CN103993026A - High temperature cyclodextrin glucanotransferase gene and recombinant expression thereof - Google Patents

Abstract

The present invention relates to a high temperature cyclodextrin glucanotransferase (CGTase) gene, wherein cgt coding the CGTase gene is obtained by amplifying from GeobacilluscaldoxylosilyticusCHB1 genome, the sequence is represented by SEQ ID NO:1, and the expression vectors pLLP-OmpA and pEASY-E2-OmpA used by the gene achieve extracellular secretion expression. According to the present invention, the recombinant enzyme has the cyclization activity, the main products are alpha-cyclodextrin and beta-cyclodextrin, the optimum reaction temperature is 60-65 DEG C, the enzyme activity is low at a temperature of less than 50 DEG C and more than 85 DEG C, and the recombinant enzyme is suitable for industrial production of alpha-cyclodextrin and beta-cyclodextrin, and can meet requirements of the fields of food, medicine, cosmetics and the like on cyclodextrin.

Description

A kind of high temperature cyclodextrin glucosyl transferase gene and recombinant expressed

Technical field

The present invention relates to a kind of high temperature cyclomaltodextrin glucanotransferase (CGTase) gene cgt with and RT-PCR express.Specifically a kind of clone of cgt gene and in intestinal bacteria secretion expression.Recombinase can utilize Zulkovsky starch for substrate production alpha-cylodextrin and beta-cyclodextrin.

Background technology

High temperature cyclomaltodextrin glucanotransferase (CGTase) is the important member of alpha-amylase family, has cyclisation, disproportionation, hydrolysis and four kinds of activity of coupling.In current production, main its cyclization of application generates cyclodextrin taking starch as substrate.CGTase catalysis starch mainly produces three kinds of cyclodextrin: alpha-cylodextrin, beta-cyclodextrin and γ-cyclodextrin (respectively corresponding 6,7 and 8 glucosyl groups).Thereby the outside hydrophilic cavity structure of cyclodextrin inner hydrophobic can wrap up many small-molecule substances and improve the physico-chemical property of these materials, thereby is widely used in fields such as food, medicine, makeup, environment.

The CGTase of application is mainly derived from bacterium at present, has found Bacillus sp, Thermococcus sp various bacteria product CGTase.Owing to producing, CGTase wild type strain yield of enzyme is relatively low, the research of heavier apparent weight group CGTase enzyme genetic engineering bacterium in production application, the most frequently used CGTase expression of enzymes Host Strains is intestinal bacteria at present, also has this enzyme of report eukaryotic expression system Pichia anomala expression.The advantage of escherichia coli expression foreign gene is that expression amount is large, but also exists recombinant protein easily to form inclusion body, poorly soluble, and be difficult to realize the problem that exocytosis is expressed.Chen Jian etc. have compared unlike signal peptide to soaking the impact of sesame oil genus bacillus source CGTase secreting, expressing in recombination bacillus coli, prove that OmpA signal Toplink can effectively mediate the secreting, expressing of this enzyme; Montarop Yamabhai finds that the different Bacillus sp signal peptide in source can mediate the secreting, expressing of recombination in colibacillus well.

The present invention clone obtains being derived from a CGTase gene of thermophile bacteria Geobacillus sp, and application has been carried out efficient secretory expression with expression vector pLLP-OmpA and the pEASY-E2-OmpA of OmpA signal peptide to this enzyme.

Summary of the invention

An object of the present invention is to provide a kind of high temperature cyclodextrin glucosyl transferase gene and recombinant expressed, one comes from a cgt gene of thermophile bacteria Geobacillus caldoxylosilyticus CHB1, its nucleotide sequence comprises 2136 bases, its base sequence is as shown in SEQ ID NO:1, this gene has complete cyclodextrin glucosyltransferase gene cgt open reading frame, initiator codon ATG, terminator codon TAA, the highest by 2033/2138 (95%) with the homology of B.stearthermophillus cgt232 gene for cyclodextrin glucanotransferase in GenBank.Another object of the present invention is to provide the high temperature CGTase of the coding of above-mentioned cgt gene, this enzyme comprises 711 amino acid, comprising 35 amino acid whose signal peptide sequences, its aminoacid sequence as shown in SEQ ID NO:2, with CGTase highest homology in GenBank be 685/711 (96%).

Stearothermophilus ground bacterial strain of bacillus (Geobacillus caldoxylosilyticus) CHB1, this bacterial strain is registered preservation on August 28th, 2013 in Chinese Typical Representative culture DSMZ, deposit number is CCTCC M 2013384, and preservation address is Wuhan University.

A further object of the present invention is to provide and comprises two kinds of recombinant expression vector pLLP-OmpA-cgt of the present invention and pEASY-OmpA-cgt.

Another object again of the present invention is to provide two the host cell intestinal bacteria Top10F ' and the BL21 bacterial strain that comprise above-mentioned recombinant expression vector.

