CN104031939A - Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line - Google Patents

Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line Download PDF

Info

Publication number
CN104031939A
CN104031939A CN201410243657.0A CN201410243657A CN104031939A CN 104031939 A CN104031939 A CN 104031939A CN 201410243657 A CN201410243657 A CN 201410243657A CN 104031939 A CN104031939 A CN 104031939A
Authority
CN
China
Prior art keywords
gene
bmu6
zsgfp
bac
silkworm
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410243657.0A
Other languages
Chinese (zh)
Inventor
缪云根
梁爽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN201410243657.0A priority Critical patent/CN104031939A/en
Publication of CN104031939A publication Critical patent/CN104031939A/en
Pending legal-status Critical Current

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for constructing a recombinant transposon vector PXL-BACII-ZsGFP-BmU6-Hh-Neor. The method comprises the steps of a) designing a Hedgehog gene amplification primer of silkworm; 2) cloning a Hedgehog gene: extracting total RNA from pure P50 silkworm as a material; carrying out reverse transcription synthesis to obtain cDNA; then carrying out PCR synthesis with the cDNA as a template to obtain the Hedgehog gene; directly linking PCR products to a pMD18-T vector and confirming by sequencing; and 3) constructing recombinant transposon vector PXL-BACII-ZsGFP-BmU6-Hh-Neor overexpressed by the Hh gene. According to the method disclosed by the invention, the Hedgehog gene of silkworm is synthesized by a RT-PCR method, a transposon vector is constructed after the Hedgehog gene is sequenced, and the transgenic silkworm cell line overexpressed by Hedgehog signaling pathway is obtained by inserting the transposon vector into the genome of the silkworm cells and the transgenic silkworm cell line is used for researching the Hedgehog gene function.

