &16SA-SB-ZNYR), amplification intergrowth thing order-checking company uses 3730 sequencer respectively；
If it is chaotic that c b walks still sequencing result, using instead and PCR primer is connected to cloning vehicle, extract plasmid after conversion, selected clone checks order no less than 6；
4, by order-checking product and the sequence association provided, use Clustalx software to compare, and build NJ tree, identify and whether have the non-Islamic composition of Carnis Sus domestica Carnis Canitis and Carnis Equi Asini to exist.
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, all any amendment, equivalent replacement and improvement etc. made within the spirit and principles in the present invention, should be included within protection scope of the present invention.
<110>applicant's title: Northern National University
<120>denomination of invention: the method for identifying molecules of a kind of Islamic meat product,
<160>number of sequence in sequence table: 24 sequences
<211>length of sequence: each sequence respectively 491bp of each sequence respectively 490bp Canis familiaris L. of each sequence respectively 489bp donkey of each sequence of the sheep respectively each sequence of 484bp cattle respectively 484bp pig
<212>type of sequence: DNA
<213>biological name in sequence source: pig, Canis familiaris L., cattle, sheep, donkey
<400>it is nucleotide sequence.Nucleotide sequence:
> sheep 1 (484)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAATCAACAAGACGAGAAGACCCTATGGAGCTTTAACTAAGTAACTCAAGGAAAATAAATTCAACCACCAAGGGATAACAACACTCCTTATGAGTTAACAGTTTCGGTTGGGGTGACCTCGGAGAACAGAAAATCCTCCGAGCGATTTTAAAGACTAGACTAACAAGTCAAACCAAACCATCGCTTATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> sheep 2 (484)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAATCAACAAGACGAGAAGACCCTATGGAGCTTTAACTAAGTAACTCAAGGAAAATAAATTCAACCACCAAGGGATAACAACACTCCTTATGAGTTAACAGTTTCGGTTGGGGTGACCTCGGAGAACAGAAAATCCTCCGAGCGATTTTAAAGACTAGACTAACAAGTCAAACCAAACCATCGCTTATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> sheep 3 (484)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAATCAACAAGACGAGAAGACCCTATGGAGCTTTAACTAAGTAACTCAAGGAAAATAAATTCAACCACCAAGGGATAACAACACTCCTTATGAGTTAACAGTTTCGGTTGGGGTGACCTCGGAGAACAGAAAATCCTCCGAGCGATTTTAAAGACTAGACTAACAAGTCAAACCAAACCATCGCTTATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> sheep 4 (484)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAATCAACAAGACGAGAAGACCCTATGGAGCTTTAACTAAGTAACTCAAGGAAAATAAATTCAACCACCAAGGGATAACAACACTCCTTATGAGTTAACAGTTTCGGTTGGGGTGACCTCGGAGAACAGAAAATCCTCCGAGCGATTTTAAAGACTAGACTAACAAGTCAAACCAAACCATCGCTTATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> sheep 5 (484)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAATCAACAAGACGAGAAGACCCTATGGAGCTTTAACTAAGTAACTCAAGGAAAATAAATTCAACCACCAAGGGATAACAACACTCCTTATGAGTTAACAGTTTCGGTTGGGGTGACCTCGGAGAACAGAAAATCCTCCGAGCGATTTTAAAGACTAGACTAACAAGTCAAACCAAACCATCGCTTATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCCGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> cattle 1 (484)
CGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCGCACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATGCACAAATAAGACGAGAAGACCCTATGGAGCTTTAACTAACCAACCCAAAGAGAATAGATTTAACCATTAAGGAATAACAACAATCTCCATGAGTTGGTAGTTTCGGTTGGGGTGACCTCGGAGAATAAAAAATCCTCCGAGCGATTTTAAAGACTAGACCCACAAGTCAAATCACTCTATCGCTCATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> cattle 2 (484)
CGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAATGGCCGCACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATGCACAAATAAGACGAGAAGACCCTATGGAGCTTTAACTAACCAACCCAAAGAGAATAGATTTAACCATTAAGGAATAACAACAATCTCCATGAGTTGGTAGTTTCGGTTGGGGTGACCTCGGAGAATAAAAAATCCTCCGAGCGATTTTAAAGACTAGACCCACAAGTCAAATCACTCTATCGCTCATTGATCCAAAAACTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTGATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATT
> donkey 1 (490)
CGGCCGCGGTATCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAATCAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTGATTCACAAAAAACAACATACAAACCTAACCCTCAGGGACAACAAAACTTTTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAACCTCCGAGTGATTTAAATCTAGACTAACCAGTCAAAATACATAATCACTTATTGATCCAAACCTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATT
> donkey 2 (490)
CGGCCGCGGTATCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAATCAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTGATTCACAAAAAACAACATACAAACCTAACCCTCAGGGACAACAAAACTTTTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAACCTCCGAGTGATTTAAATCTAGACTAACCAGTCAAAATACATAATCACTTATTGATCCAAACCTTTGATCAACGGAATAAGTTACCCTAGGGATAACAGCGCAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATT
> donkey 3 (490)
CGGCCGCGGTATCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAATCAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTGATTCACAAAAAACAACATACAAACCTAACCCTCAGGGACAACAAAACTTTTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAACCTCCGAGTGATTTAAATCTAGACTAACCAGTCAAAATACATAATCACTTATTGATCCAAACCTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATT
> donkey 4 (490)
CGGCCGCGGTATCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAATCAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTGATTCACAAAAAACAACATACAAACCTAACCCTCAGGGACAACAAAACTTTTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAACCTCCGAGTGATTTAAATCTAGACTAACCAGTCAAAATACATAATCACTTATTGATCCAAACCTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATT
> pig 1 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTACTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 2 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTACTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 3 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 4 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 5 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 6 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAATTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 7 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTAACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAACTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTGTTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 8 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTAACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAACTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTGTTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 9 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTAACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAACTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTGTTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAACCGCTATTAAAGGTTCGTTTGTTCAACGATT
> pig 10 (489)
CGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCACTTGTTCTCCAAATAAGGACTTGTATGAATGGCCACACGAGGGTTTTACTGTCTCTTACTTCCAATCAGTGAAATTAACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTATTCCAAAAGTTAAACAACTCAACCACAAAGGGATAAAACATAACTTAACATGGACTAGCAATTTCGGTTGGGGTGACCTCGGAGTACAAAAAACCCTCCGAGTGATTTTAATCTAGACAAACCAGTCAAAATAACCATAACATCACTTATTGATCCAAAATTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTGTTCTAGAGTTCCTATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATT
> Canis familiaris L. 1 (491)
CGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTAACTGTCTCTTACTCCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATACCACAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTAACCCAAACTTATGGATACTAGATACCTACAAGGCATAACATAACACCATTATTATGAGTTAGCAATTTAGGTTGGGGTGACCTCGGAATATAAAAAAACTCCCGAGTGATTAAAATTTAGACCCACAAGTCAAAATACAACATCACTTATTGATCCAATAATTTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCAGCTATTAAGGGTTCGTTTGTTCAACGATT
> Canis familiaris L. 2 (491)
CGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTAACTGTCTCTTACTCCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATACCACAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTAACCCAAACTTATGGATACTAGATACCTACAAGGCATAACATAACACCATTATTATGAGTTAGCAATTTAGGTTGGGGTGACCTCGGAATATAAAAAAACTCCCGAGTGATTAAAATTTAGACCCACAAGTCAAAATACAACATCACTTATTGATCCAATAATTTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCAGCTATTAAGGGTTCGTTTGTTCAACGATT
> Canis familiaris L. 3 (491)
CGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAGGGACTTGTATGAATGGCCACACGAGGGTTTAACTGTCTCTTACTCCCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATACCACAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTAACCCAAACTCATGGATACTAGATACCTACAAGGCATAACATAACACCATTATTATGGGTTAGCAATTTAGGTTGGGGTGACCTCGGAATATAAAAAAACTCCCGAGTGATTAAAATTTAGACCCACAAGTCAAAATACAACATCACTTATTGATCCAATAATTTTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCAGCTATTAAGGGTTCGTTTGTTCAACGATT