The present invention solves the problems of the technologies described above by the following technical programs:

The gene of a coded high temperature cyclomaltodextrin glucanotransferase, described gene is cgt gene, its base sequence is as shown in SEQ ID NO:1.

The protein of genes encoding as claimed in claim 1, its aminoacid sequence is as shown in SEQ ID NO:2.

Described recombinant expression vector is pLLP-OmpA-cgt and pEASY-OmpA-cgt, and this expression vector contains cgt gene described in secretion type expression signal peptide OmpA and claim 1.

In two kinds of host cell Top10F ' and BL21, be transformed into respectively expression vector pLLP-OmpA-cgt and pEASY-OmpA-cgt, realize cgt gene secretion expression in two kinds of host cells.

Concrete grammar is as follows:

First this cgt gene is cloned and checked order

(1) template preparation: get in the CHB1 in logarithm later stage bacterium liquid 1mL 10000 g in 1.5 mL centrifuge tubes centrifugally, with 100 ul sterilized water suspension thalline, be placed in rapidly 30 min on ice after boiling water bath 10 min, make pcr amplification template.

(2) design of primers: upstream primer is CF:ATGAAAAGATGGCTTTCATTG, downstream primer is CR:GTTTTGCCAATTCACTATAAT.

(3) pcr amplification of cgt: 95 DEG C of denaturation 5 min, then 94 DEG C of 50s, 55 DEG C of 50s, 72 DEG C of 2 min 30s, 33 circulations, last rear 10 min that extend, amplified production checks order after being connected to pMD19T.

Further for this gene order construction of expression vector and carry out recombinant expressed

(1) construction of expression vector: design front end primer CGTF:CGCGGATCCAATAAGGTAAATTTTACATCG(BamH1 from cgt signal peptide sequence), rear end primer CGTR:CGGAATTCGTTTTGCCAATTCACTATAAT(EcoRI), taking Geobacillus sp bacterium liquid as template amplification is with the goal gene of restriction enzyme site, amplified production send order-checking company to check order to confirm that base, without sudden change, obtains recombinant plasmid pMD19T-cgt after being connected with pMD19T carrier.Extract pMD19T-cgt plasmid, with BamH1 and EcoR1 double digestion, glue reclaims cgt object fragment.Extract plasmid pLLP-OmpA and plasmid pEASY-E2-OmpA, reclaim enzyme with glue after BamH1 and EcoR1 double digestion equally and cut product.By the goal gene after double digestion and plasmid T ₄dNA ligase connects, and connects product and transforms bacillus coli DH 5 alpha competent cell.Picking transformant is upgrading grain again, and double digestion is verified as positive colony, obtains recombinant expression plasmid pLLP-OmpA-cgt and pEASY-E2-OmpA-cgt.

(2) recon obtains and abduction delivering: recombinant plasmid pLLP-OmpA-cgt heat shock is transformed to intestinal bacteria chemoreception state cell Top10F ', recombinant plasmid pEASY-E2-OmpA-cgt heat shock is transformed to competent escherichia coli cell BL21, on Amp resistance LB flat board, picking transforms bacterium colony enlarged culturing, culture OD ₆₀₀reach at 0.6 o'clock adding final concentration is 1mM IPTG abduction delivering, and expression condition is 30 DEG C, 220 rpm, 10 h; Culture ultracentrifugation obtains thalline, ice-bath ultrasonic fragmentation after PBS suspends, and ultrasound parameter is power 400 W, ultrasonic 2s, interval 2s, works 80 times; The upper cleer and peaceful precipitation of getting respectively after fragmentation is carried out SDS-PAGE electrophoretic analysis.SDS-PAGE adopts the separation gel of 12 % and the concentrated glue of 4 %, coomassie brilliant blue R250 dyeing.

Detect further the extracellular enzyme vigor of recombinant bacterium

(1) picking recombinant bacterium list bacterium colony, is in the LB liquid nutrient medium (peptone 1 %, yeast soaks powder 0.5 %, NaCl 1 %, pH 7.0) of 100 mg/L in 50 mL penbritin concentration, 37 DEG C, and 200 rpm overnight incubation;

It is in the LB substratum of 100 mg/L that above-mentioned seed liquor is accessed 50 mL penbritin concentration by the inoculum size of (2) 1 %, and 37 DEG C, 200 rpm are cultured to OD ₆₀₀reach at 0.6 o'clock adding final concentration is the IPTG of 1mM, continues to cultivate, and each 6 h samplings detect Extracellular enzyme activity;

(3) detect recombinant alpha-CGTase activity, getting the fermented liquid supernatant obtaining after centrifugal is crude enzyme liquid 0.1 mL, join 3 %(w/v that 0.9 ml is housed uses in advance 50 mmol/L sodium phosphate buffers (pH 6.0) preparations) in the test tube of Zulkovsky starch solution, at 60 DEG C, react after 10 min, add the hydrochloric acid soln termination reaction of 1.0 mL 1 mol/L, add again 1.0 ml to use in advance the methyl orange solution of 0.1 mmol/L of 50 mmol/L sodium phosphate buffers (pH 6.0) preparation, after mixing, at 16 DEG C, be incubated 20 min, at wavelength, 505 nm places measure absorbancy.Calculate the concentration of alpha-cylodextrin according to alpha-cylodextrin typical curve, enzyme activity unit is defined as under above-mentioned reaction conditions per minute and generates the required enzyme amount of alpha-cylodextrin of 1 μ mol.