Description

Hedgehog signal path is crossed express transgenic bombyx mori cell system and restructuring transposon vector used
Technical field
The present invention relates to a kind of structure of crossing the transgenic bombyx mori clone of expression study for Hedgehog signal transduction pathway.Specifically, the present invention adopts RT-PCR method to synthesize silkworm Hedgehog gene, builds transposon vector after order-checking, and inserts the genome of bombyx mori cell by transposon vector, obtain Hedgehog signal transduction pathway and cross the transgenic bombyx mori clone of expression, for studying Hedgehog gene function.
Background technology
From vertebrates to invertebrates, Hh signal path extensively exists and high conservative, in the growth of animal embryo Various Tissues organ, plays a significant role.The variation of Hh and its downstream signaling molecule is relevant with the generation of the diseases such as kinds cancer.Therefore, the transduction mechanism of research Hh signal path is for understanding the mechanism of growing of animal body and all important in inhibitings of generation of some disease.
Hh signal path comprises that secretor type signal glycoprotein h h, 12 transmembrane protein acceptor Patched (Ptch), 7 cross-film effect protein Smoothened (Smo) and the downstream with signal Transport Activities can enter core and participate in zinc finger transcription factor Ci, the microtubule kinesin Costal2 (Cos2) of signal transduction, serine/threonine kinase Fused (Fu) etc.
Silkworm is not only important economic insects, and is the typical module biology of lepidopterous insects, is also the important materials of Development of New Generation bio-reactor simultaneously.Fatty body is important histoorgan in Silkworm, Bombyx mori, there is the function of similar mammalian liver and kidney, it is the synthetic and metabolism center of the materials such as carbohydrate, lipid and protein, also has storage nutrition, removing toxic substances and the physiological functions such as various biosynthetic meta-bolitess are provided for life cycle activity.In fatty body, whether storage material enriches with larval growth growth and metamorphosis, Adult worms producting eggs amount and ovum quality substantial connection.Build Hedgehog signal transduction pathway and cross express transgenic clone, study the regulating and controlling effect that its Hh signal path is grown for silkworm Adipocyte Differentiation, significant.
Summary of the invention
The technical problem to be solved in the present invention is to provide the transgenic cell line that builds Hedgehog signal transduction pathway and cross expression study, studies the regulating and controlling effect that its Hh signal path is grown for silkworm Adipocyte Differentiation.
In order to solve the problems of the technologies described above, the invention provides a kind of restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo rconstruction process, comprise the following steps:
1), design silkworm Hedgehog gene amplification primer;
2), clone Hedgehog gene:
Taking purebred P50 silkworm as material, extract total RNA; The synthetic cDNA that obtains of reverse transcription; Taking this cDNA as template, PCR synthesizes Hedgehog gene again; PCR product is directly connected on pMD18-T carrier, and order-checking is confirmed;
3), build Hh gene overexpression restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo r.
As restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo of the present invention rthe improvement of construction process, comprise the following steps:
1., utilize the est database design silkworm Hedgehog gene amplification primer (adding BamHI and EcoRI restriction enzyme site at upstream and downstream primer two ends) of domestic silkworm gene group database (http://silkworm.genomics.org.cn/) and NCBI (http://www.ncbi.nlm.nih.gov/);
2., taking purebred P50 silkworm as material, get 50-100mg Tissues of Silkworm Bombyx Moril, extract total RNA and carry out reverse transcription, synthetic cDNA; Taking above-mentioned synthetic cDNA as template, and the primer 1. designing and synthesizing with above-mentioned steps, carry out pcr amplification;
3., to reclaim purification kit, above-mentioned Hedgehog gene object fragment is reclaimed, be directly connected on pMD18-T carrier, transfection Escherichia coli competent cell DH5 α, gets 100 μ l plasmid bacterium liquid and checks order, confirms sequence; The Hedgehog gene object fragment length that clone obtains is 834bp;
4., get PXL-BAC II-ZsGFP-BmU6 and pMD18T-Hh carrier and carry out double digestion reaction with BamHI and these two kinds of restriction enzymes of EcoRI respectively; To reclaim products therefrom and adopt T4 ligase enzyme, 16 DEG C of connections are spent the night; Connect product and transform DH5 α competent cell, cultivate single bacterium colony, and extract plasmid and carry out BamHI and the qualification of EcoRI double digestion, obtain PXL-BAC II-ZsGFP-BmU6-Hh carrier;
5., cut PXL-BAC II-ZsGFP-BmU6-Hh with EcoRI enzyme, enzyme is cut product and is detected whether there is object band with 1% agarose gel electrophoresis, and the object fragment conforming to expection size (about 7000bp) is reclaimed; By ie-Neo r-poly (A) EcoRI enzyme cuts back to close product cloning and cuts back to close in product to the EcoRI enzyme of above-mentioned PXL-BAC II-ZsGFP-BmU6-Hh, through transformed competence colibacillus, cultivate after single bacterium colony qualification, swivel base plasmid PXL-BAC II-ZsGFP-BmU6-Hh-Neo obtains recombinating r.
Remarks explanation: restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo rcross expression study for Hedgehog signal transduction pathway.
As restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo of the present invention rthe improvement of construction process:
Silkworm Hedgehog gene amplification primer is:
Hh-cDNA-F:cgc ggatccgcgATGAACCAGTGGCCGGGAGT
Hh-cDNA-R:cg gaattccgTCGATATCTATACGATGCTG。
The present invention also provides a kind of construction process of crossing the transgenic bombyx mori clone of expression study for Hedgehog signal transduction pathway simultaneously, comprises the following steps:
1) the transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo that will recombinate rplasmid and Helper plasmid mix according to the mass ratio of 1:1, adopt transfection reagent lipofectamine tM2000 transfection bombyx mori cell BmN, the expression of fluorescin is observed in transfection after 24 hours;
2) determine the susceptibility of BmN to G418 by the G418 screening culture medium of different concns, thereby determine that the best screening concentration of BmN cell is 800 μ g/mL;
3) the transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo that will recombinate rtransfection BmN cell, cultivate and after 24 hours, add medicine neomycin analog G418 (best screening concentration 800 μ g/ml are determined in test), step sizing can see after one month that negative cells is all dead, is all the positive cell that sends green fluorescence in the visual field; The existing anti-G418 ability of transgenic cell line obtaining, again can expressing green fluorescent protein.
The present invention also discloses the expression of Hh signal path in transgenic cell line and target gene AP2 thereof simultaneously, i.e. Hedgehog gene function analysis, comprise the following steps:
1), in above-mentioned transgenic bombyx mori clone, the expression level of Hh gene is high, the expression level of Smo, Ci and Fu also increases, but the expression level of Ptch and Cos2 reduces on the contrary, this has illustrated that Hh gene obtains the extremely effective expression of crossing in transgenic cell line, thereby Hh signal path is activated, Smo, Ci and Fu are the positive regulatory factors of Hh signal path, express and activate, expression amount increases, and Ptch and Cos2 are as the negative regulatory factor of Hh signal path, express being at this moment suppressed, expression amount reduces;
2), in above-mentioned transgenic bombyx mori clone, the expression amount of AP2 gene also has obvious reduction because AP2 is fatty labelled protein, lipid companion, therefore Hh signal path suppress lipogenesis.
In sum, main technical content of the present invention comprises the following steps:
1) design silkworm Hedgehog gene amplification primer.
2) clone Hedgehog gene.Taking purebred P50 silkworm as material, extract total RNA; The synthetic cDNA that obtains of reverse transcription; Taking this cDNA as template, PCR synthesizes Hedgehog gene again; PCR product is directly connected on pMD18-T carrier, and order-checking is confirmed.
3) build Hh gene overexpression restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo r.
4) restructuring transposon vector transfection Bombyx noriN cell.Above-mentioned restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo ruse lipofectamine tM2000Reagent (Invitrogen) transfection reagent transfection Bombyx noriN cell, the expression of fluorescin is observed in transfection after 24 hours.
5) set up transgenic cell line.The G418 screening culture medium preparing by best screening concentration is screened, and according to the color of substratum and Growth of Cells situation, within every 3-5 days, changes primary screening substratum.After one month, obtain stable transgenic cell line.
6) expression of Hh signal path and AP2 gene in analysis transgenic cell line.
Concrete technical scheme of the present invention is as follows:
Step (1): design silkworm Hedgehog gene amplification primer
Utilize the est database design silkworm Hedgehog gene amplification primer of domestic silkworm gene group database (http://silkworm.genomics.org.cn/) and NCBI (http://www.ncbi.nlm.nih.gov/).
Step (2): clone Hedgehog gene
2-1: taking purebred P50 silkworm as material, get 50~100mg Tissues of Silkworm Bombyx Moril, the specification sheets operation of extracting test kit (RNAizol Plus) by the RNA of Takara, extracts total RNA.
2-2: by the total RNA reverse transcription test kit extracting rT Master Mix Perfect Real Time (DRR036A, TAKARA) carries out reverse transcription, synthetic cDNA.
2-3: taking above-mentioned synthetic cDNA as template, and with the above-mentioned primer designing and synthesizing (adding BamHI and EcoRI restriction enzyme site at upstream and downstream primer two ends), carry out pcr amplification.The Hedgehog gene object fragment length that clone obtains is 834bp.
2-4: the above marine life sepharose DNA of Engineering Co., Ltd reclaims purification kit above-mentioned Hedgehog gene object fragment is reclaimed, be directly connected on pMD18-T carrier, transfection Escherichia coli competent cell (DH5 α), gets 100 μ l plasmid bacterium liquid and delivers to the order-checking of Shanghai biotechnology company limited, confirms sequence.
Step (3): build Hh gene overexpression restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo r
3-1: carrier obtains with goal gene fragment: get PXL-BAC II-ZsGFP-BmU6 and pMD18T-Hh carrier and carry out double digestion with BamHI and these two kinds of restriction enzymes of EcoRI respectively and react.After 37 DEG C of water-bath 3h, product is carried out to 1% agarose gel electrophoresis.PXL-BAC II-ZsGFP-BmU6 enzyme is cut product and is reclaimed carrier segments, and pMD18T-Hh reclaims Hh gene fragment.
The structure of 3-2:PXL-BAC II-ZsGFP-BmU6-Hh carrier: will reclaim products therefrom and adopt T4 ligase enzyme, 16 DEG C of connections are spent the night.Connect product and transform DH5 α competent cell, cultivate single bacterium colony, and extract plasmid and carry out BamHI and the qualification of EcoRI double digestion, obtain PXL-BAC II-ZsGFP-BmU6-Hh carrier.
3-3:PXL-BAC II-ZsGFP-BmU6-Hh-Neo rvector construction: cut PXL-BAC II-ZsGFP-BmU6-Hh with EcoRI enzyme, reaction system is the same, enzyme is cut product and is detected whether there is object band with 1% agarose gel electrophoresis, and the object fragment conforming to expection size (about 7000bp) is reclaimed.By ie-Neo r-poly (A) EcoRI enzyme cuts back to close product cloning and cuts back to close in product to the EcoRI enzyme of above-mentioned PXL-BAC II-ZsGFP-BmU6-Hh, through transformed competence colibacillus, cultivate after single bacterium colony qualification, swivel base plasmid PXL-BAC II-ZsGFP-BmU6-Hh-Neo obtains recombinating r.
Step (4): restructuring transposon vector transfection Bombyx noriN cell
