CN104004662A - Aspergillus versicolor strain with antibacterial activity - Google Patents
Aspergillus versicolor strain with antibacterial activity Download PDFInfo
- Publication number
- CN104004662A CN104004662A CN201410219071.0A CN201410219071A CN104004662A CN 104004662 A CN104004662 A CN 104004662A CN 201410219071 A CN201410219071 A CN 201410219071A CN 104004662 A CN104004662 A CN 104004662A
- Authority
- CN
- China
- Prior art keywords
- aspergillus
- cwj2
- variable color
- aspergillus versicolor
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to an Aspergillus versicolor strain, particularly an Aspergillus versicolor strain with antibacterial activity. The invention provides an Aspergillus versicolor strain, which has favorable inhibiting actions on Bacillus subtilis, Bacillus pumilus, Staphylococcus aureus and other bacteria and provides references for developing new antibacterial drugs and food preservatives. The Aspergillus versicolor with antibacterial activity is Aspergillus versicolor CWJ2, and is collected at China Center for Type Culture Collection; and the collection date is April 16th, 2014, and the collection number is CCTCC NO:M2014130. The Aspergillus versicolor CWJ2 has strong inhibiting actions on Bacillus subtilis, Bacillus pumilus, Staphylococcus aureus and other bacteria.
Description
Technical field
The present invention relates to a strain variable color aspergillus.
Background technology
As the important Microbial resources of a class, endophyte of plant has become the focus of research, and it is widely distributed in plant tissue organ, is the microorganism species that has metabolism diversity.Find the first microbiotic from scientist Fleming---since penicillin, antibiotic discovery and application been has successfully has been prevented and treated the disease infection that microorganism causes.But, in recent years, along with the widespread use of the Broad spectrum antibiotics such as penicillin, cynnematin, various microbiotic are constantly updated and are regenerated, and have clinically unreasonable use microbiotic, cause the resistance of microorganism constantly to strengthen, the appearance of Resistant strain has limited existing antibiotic clinical effectiveness, address this problem, the most effective way is gone into overdrive exactly, the microbiotic of screening development of new.
Because traditional research method repeats to find that the probability of natural antibacterial active result constantly increases, from the microorganism in conventional environment source, separate new antibacterial substance difficulty day by day.Therefore, investigators have turned one's attention to the relatively less endophyte of plant of research gradually.Research shows, Endophytic Fungi of Medicinal Plant is the microbe-derived of novel antibacterial medicine, wherein a lot of in the multi-field interior huge economic worth that produced of society.
Summary of the invention
The invention provides a strain variable color aspergillus, the bacteriums such as subtilis, bacillus pumilus, streptococcus aureus are had to good restraining effect, provide foundation for developing new antibacterials and food preservatives.
The variable color aspergillus that the present invention has bacteriostatic activity is variable color aspergillus CWJ2Aspergillus versicolor CWJ2, be deposited in Chinese Typical Representative culture collection center (CCTCC), preservation address is Wuhan University of Wuhan City, preservation date is on April 16th, 2014, and deposit number is CCTCC NO:M2014130.
Variable color aspergillus CWJ2 of the present invention belongs to hyphomycete section (Hyohomycetaceae) Aspergillus (Aspergillus) variable color aspergillus (Aspergillus versicolor).
Variable color aspergillus CWJ2 of the present invention cultivated after 5 days on PDA solid medium, quality velvet shape; The conidium structure that tool is a large amount of, green, edge white; Without transudate; There is light musty; Bacterium colony reverse side is micro-Huang in various degree to orange.The conidiophore ultimate swelling of variable color aspergillus CWJ2 becomes top capsule, spherical in shape.Capsule surface, top covers with radial stigma.
Variable color aspergillus CWJ2 of the present invention can grow on PDA substratum, and optimum growth temperature is 28 DEG C.
Variable color aspergillus CWJ2 of the present invention has stronger restraining effect to subtilis, bacillus pumilus, streptococcus aureus, enterococcus faecalis, faecium, Listeria monocytogenes, streptococcus pyogenes, intestinal bacteria, pseudomonas aeruginosa and Klebsiella Pneumoniae, there is good development and application values, for the screening of Novel antibacterial active substance provides reference.