Claims (1)

1. the method for identifying molecules of an Islamic meat product, it is characterised in that the method for identifying molecules of this Islamic meat product comprises the following steps:
The first step, takes detected sample 25mg, uses universal pillar genome to extract test kit and extracts genomic DNA, in operating procedure during ProteinaseK digestion, takes overnight to process, digestion time more than 10 hours；
Second step, uses primer 16SA-SB-ZNYF and the 16SA-SB-ZNYR of design, and the DNA extracted carried out pcr amplification, 94 DEG C of 4min of PCR response procedures, 94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 1.5min, 72 DEG C 10 minutes；
3rd step, then by amplified production, intergrowth thing order-checking company use 3730 sequencer；
Whether the 4th step, by order-checking product and the sequence association provided, use Clustalx software to compare, and build NJ tree, identify and have the non-Islamic composition of Carnis Sus domestica, Carnis Canitis and Carnis Equi Asini to exist；
In second step, the 5 '-3 of 16SA-SB-ZNYF primer ' primer sequence is:
CGGCCGCGGTATTCTGACCGTGC；
In second step, the 5 '-3 of 16SA-SB-ZNYR primer ' primer sequence is:
GATCACGTAGGACTTTAATCGTTG；
In the third step, if there is the situation that sequencing result peak type is more random, use extra three pairs of primer 16SA-pig primers and 16SA-SB-ZNYR, 16SA-Canis familiaris L. primer and 16SA-SB-ZNYR, 16SA-donkey primer and 16SA-SB-ZNYR, amplification intergrowth thing order-checking company uses 3730 sequencer respectively；
If still sequencing result is chaotic, using instead and PCR primer is connected to cloning vehicle, extract plasmid after conversion, selected clone checks order no less than 6；
In the third step, the 5 '-3 of 16SA-pig primer ' primer sequence is:
TTAACTATTCCAAAAGTTAAAC；
The 5 '-3 of 16SA-Canis familiaris L. primer ' primer sequence is:
TTAACTAACCCAAACTTATGGAT；
The 5 '-3 of 16SA-donkey primer ' primer sequence is:
TTAACTGATTCACAAAAAACAACATAC。
CN201410259544.XA 2014-06-12 2014-06-12 A kind of method for identifying molecules of Islamic meat product Expired - Fee Related CN104032004B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410259544.XA CN104032004B (en) 2014-06-12 2014-06-12 A kind of method for identifying molecules of Islamic meat product