4-1: transfection step is according to lipofectamine tM2000Reagent (Invitrogen) specification sheets carries out.24h inoculation BmN cell (2 × 10 before transfection 5) in 2ml Tissue Culture Dish, under 28 DEG C of conditions, cultivate, after cell cultures 24h, cell degree of converging reaches 60-80%, can do transfection.Take out the transfection reagent lipofectamine of 4 DEG C of preservations tM2000Reagent, concussion mixes.Get and in the 1.5ml centrifuge tube of two sterilizings, respectively add 100ml containing the serum free medium of G418.Get a wherein pipe and add 4 μ l transfection reagents, mix; In another pipe with the quality of 1:1 than transfection PXL-BAC II-ZsGFP-BmU6-Hh-Neo rrestructuring swivel base plasmid and Helper plasmid, mix.Room temperature incubation 5min.Two pipes are mixed to room temperature incubation mixture 20min.Tissue Culture Dish is taken out from thermostat container, suck supernatant, use serum free medium washed twice, add 1.8ml serum free medium, mixture is added in culture dish.After mixing gently, immediately Tissue Culture Dish being put into thermostat container cultivates.After hatching 4-5h, change transfection media, serum free medium is changed to the TC100 substratum containing 10% foetal calf serum.
4-2: the expression of fluorescin is observed in transfection after 24 hours.
Step (5): set up transgenic cell line
5-1: the susceptibility of BmN to G418 determined in screening.(1) get G418 (5g) and under sterile state, add 100ml ultrapure water to make 50mg/m1 stoste, for subsequent use in-20 DEG C of storages.(2), by 400 μ g/ml, 600 μ g/ml, 800 μ g/ml, 1000 μ g/ml, 1200 μ g/ml, 1400 μ g/ml, 1600 μ g/ml gradient concentrations are made screening culture medium with TC-100 insect substratum dilution G418.(3), according to the color of substratum and Growth of Cells situation, within every 3-5 days, change primary screening substratum.The minimum G418 concentration that can kill all cells in step sizing 10-14 days is best screening concentration.
5-2: determine the susceptibility of BmN to G418 by the G418 screening culture medium of different concns, determine that the best screening concentration of BmN cell is 800 μ g/mL.
5-3: above-mentioned transposon vector transfection BmN cell, cultivate and after 24 hours, add medicine neomycin analog G418 (best screening concentration 800 μ g/ml are determined in test), step sizing can see after one month that negative cells is all dead, is all the positive cell that sends green fluorescence in the visual field.The existing anti-G418 ability of transgenic cell line obtaining, again can expressing green fluorescent protein.
Step (6): the expression of Hh signal path and AP2 gene in analysis transgenic cell line
In transgenic cell line, the expression level of Hh gene is high, the expression level of Smo, Ci and Fu also increases, but the expression level of Ptch and Cos2 reduces on the contrary, this has illustrated that Hh gene obtains the extremely effective expression of crossing in transgenic cell line, thereby Hh signal path is activated, Smo, Ci and Fu are the positive regulatory factors of Hh signal path, express and activate, expression amount increases, and Ptch and Cos2 are as the negative regulatory factor of Hh signal path, express being at this moment suppressed, expression amount reduces.
In transgenic cell, the expression amount of AP2 gene also has obvious reduction in addition, because AP2 is fatty labelled protein gene, therefore Hh signal path suppresses lipogenesis.
Beneficial effect of the present invention is as follows:
The transmission mechanism of research Hh signal path is for understanding the mechanism of growing of animal body and all important in inhibitings of generation of some disease.Silkworm is as model animal, illustrates the effect of Hedgehog signal path in adipocyte growth and development process and molecular mechanism thereof by significant the Adipocyte Differentiation of regulatory mechanism be familiar with to(for) people.Build Hedgehog signal transduction pathway and cross express transgenic clone, study the regulating and controlling effect that its Hh signal path is grown for silkworm Adipocyte Differentiation, significant.
Brief description of the drawings
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the cDNA sequence of silkworm Hh gene and the aminoacid sequence of derivation;
Fig. 2 is PXL-BAC II-ZsGFP-BmU6-Hh carrier schematic diagram;
Fig. 3 is PXL-BAC II-ZsGFP-BmU6-Hh-Neo rcarrier schematic diagram;
Fig. 4 is the silkworm transgenic cell line of screening after one month;
Left figure is that silkworm transgenic cell presents green fluorescence under UV-light;
Right figure is non-transgenic bombyx mori cell redgreen fluorescence under UV-light.
Fig. 5 is transgenic bombyx mori cellular genome pcr amplification Neo r, GFP and Hh gene identification;
Swimming lane 1-3 is respectively: taking transgenic cell genome as template, and Neo r, GFP and Hh primer carry out pcr amplification.Swimming lane 4-6 is respectively: taking control cells genome as template, and Neo r, GFP and Hh primer carry out pcr amplification.
Fig. 6 is Hh signal path gene and the expression of AP2 gene in transgenic cell line and normal cell system.
Embodiment
Embodiment 1: the synthetic silkworm Hedgehog gene of clone
Utilize the est database design silkworm Hedgehog gene amplification primer of domestic silkworm gene group database (http://silkworm.genomics.org.cn/) and NCBI (http://www.ncbi.nlm.nih.gov/).
Silkworm Hedgehog gene amplification primer sequence:
Hh-cDNA-F:cgc ggatccgcgATGAACCAGTGGCCGGGAGT
Hh-cDNA-R:cg gaattccgTCGATATCTATACGATGCTG
Taking purebred P50 silkworm as material, get 50~100mg Tissues of Silkworm Bombyx Moril, the specification sheets operation of extracting test kit (RNAizol Plus) by the RNA of Takara, extracts total RNA.
By the total RNA reverse transcription test kit extracting rT Master Mix Perfect Real Time (DRR036A, TAKARA) carries out reverse transcription, synthetic cDNA.
RT-PCR amplification system is:
1. in Microtube, prepare following mixed solution.
* reaction system can be by the corresponding amplification of demand, and 10 μ l reaction systems can the maximum Total RNA that uses 500ng.
2. on PCR instrument, carry out sex change, the annealing reaction of following condition:
37 DEG C of 15min (reverse transcription reaction);
85 DEG C of 5sec (inactivation reaction of ThermoScript II);
4℃;
3. so far, obtain cDNA template.