Variable color aspergillus CWJ2 of the present invention belongs to Aspergillus (Aspergillus), be deposited in Chinese Typical Representative culture collection center (CCTCC), preservation address is Wuhan University of Wuhan City, and preservation date is on April 16th, 2014, and deposit number is CCTCCNO:M2014130.
Brief description of the drawings
Fig. 1 is the colonial morphology photo of variable color aspergillus CWJ2 of the present invention; Fig. 2 is the spore shape photo of variable color aspergillus CWJ2 of the present invention; Fig. 3 is the phylogenetic tree that variable color aspergillus CWJ2 of the present invention and close bacterial strain carry out sequence analysis structure.
Embodiment
Technical solution of the present invention is not limited to following cited embodiment, also comprises the arbitrary combination between each embodiment.
Embodiment one: the variable color aspergillus that present embodiment has bacteriostatic activity is variable color aspergillus (Aspergillus versicolor) CWJ2, be deposited in Chinese Typical Representative culture collection center (CCTCC), preservation address is Wuhan University of Wuhan City, preservation date is on April 16th, 2014, and deposit number is CCTCC NO:M2014130.
Present embodiment variable color aspergillus CWJ2 cultivated after 5 days on PDA solid medium, quality velvet shape; The conidium structure that tool is a large amount of, green, edge white (as Fig. 1); Without transudate; There is light musty; Bacterium colony reverse side is micro-Huang in various degree to orange.The conidiophore ultimate swelling of variable color aspergillus CWJ2 becomes top capsule, (as Fig. 2) spherical in shape.Capsule surface, top covers with radial stigma.
Present embodiment variable color aspergillus CWJ2 can grow on PDA substratum, and optimum growth temperature is 28 DEG C.
Embodiment two: screen and obtain in the Radix Et Caulis Acanthopanacis Senticosi plant of present embodiment variable color aspergillus (Aspergillus versicolor) CWJ2 by Mao Er Mountain area, Heilongjiang Province of China health.Screening is carried out according to the following steps: after choosing healthy Radix Acanthopanacis Senticosi root tap water and rinsing well, with aseptic filter paper suck dry moisture, be cut into 1cm segment, by following aseptic technique program, it carried out to surface sterilization: the alcohol rinsing 1min-aseptic water washing of the hydrogen peroxide rinsing 15min-volumetric concentration 75% of the alcohol rinsing 1min-volumetric concentration 10% of volumetric concentration 75% 3 times.Experiment material after sterilization is placed in to PDA solid medium, in 28 DEG C of constant incubators, cultivate 10～15 days, treat that experiment material grows mycelia around, picking mycelia proceeds to flat board (PDA solid medium) separation and purification of repeatedly ruling, bacterial strain after purifying is placed in to slant medium (PDA solid medium), 4 DEG C of preservations.Whether thorough in order to check surface sterilization, getting last aseptic water washing liquid coating culture plate (PDA solid medium) compares, separately the experiment material after sterilization is rolled and compared for one week on culture plate, under identical condition, cultivate, result contrast is dull and stereotyped to be grown without any bacterium, repeatedly repeat all so, prove that the bacterium of assigning to is endophyte of plant, instead of the epiphyte on surface.Bacterial strain after the purifying obtaining is variable color aspergillus CWJ2.
PDA substratum (1000mL) is made up of the distilled water of 200g potato, 20g sucrose and surplus.PDA solid medium (1000mL) is made up of the distilled water of 200g potato, 20g sucrose, 16g agar powder and surplus.
The variable color aspergillus CWJ2 that separation and purification is obtained carries out molecular biology identification, carries out according to the following steps:
Extract total DNA of bacterial strain, adopt fungi universal primer NS1, NS6 amplification 18SrDNA fragment, after PCR product purification, check order, its sequence is as shown in SEQIDNO:1, sequencing result is applied in ncbi database to BLAST analysis and carried out homology comparison, then by application software MEGA6.0 phylogenetic tree construction (as shown in Figure 3), all reach more than 99% with the homology of Aspergillus bacterial strain, by determining that in conjunction with morphological features, growth conditions variable color aspergillus CWJ2 belongs to Aspergillus (Aspergillus).