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410259544.XA CN104032004B (en) 2014-06-12 2014-06-12 A kind of method for identifying molecules of Islamic meat product

Publications (2)

Publication Number Publication Date
CN104032004A CN104032004A (en) 2014-09-10
CN104032004B true CN104032004B (en) 2016-06-29

Family

ID=51462998

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410259544.XA Expired - Fee Related CN104032004B (en) 2014-06-12 2014-06-12 A kind of method for identifying molecules of Islamic meat product

Country Status (1)

Country Link
CN (1) CN104032004B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104498597A (en) * 2014-12-10 2015-04-08 甘肃出入境检验检疫局检验检疫综合技术中心 Multiplex PCR rapid detection method for common contraindicant ingredients in muslem food
CN105018625A (en) * 2015-08-03 2015-11-04 上海派森诺生物科技有限公司 Method for detecting material sources of meat products on basis of short-sequence high-throughput sequencing

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103333897A (en) * 2013-06-05 2013-10-02 湖南农业大学 Clone and application of pork quality character correlation POSTN gene molecular marker
CN103397101A (en) * 2013-08-22 2013-11-20 山东省农业科学院生物技术研究中心 Fluorescently-labeled gene multiplex amplification method for identifying sources of goat, sheep, pig and duck meat simultaneously

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103333897A (en) * 2013-06-05 2013-10-02 湖南农业大学 Clone and application of pork quality character correlation POSTN gene molecular marker
CN103397101A (en) * 2013-08-22 2013-11-20 山东省农业科学院生物技术研究中心 Fluorescently-labeled gene multiplex amplification method for identifying sources of goat, sheep, pig and duck meat simultaneously

Also Published As

Publication number Publication date
CN104032004A (en) 2014-09-10

Similar Documents

Publication Publication Date Title
Lillestøl et al. CRISPR families of the crenarchaeal genus Sulfolobus: bidirectional transcription and dynamic properties
AU2017286122A1 (en) Use of Cpf1 endonuclease for plant genome modifications
MX2017004285A (en) Biological indicator.
FI3250691T3 (en) Crispr hybrid dna/rna polynucleotides and methods of use
WO2014138119A3 (en) Method and kit for characterizing microorganisms
JP2019508051A5 (en)
AR090417A1 (en) GLIFOSATO RESISTANT PLANTS AND ASSOCIATED METHODS
NZ762361A (en) Target sequence specific alteration technology using nucleotide target recognition
WO2017065959A3 (en) Methods and compositions that utilize transcriptome sequencing data in machine learning-based classification
WO2014108850A3 (en) High throughput transcriptome analysis
EP2487263A3 (en) MicroRNA-based methods and compositions for the diagnosis and treatment of solid cancers
MX2011007693A (en) Methods for amplifying hepatitis c virus nucleic acids.
Steige et al. Genomic legacies of the progenitors and the evolutionary consequences of allopolyploidy
BR112016029907A2 (en) genetically adapted enrichment and polymerase chain reaction for rapid detection of microorganisms &#34;.
CN104032004B (en) A kind of method for identifying molecules of Islamic meat product
CA3153995A1 (en) Mad7 nuclease in plants and expanding its pam recognition capability
AR122413A2 (en) METHOD TO IDENTIFY A DNA SEQUENCE THAT CONTRIBUTES TO RESISTANCE TO CABBAGE HERNIA DISEASE IN A BRASSICA NAPUS PLANT
BR112021010781A2 (en) Genetic silencing through genome editing
SG11201809242VA (en) Method for increasing mutation introduction efficiency in genome sequence modification technique, and molecular complex to be used therefor
BR112022001230A2 (en) Donor design strategy for crispr-cas9 genome editing
CN105441421A (en) Cell lysis method
BR112019005605A2 (en) methods for modifying the (nuclear) genome of a plant cell and an endogenous epsps gene or for producing a plant cell or for testing the efficiency of genome, bacterial, and vector editing
Redder Using EMOTE to map the exact 5′-ends of processed RNA on a transcriptome-wide scale
CN102321735A (en) Method for searching target gene of reverse miRNA
WO2011059285A3 (en) Genotyping method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20160629

Termination date: 20170612

CF01 Termination of patent right due to non-payment of annual fee