Taking above-mentioned synthetic cDNA as template, and carry out pcr amplification with the above-mentioned primer designing and synthesizing (upstream and downstream primer two ends add BamHI and EcoRI restriction enzyme site, as shown in underscore), the object fragment length that clone obtains is 834bp.
Pcr amplification system is:
Component Usage quantity
2×Premix Ex Taq 25μl
Primer-F 0.5μl
Primer-R 0.5μl
cDNA 1μl
ddH 2O Surplus
Total 50μl
Carry out PCR reaction by following condition:
Above-mentioned Hedgehog gene PCR amplified fragments reclaims, and is directly connected on pMD18-T carrier, and transfection Escherichia coli competent cell (DH5 α), gets 100 μ l plasmid bacterium liquid and deliver to the order-checking of Shanghai biotechnology company limited, confirm sequence.The Hedgehog gene object fragment length that clone obtains is 834bp (Fig. 1), and accession number is KC494700.
Embodiment 2: build Hh gene overexpression restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo r
Get PXL-BAC II-ZsGFP-BmU6 and pMD18T-Hh carrier and carry out double digestion reaction with BamHI and these two kinds of restriction enzymes of EcoRI respectively.After 37 DEG C of water-bath 3h, product is carried out to 1% agarose gel electrophoresis.PXL-BAC II-ZsGFP-BmU6 enzyme is cut product and is reclaimed carrier segments, and pMD18T-Hh reclaims Hh gene fragment.
Remarks explanation:
1, PXL-BAC II-ZsGFP-BmU6 carrier has clearly and informs in Ph D dissertation " target gene shRNA disturbs copying and proliferation research of silkworm and the some viruses of pig ".
2, pMD18T-Hh is reclaimed by above-mentioned Hedgehog gene PCR amplified fragments, is directly connected to pMD18-T carrier (purchased from the precious biotechnology (Dalian) of TaKaRa company limited) and above obtains, and Hh is the abbreviation of Hedgehog gene.
The structure of PXL-BAC II-ZsGFP-BmU6-Hh carrier:
To reclaim products therefrom and adopt T4 ligase enzyme, 16 DEG C of connections are spent the night.Connect product and transform DH5 α competent cell, cultivate single bacterium colony, and extract plasmid and carry out BamHI and the qualification of EcoRI double digestion, obtain PXL-BAC II-ZsGFP-BmU6-Hh carrier (Fig. 2).
Cut PXL-BAC II-ZsGFP-BmU6-Hh with EcoRI enzyme, reaction system is the same, and enzyme is cut product and detected whether there is object band with 1% agarose gel electrophoresis, and the object fragment conforming to expection size (about 7000bp) is reclaimed.By ie-Neo r-poly (A) EcoRI enzyme cuts back to close product cloning and cuts back to close in product to the EcoRI enzyme of above-mentioned PXL-BAC II-ZsGFP-BmU6-Hh, through transformed competence colibacillus, cultivate after single bacterium colony qualification, swivel base plasmid PXL-BAC II-ZsGFP-BmU6-Hh-Neo obtains recombinating r(Fig. 3).
Remarks explanation: (PXL-BACII-GFP-BmU6-shRNA is 6226bp to the about 6157bp of PXL-BAC II-ZsGFP-BmU6 size, cutting shRNA is 69bp, therefore PXL-BACII-GFP-BmU6 is 6226-69=6157bp), reconnecting Hh is 834bp, therefore PXL-BAC II-ZsGFP-BmU6-Hh expection should be 6157+834=6991bp,, about 7000bp.
Ie-Neo r-poly (A) EcoRI enzyme cuts back to close product, and in Ph D dissertation " target gene shRNA disturbs copying and proliferation research of silkworm and the some viruses of pig ", have clearly and inform, that is, be IE+Neomycinr+poly (A) sequence.Specific as follows:
GaattcGATTTGCAGTTCGGGACATAAATGTTTAAATATATCAATGTCTTTGTGATGCGCGCGACATTTTTGTAAGTTATTAATAAAATGCACCGACACGTTGCCCGACATTATCATTAAATCCTTGGCGTAGAATTTGTCGGGTCCGTTGTCCGTGTGCGCTAGCATGCCCGTAACGGACCTTGTGCTTTTGGCTTCAAAGGTTTTGCGCACAGACAAAATGTGCCACACTTGCAGCTCTGCTTGTGTGCGCGTTACCACAAATCCCAACGGCGCAGTGTACTTGTTGTATGTAAATAAATCTCGATAAAGGCGCGGCGCGCGAATGCAGCTGATCACGTACGCTCCTCGTGTCCCCGTTTCAAAGGACGGTGTTATCGACCCTCAGATTAATGTTTTATCGGCCCGACTGTTTTCGTATCCGCTCACCAAACGTGTTTTTGCATTAACATTGTATGTCGGCGGATGTTCTGTATCTAATTTGAATAAATAAATGATAACCGCATTGGTTTTAGAGGGCATAATAAAAAAAATATTATTATCGTGTTCGCCATTAGGGCAGTATAAATTGACGTTCATGTTGAATATTGTTTCAGTTGCAAGTTGACATTGGCGGCGACACGATCGTGAACAACCAAACGACTGATATCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACTTGCTCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAgaattcgaattc:For EcoRI enzyme recognition site.。
Embodiment 3, restructuring transposon vector transfection Bombyx noriN cell
Transfection step is according to lipofectamine tM2000Reagent (Invitrogen) specification sheets carries out.24h inoculation BmN cell (2 × 10 before transfection 5) in 2ml Tissue Culture Dish, under 28 DEG C of conditions, cultivate, after cell cultures 24h, cell degree of converging reaches 60-80%, can do transfection.Take out the transfection reagent lipofectamine of 4 DEG C of preservations tM2000Reagent, concussion mixes.Get and in the 1.5ml centrifuge tube of two sterilizings, respectively add 100ml containing the serum free medium of G418.Get a wherein pipe and add 4 μ l transfection reagents, mix; In another pipe with the quality of 1:1 than transfection PXL-BAC II-ZsGFP-BmU6-Hh-Neo rrestructuring swivel base plasmid and Helper plasmid, mix.Room temperature incubation 5min.Two pipes are mixed to room temperature (being 25 DEG C) incubation mixture 20min.Tissue Culture Dish is taken out from thermostat container, suck supernatant, use serum free medium washed twice, add 1.8ml serum free medium, mixture is added in culture dish.After mixing gently, immediately Tissue Culture Dish being put into thermostat container (being 28 DEG C) cultivates.After hatching 4-5h, change transfection media, serum free medium is changed to the TC100 substratum (that is: foetal calf serum mixes according to the volume ratio of 1:9 with TC100 substratum) containing 10% foetal calf serum.
The expression of fluorescin is observed in transfection after 24 hours, result is: Bombyx noriN cell transfection PXL-BAC II-ZsGFP-BmU6-Hh-Neo rrestructuring swivel base plasmid and Helper plasmid present green fluorescence under UV-light; And common Bombyx noriN cell (without transfection) redgreen fluorescence under UV-light.Illustrate that constructed carrier can be used for the foundation of following transgenic bombyx mori clone.
Embodiment 4: set up transgenic bombyx mori clone
The susceptibility of BmN to G418 determined in screening:
(1) get G418 (5g) and under sterile state, add 100ml ultrapure water to make 50mg/m1 stoste, for subsequent use in-20 DEG C of storages.
(2), by 400 μ g/ml, 600 μ g/ml, 800 μ g/ml, 1000 μ g/ml, 1200 μ g/ml, 1400 μ g/ml, 1600 μ g/ml gradient concentrations are made screening culture medium with TC-100 insect substratum dilution G418.