NS1：GTAGTCATATGCTTGTCTC
NS6：GCATCACAGACCTGTTATTGCCTC
Below present embodiment variable color aspergillus CWJ2 and fermented liquid thereof are carried out to Antibacterial Activity, concrete steps are as follows:
1, the preparation of fermented liquid: variable color aspergillus CWJ2 is inoculated in 50mLPDA substratum, does 3 repetitions, be placed in 28 DEG C of 120r/min airbath shaking tables, cultivate taking-up in 10 days, under aseptic condition, filter with 8 layers of sterile gauze and aseptic filter paper successively, collect filtered liquid as fermented liquid, for subsequent use; Get PDA substratum and be made in the same way of negative control sample.
2, contain the preparation for examination bacterium flat board: 11 strains are activated after 2～3 times for examination bacterium, be inoculated on slant medium (beef extract-peptone nutrient agar), in 37 DEG C of constant incubators, cultivate 1～2 day, use blood counting chamber counting process, in every kind of slant tube for examination bacterium, add in 5mL physiological saline, after fully vibration shakes up, drip in the nucleonics being placed between blood counting chamber slide glass and cover glass, count under the microscope, then being diluted to cell concentration is 1 × 107CFU/mL, obtains the bacteria suspension of 11 strains for examination bacterium; In the beef extract-peptone nutrient agar of 50 DEG C of left and right, add bacteria suspension in the ratio that adds 1mL bacteria suspension in every 100mL substratum again, after mixing, divide rapidly in the sky flat board installing to after sterilizing, cooling, make containing bacterium flat board, for subsequent use.
Same method, get activation and supply examination fungi--Candida albicans bacterium for 2-3 time, be inoculated on slant medium (PDA solid medium), in 28 DEG C of incubators, cultivate 1-2d, use blood cell counting plate counting process, in the slant medium test tube for examination fungi, add respectively 5mL physiological saline, fully vibration shakes up, get in one after another drop of nucleonics between blood cell counting plate slide glass and cover glass, count under the microscope, then being diluted to cell concentration is 1 × 107CFU/mL, obtains the bacteria suspension for examination fungi; Bacteria suspension is joined in the PDA solid medium of 50 DEG C of left and right in the ratio that adds 1mL bacteria suspension in every 100mL substratum, after mixing, divide rapidly in the sky flat board installing to after sterilizing, cooling, make containing bacterium flat board, for subsequent use.
Described 11 strains are streptococcus aureus (Staphylococcus aureus) for examination bacterium, bacillus pumilus (Bacillus pumilus), subtilis (Bacillus subtilis), Listeria monocytogenes (Listeria monocytogenes), streptococcus pyogenes (Streptococcus pyogenes), enterococcus faecalis (Enterococcus facalis), faecium (Enterococcus faecium), intestinal bacteria (Escherichia coli), Klebsiella pneumonia (Klebsiella pneumoniae), Acinetobacter bauamnnii (Acinetobacter baummanii) and pseudomonas aeruginosa (Pseudomonas aeruginosa), be Candida albicans (Candida albicans) for examination fungi, all buy from Institute of Microbiology, Heilongjiang Academy of Sciences.
3, adopt bacterium cake method to detect the bacteriostatic activity of variable color aspergillus CWJ2
On the variable color aspergillus CWJ2 bacterium colony of cultivating 10 days, prepare bacterium cake with the punch tool of diameter 0.8cm, and bacterium cake is placed in containing on bacterium flat board, every strain is done 3 repetitions for examination bacterium, make negative control with PDA substratum, with making positive control containing 1mg/mL Streptomycin sulphate and 2mg/mL fluconazole nutrient agar, after the flat board preparing is placed in respectively to 37 DEG C and 28 DEG C of constant temperature culture 24h, observe, survey its antibacterial circle diameter (Ф).Detected result is as shown in table 1.