(3) transfection is got Bombyx noriN cell and be prepared into cell suspension the day before yesterday, by 2 × 10 5density is inoculated in octal culture plate, cultivates 6h left and right and uses.By described in above-mentioned experimental example 3 with PXL-BAC II-ZsGFP-BmU6-Hh-Neo rrestructuring swivel base plasmid and Helper plasmid transfection Bombyx noriN cell.The expression of fluorescin is observed in transfection after 24 hours, and removes nutrient solution, and PBS washes once, adds the above-mentioned G418 screening culture medium preparing to screen.
(4), according to the color of substratum and Growth of Cells situation, within every 3 days, change primary screening substratum.The minimum G418 concentration that can kill all cells in step sizing 10-14 days is best screening concentration.
(5) determine the susceptibility of BmN to G418 by the G418 screening culture medium of different concns, determine that the best screening concentration of BmN cell is 800 μ g/mL.
Above-mentioned restructuring swivel base plasmid PXL-BAC II-ZsGFP-BmU6-Hh-Neo rtransfection Bombyx noriN cell, cultivate and after 24 hours, add medicine neomycin analog G418 (800 μ g/ml), step sizing can see after one month that negative cells is (without transfection, the Bombyx noriN cell of redgreen fluorescence performance) all dead, in the visual field, be all send green fluorescence positive cell (through transfection, presenting the Bombyx noriN cell of green fluorescence) (Fig. 4).The existing anti-G418 ability of transgenic cell line obtaining, again can expressing green fluorescent protein.
Remarks explanation: be the TC-100 insect substratum of 800 μ g/mL preparations containing G418 by best screening concentration, change primary screening substratum, step sizing one month for every 3 days.
Embodiment 5: the qualification of transgenic bombyx mori clone
Obtain, after stable transgenic bombyx mori clone, detecting three transposable element: GFP, Neomycin by PCR method r(Neo r) and Hedgehog (Hh).
Extract transgenic bombyx mori cellular genome, taking genomic dna as template, the normal negative contrast of bombyx mori cell genome, respectively with Neo r-F/R, GFP-F/R and Hh-F/R are that primer carries out pcr amplification.
Transgenic bombyx mori clone Hh gene amplification primer sequence:
Hh-F:ACCGAGACCGCAGCAAATAC
Hh-R:CCAGCACCAGTTCCCACAGA。
Transgenic bombyx mori clone Neo rgene amplification primer sequence:
Neo r-F:GATTGAACAAGATGGATTGC
Neo r-R:TAGCTAGAGGTCGACGGTAT。
Transgenic bombyx mori clone GFP gene amplification primer sequence:
GFP-F:AAACGACTATGGTGAGCAA
GFP-R:TTTACTTGTACAGCTCGTCC。
Pcr amplification system is:
Component Usage quantity
2×Premix Ex Taq 10μl
Primer-F 0.5μl
Primer-R 0.5μl
cDNA 1μl
ddH 2O 8μl
Total 20μl
Carry out PCR reaction by following condition:
PCR product is confirmed through 1% agarose gel electrophoresis, shown in amplification Fig. 5.Negative control group does not detect Neo rgene, GFP gene, and transgenic cell genome amplification detects Neo rgene, GFP gene, be respectively 1115bp and 729bp, in the same size with expection; Transgenic cell genome and control group all amplify Hh gene band, and the Hh band that transgenic cell genome amplifies is brighter, conform to expection, and the above results shows marker gene (ZsGFP) and screening-gene (Neo r), and the mode success swivel base that Hh passes through swivel base is in transgenic cell line.
Embodiment 6: the expression of Hh signal path and AP2 gene in analysis transgenic cell line
Transgenic cell line and the normal cellular control unit of choosing contemporaneity are extraction and the synthetic cDNA of reverse transcription that carries out total RNA.Taking the cDNA that obtains as template, carry out quantitative fluorescent PCR, the variation of the expression level of analyzing Hh signal path and AP2 gene in transgenic cell line and control group.
In transgenic cell line, Hh signal path gene and AP2 expression conditions are as Fig. 6.In transgenic cell line, the expression level of Hh gene is high, the expression level of Smo, Ci and Fu also increases, but the expression level of Ptch and Cos2 reduces on the contrary, this has illustrated that Hh gene obtains the extremely effective expression of crossing in transgenic cell line, thereby Hh signal path is activated, Smo, Ci and Fu are the positive regulatory factors of Hh signal path, express and activate, expression amount increases, and Ptch and Cos2 are as the negative regulatory factor of Hh signal path, express being at this moment suppressed, expression amount reduces.In transgenic cell, the expression amount of AP2 gene also has obvious reduction in addition, because AP2 is fatty labelled protein gene, therefore Hh signal path suppresses lipogenesis.
Remarks explanation: this embodiment has shown the 1. excessively expression regulating and controlling effect to its downstream film protein gene Smo, Ptch and cell in transcription factor Ci, Fu and Cos2 of Hedgehog albumen in transgenic bombyx mori cell; 2. in transgenic cell, Hedgehog protein overexpression causes that the expression amount of AP2 gene obviously reduces, because AP2 is fatty labelled protein gene, therefore thinks that Hh signal path suppresses lipogenesis.
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
<110> Zhejiang University
<120> Hedgehog signal path is crossed express transgenic bombyx mori cell system and restructuring transposon vector used
<160> 8
<210> 1
<211> 32
<212> DNA
<213> artificial sequence
<220>
<223> primer Hh-cDNA-F
<400> 1
cgcggatccg cgatgaacca gtggccggga gt 32
<210> 2
<211> 30
<212> DNA
<213> artificial sequence
<220>
<223> primer Hh-cDNA-R
<400> 2
cggaattccg tcgatatcta tacgatgctg 30
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> primer Hh-F
<400> 3
accgagaccg cagcaaatac 20
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> primer Hh-R
<400> 4
ccagcaccag ttcccacaga 20
<210> 5
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> primer Neo r-F
<400> 5
gattgaacaa gatggattgc 20
<210> 6
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> primer Neo r-R
<400> 6
tagctagagg tcgacggtat 20
<210> 7
<211> 19
<212> DNA
<213> artificial sequence
<220>
<223> primer GFP-F
<400> 7
aaacgactat ggtgagcaa 19
<210> 8
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> primer GFP-R
<400> 8
tttacttgta cagctcgtcc 20

Claims (5)

1. restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo rconstruction process, it is characterized in that comprising the following steps:
1), design silkworm Hedgehog gene amplification primer;
2), clone Hedgehog gene:
Taking purebred P50 silkworm as material, extract total RNA; The synthetic cDNA that obtains of reverse transcription; Taking this cDNA as template, PCR synthesizes Hedgehog gene again; PCR product is directly connected on pMD18-T carrier, and order-checking is confirmed;
3), build Hh gene overexpression restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo r.
2. restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo according to claim 1 rconstruction process, it is characterized in that comprising the following steps:
1., utilize the est database design silkworm Hedgehog gene amplification primer of domestic silkworm gene group database and NCBI;
2., taking purebred P50 silkworm as material, get 50-100mg Tissues of Silkworm Bombyx Moril, extract total RNA and carry out reverse transcription, synthetic cDNA; Taking above-mentioned synthetic cDNA as template, and the primer 1. designing and synthesizing with above-mentioned steps, carry out pcr amplification;
3., to reclaim purification kit, above-mentioned Hedgehog gene object fragment is reclaimed, be directly connected on pMD18-T carrier, transfection Escherichia coli competent cell DH5 α, gets 100 μ l plasmid bacterium liquid and checks order, confirms sequence; The Hedgehog gene object fragment length that clone obtains is 834bp;
4., get PXL-BAC II-ZsGFP-BmU6 and pMD18T-Hh carrier and carry out double digestion reaction with BamHI and these two kinds of restriction enzymes of EcoRI respectively; To reclaim products therefrom and adopt T4 ligase enzyme, 16 DEG C of connections are spent the night; Connect product and transform DH5 α competent cell, cultivate single bacterium colony, and extract plasmid and carry out BamHI and the qualification of EcoRI double digestion, obtain PXL-BAC II-ZsGFP-BmU6-Hh carrier;
5., cut PXL-BAC II-ZsGFP-BmU6-Hh with EcoRI enzyme, enzyme is cut product and is detected whether there is object band with 1% agarose gel electrophoresis, and the object fragment that will conform to expection size reclaim; By ie-Neo r-poly (A) EcoRI enzyme cuts back to close product cloning and cuts back to close in product to the EcoRI enzyme of above-mentioned PXL-BAC II-ZsGFP-BmU6-Hh, through transformed competence colibacillus, cultivate after single bacterium colony qualification, swivel base plasmid PXL-BAC II-ZsGFP-BmU6-Hh-Neo obtains recombinating r.
3. restructuring transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo according to claim 1 and 2 rconstruction process, it is characterized in that:
Silkworm Hedgehog gene amplification primer is:
Hh-cDNA-F:cgc ggatccgcgATGAACCAGTGGCCGGGAGT
Hh-cDNA-R:cg gaattccgTCGATATCTATACGATGCTG。
4. the construction process of crossing the transgenic bombyx mori clone of expression study for Hedgehog signal transduction pathway, is characterized in that comprising the following steps:
1) the transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo that will recombinate rplasmid and Helper plasmid mix according to the mass ratio of 1:1, adopt transfection reagent lipofectamine tM2000 transfection bombyx mori cell BmN, the expression of fluorescin is observed in transfection after 24 hours;
2) determine the susceptibility of BmN to G418 by the G418 screening culture medium of different concns, thereby determine that the best screening concentration of BmN cell is 800 μ g/mL;
3) the transposon vector PXL-BAC II-ZsGFP-BmU6-Hh-Neo that will recombinate rtransfection BmN cell, cultivates and adds G418 after 24 hours, and step sizing can see after one month that negative cells is all dead, is all the positive cell that sends green fluorescence in the visual field; The existing anti-G418 ability of transgenic cell line obtaining, again can expressing green fluorescent protein.
5. the expression of Hh signal path and target gene AP2 thereof in transgenic cell line, is characterized in that comprising the following steps:
1), in transgenic bombyx mori clone claimed in claim 3, the expression level of Hh gene is high, the expression level of Smo, Ci and Fu also increases, but the expression level of Ptch and Cos2 reduces on the contrary, this has illustrated that Hh gene obtains the extremely effective expression of crossing in transgenic cell line, thereby Hh signal path is activated, Smo, Ci and Fu are the positive regulatory factors of Hh signal path, express and activate, expression amount increases, and Ptch and Cos2 are as the negative regulatory factor of Hh signal path, express being at this moment suppressed, expression amount reduces;
2), in transgenic bombyx mori clone claimed in claim 3, the expression amount of AP2 gene also has obvious reduction because AP2 is fatty labelled protein, lipid companion, therefore Hh signal path suppress lipogenesis.
CN201410243657.0A 2014-05-31 2014-05-31 Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line Pending CN104031939A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410243657.0A CN104031939A (en) 2014-05-31 2014-05-31 Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410243657.0A CN104031939A (en) 2014-05-31 2014-05-31 Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line