4, adopt filter paper method to carry out bacteriostatic test to the fermented liquid of variable color aspergillus CWJ2
Aseptic filter paper sheet (Ф=0.8cm) is dipped in to 30min in the fermented liquid of variable color aspergillus CWJ2, take out, lie against containing on bacterium flat board, on each flat board, put 2 filter papers, every strain is done 3 repetitions for examination bacterium, makes negative control with PDA liquid nutrient medium, makes positive control with 1mg/mL Streptomycin sulphate and 2mg/mL fluconazole solution, after the flat board preparing is placed in to 37 DEG C of constant temperature culture 24h, observe, survey its antibacterial circle diameter (Ф).Detected result is as shown in table 2.
Table 1 variable color aspergillus CWJ2 is to 12 kinds of Screening of Antibacterial Activities results for examination bacterium
| Strains tested | A | B | C | D | E | F | G | H | I | J | K | L |
| CWJ2 | +++ | ++ | +++ | +++ | +++ | ++ | +++ | +++ | +++ | ++ | +++ | - |
| Str | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | - |
| Flu | - | - | - | - | - | - | - | - | - | - | - | +++ |
Table 2 variable color aspergillus CWJ2 fermented liquid is to 12 kinds of Screening of Antibacterial Activities results for examination bacterium
| Strains tested | A | B | C | D | E | F | G | H | I | J | K | L |
| CWJ2 | ++ | + | ++ | + | ++ | + | ++ | + | ++ | + | + | - |
| Str | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | +++ | - |
| Flu | - | - | - | - | - | - | - | - | - | - | - | +++ |
In table 1 and table 2, A: subtilis; B: bacillus pumilus; C: streptococcus aureus; D: enterococcus faecalis; E: faecium; F: Listeria monocytogenes; G: streptococcus pyogenes; H: intestinal bacteria; I: pseudomonas aeruginosa; J: Acinetobacter bauamnnii; K: Klebsiella Pneumoniae; L: Candida albicans; Str: Streptomycin sulphate; Flu: fluconazole.
Note :-expression non-activity; + represent activity a little less than, antibacterial circle diameter <11mm; ++ represent that activity is medium, antibacterial circle diameter 11～15mm; +++ represent that activity is stronger, antibacterial circle diameter >15mm.
Conclusion: variable color aspergillus CWJ2 has stronger restraining effect to subtilis, bacillus pumilus, streptococcus aureus, enterococcus faecalis, faecium, Listeria monocytogenes, streptococcus pyogenes, intestinal bacteria, pseudomonas aeruginosa and Klebsiella Pneumoniae, illustrate that variable color aspergillus CWJ2 and meta-bolites thereof have good bacteriostatic activity, the object bacterial strain that can be used as screening novel antibacterial material develops and utilizes, and provides reference for researching and developing new drug and new Type of Preservatives.
Claims (1)
1. a strain has the variable color aspergillus of bacteriostatic activity, it is characterized in that this bacterial strain is variable color aspergillus (Aspergillus versicolor) CWJ2, be deposited in Chinese Typical Representative culture collection center, preservation address is Wuhan University of Wuhan City, preservation date is on April 16th, 2014, and deposit number is CCTCCNO:M2014130.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410219071.0A CN104004662A (en) | 2014-05-22 | 2014-05-22 | Aspergillus versicolor strain with antibacterial activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410219071.0A CN104004662A (en) | 2014-05-22 | 2014-05-22 | Aspergillus versicolor strain with antibacterial activity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104004662A true CN104004662A (en) | 2014-08-27 |
Family
ID=51365572
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410219071.0A Pending CN104004662A (en) | 2014-05-22 | 2014-05-22 | Aspergillus versicolor strain with antibacterial activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004662A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109504647A (en) * | 2019-01-04 | 2019-03-22 | 湖南农业大学 | A kind of cultural method of aspergillus versicolor HY12 bacterial strain |
| CN109628325A (en) * | 2019-01-04 | 2019-04-16 | 湖南农业大学 | A kind of aspergillus versicolor HY12 bacterial strain |