Publications (1)

Publication Number Publication Date
CN104031939A true CN104031939A (en) 2014-09-10

Family

ID=51462935

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410243657.0A Pending CN104031939A (en) 2014-05-31 2014-05-31 Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line

Country Status (1)

Country Link
CN (1) CN104031939A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009146463A2 (en) * 2008-05-30 2009-12-03 Genentech, Inc. Variant hhip1 protein and methods and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009146463A2 (en) * 2008-05-30 2009-12-03 Genentech, Inc. Variant hhip1 protein and methods and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
周芳: "靶向基因shRNA干扰家蚕及猪若干病毒的复制和增殖研究", 《中国博士学位论文全文数据库》 *
郝向伟: "家蚕Hedgehog信号通路相关基因的克隆、鉴定及其功能分析", 《中国优秀硕士学位论文全文数据库》 *

Similar Documents

Publication Publication Date Title
CN110257435B (en) Construction method and application of PROM1-KO mouse model
CN104846011A (en) Method for synthesizing royal jelly main protein 1 by using bombyx mori posterior silkgland
KR20160012735A (en) Dyrk1aa mutant zebrafish model for vascular disease and screening method of vascular disease treatment agent using the same
Prochazkova et al. CPEB2 is necessary for proper porcine meiotic maturation and embryonic development
CN105002215A (en) Expression vector containing regulatably expressible cre recombinase gene and reporter gene LacZ, construction method and application thereof
CN109679954A (en) The knockout and application of diamondback moth APN3a gene based on CRISPR/Cas9
Zhou et al. Investigation of the lncRNA THOR in mice highlights the importance of noncoding RNAs in mammalian male reproduction
Guo et al. Efficient and Specific Generation of MSTN-Edited Hu Sheep Using C-CRISPR
CN105524941A (en) Gene transfer system and method for specific poultry primordial germ cell
CN102747096A (en) Gene search vector, random gene mutation control method and application thereof
CN101289671B (en) Method for preparing transgenic animal
CN104232643B (en) RNAi interference fragments, interference carrier, preparation method and applications
CN104031939A (en) Transgenic silkworm cell line overexpressed by Hedgehog signaling pathway and recombinant transposon vector for transgenic silkworm cell line
CN110250108A (en) RPRM gene knock-out mice model and its construction method and application
CN112522278B (en) dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof
KR102191341B1 (en) Method of manufacturing breast cancer animal model and uses thereof
Gui et al. In vitro evaluation of a mammary gland specific expression vector encoding recombinant human lysozyme for development of transgenic dairy goat embryos
CN106434680A (en) Masculinization gene of shrimps and application of masculinization gene
CN101412999A (en) A kind of gene targeting locus-specific transgenic method and application thereof
CN101519664B (en) Method for breeding genetically modified animal by using recombinant adenovirus vector
Gao et al. Transfection and expression of exogenous gene in laying hens oviduct in vitro and in vivo
CN100378220C (en) Novel transgenic medaka, gene fragments
CN110157712A (en) A method of increasing fish reproduction power
Wang et al. ZB transposon and chicken vasa homologue (Cvh) promoter interact to increase transfection efficiency of primordial germ cells in vivo
CN113481238B (en) Method for preparing IL-2Rg knockout non-human animal model and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20140910