| CN113173904A (en) * | 2021-03-23 | 2021-07-27 | 中国地质大学（北京） | Novel bacteriostatic compounds and aspergillus for preparing same |
| CN113416653A (en) * | 2021-07-01 | 2021-09-21 | 中国农业大学 | Aspergillus discolours CAULIU-FUNGUS-2 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329739A (en) * | 2011-08-31 | 2012-01-25 | 云南大学 | Aspergillus versicolor for fermenting Jatropha cake to manufacture biological bacterial manure |
| CN102875551A (en) * | 2012-07-31 | 2013-01-16 | 中国科学院烟台海岸带研究所 | Chloro alkaloid compound and preparation and application thereof |
-
2014
- 2014-05-22 CN CN201410219071.0A patent/CN104004662A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329739A (en) * | 2011-08-31 | 2012-01-25 | 云南大学 | Aspergillus versicolor for fermenting Jatropha cake to manufacture biological bacterial manure |
| CN102875551A (en) * | 2012-07-31 | 2013-01-16 | 中国科学院烟台海岸带研究所 | Chloro alkaloid compound and preparation and application thereof |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109504647A (en) * | 2019-01-04 | 2019-03-22 | 湖南农业大学 | A kind of cultural method of aspergillus versicolor HY12 bacterial strain |
| CN109628325A (en) * | 2019-01-04 | 2019-04-16 | 湖南农业大学 | A kind of aspergillus versicolor HY12 bacterial strain |
| CN113173904A (en) * | 2021-03-23 | 2021-07-27 | 中国地质大学（北京） | Novel bacteriostatic compounds and aspergillus for preparing same |
| CN113173904B (en) * | 2021-03-23 | 2022-07-29 | 中国地质大学（北京） | Novel bacteriostatic compounds and aspergillus for preparing the same |
| CN113416653A (en) * | 2021-07-01 | 2021-09-21 | 中国农业大学 | Aspergillus discolours CAULIU-FUNGUS-2 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103184162B (en) | Trichoderma asperellum and applications thereof | |
| CN101993836B (en) | Bacillus subtilis strain YB-81, fungicide and preparation method and application thereof | |
| CN109456921B (en) | Paenibacillus polymyxa, application thereof, microbial agent, powder and granules | |
| CN107090419B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN110200018B (en) | Optimal DSE inoculation amount for promoting plant rooting | |
| CN105199996B (en) | A kind of bacillus amyloliquefaciens and its application for preventing graw mold of tomato | |
| CN113308392B (en) | Application of Nori endophytic Siamese bacillus | |
| CN114410484B (en) | Epicoccus nigrum, microbial agent, and preparation method and application thereof | |
| CN104004662A (en) | Aspergillus versicolor strain with antibacterial activity | |
| CN111647522A (en) | Entomopathogenic nematode symbiotic bacterial strain for inhibiting various plant fungal diseases and application thereof | |
| CN101942395B (en) | Aspergillus aculeatus | |
| CN108641989A (en) | One plant of Methylotrophic bacillus and its application | |
| CN110317747B (en) | Bacillus amyloliquefaciens JT68 and application thereof in prevention and treatment of tea anthracnose | |
| CN112011478A (en) | Dendrobium nobile endogenous Burkholderia gladioli BL-HTie-5 and application thereof | |
| CN113444651B (en) | Saffron endophytic fungus and application thereof in preventing and treating bulb rot | |
| CN112522127B (en) | Bacillus subtilis, microbial inoculum, bacterial liquid extract, preparation method and application | |
| CN102835423B (en) | Streptomyces mediolani ZW-1 bacterial strain, and bacteriostatic application of fermentation broth thereof | |
| CN102703365B (en) | Bacillus subtilis with bacteriostatic activity | |
| CN116536207A (en) | Bacillus atrophaeus WLKYSY-4, biological microbial inoculum and application thereof | |
| CN105733984B (en) | Bacillus subtilis and its application in terms of control of leaf spot of corn | |
| CN105018354A (en) | Trichoderma pleuroticola and application thereof | |
| CN105176895B (en) | A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt | |
| CN101486983B (en) | Bacillus for preventing wheat take-all and preparation thereof | |
| CN114933974A (en) | Trichoderma pseudokoningii C5-9 and application thereof in antagonism of botrytis cinerea | |
| CN102719384B (en) | Stenotrophomonas rhizophila with bacteriostatic activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140827 |