The invention has the advantages that: a kind of high temperature cyclodextrin glucosyl transferase gene is provided, and simultaneously the present invention is used for the two strain recombinant bacteriums of expressing this gene and all can realizes the exocytosis of restructuring cyclodextrin glucosyl transferase gene and express.For the suitability for industrialized production of this enzyme basis of laying a good foundation.The principal product that recombinase acts on Zulkovsky starch is alpha-cylodextrin and beta-cyclodextrin, and therefore this enzyme can be used for producing this two kinds of cyclodextrin products.

Brief description of the drawings

fig. 1cgt gene recombination plasmid pLLP-OmpA-cgt.

fig. 2cgt gene recombination plasmid pEASY-E2-OmpA-cgt.

fig. 3the SDS-PAGE checking of cgt recombinant bacterium pLLP-OmpA-cgt/Top10F ', wherein swimming lane M: protein standard molecular weight swimming lane 1: upper white protein swimming lane 2 after bacterial strain Top10F ' is broken: white protein swimming lane 3 is gone up in Top10F ' the bacterial strain fragmentation that contains plasmid pLLP-OmpA empty carrier afterwards: recombinant bacterial strain pLLP-OmpA-cgt/Top10F ' does not induce white protein swimming lane 4: recombinant bacterial strain pLLP-OmpA-cgt/Top10F ' induces broken postprecipitation albumen swimming lane 5 through IPTG: recombinant bacterial strain pLLP-OmpA-cgt/Top10F ' is upper white protein swimming lane 6 after IPTG induction fragmentation: the recombinant C GTase after ni-sepharose purification.

fig. 4cgt recombinant bacterium pEASY-E2-OmpA-cgt/BL21 expresses checking, wherein swimming lane M: protein standard molecular weight swimming lane 1: the broken postprecipitation albumen of bacterial strain e. coli bl21 swimming lane 2: white protein swimming lane 3 is gone up in the fragmentation of bacterial strain e. coli bl21 afterwards: recombinant bacterial strain pEASY-E2-OmpA-cgt/BL21 is induced precipitation albumen swimming lane 4 not: recombinant bacterial strain pEASY-E2-OmpA-cgt/BL21 does not induce white protein swimming lane 5: recombinant bacterial strain pEASY-E2-OmpA-cgt/BL21 induces broken postprecipitation albumen swimming lane 6 through IPTG: recombinant bacterial strain pEASY-E2-OmpA-cgt/BL21 is upper white protein after IPTG induction fragmentation.

fig. 5pEASY-E2-OmpA-cgt expresses the optimal reactive temperature of recombinase.

fig. 6 α, the HPLC peak figure of β and γ cyclodextrin standard substance.Whereinpeak 6.709 is alpha-cylodextrin, and peak 7.352 is beta-cyclodextrin, and peak 8.267 is γ-cyclodextrin .

fig. 7pEASY-E2-OmpA-cgt expresses the HPLC peak figure of CGTase catalysis Zulkovsky starch product, and wherein peak 6.709 is alpha-cylodextrin, and peak 7.352 is beta-cyclodextrin, and peak 8.267 is γ-cyclodextrin

Embodiment

Embodiment 1

The clone of the cgt gene of the present embodiment explanation bacterial strain Geobacillus caldoxylosilyticus CHB1 genome encoding.

Picking Geobacillus caldoxylosilyticus CHB1 bacterial strain list colony inoculation is in CHB1 liquid fermentation medium (beef extract 0.5 %, soy peptone 0.9 %, dipotassium hydrogen phosphate 0.1 %, potassium primary phosphate 0.75 %, distilled water preparation, pH 7.2), 60 DEG C, 180 rpm constant-temperature tables are cultivated, take the logarithm later stage bacterium liquid 1mL in the centrifuge tube of 1.5 mL sterilizings, and 1000 g are centrifugal, then use 100 ul sterilized water suspension thalline, after boiling water bath 10 min, be placed in rapidly 30 min on ice, be the required template of amplification cgt.Mix 1 ul template, 1 ul upstream primer (CF:ATGAAAAGATGGCTTTCATTG), 1 ul downstream primer (CR:GTTTTGCCAATTCACTATAAT), 25 ul ExTaqMix(comprise Buffer, Taq enzyme and dNTP), ddH ₂o complements to 50 ul.Apply above-mentioned reaction system and carry out pcr amplification, amplification program is 95 DEG C of denaturation 5 min, then 94 DEG C of sex change 50s, and 55 DEG C of annealing 50s, 72 DEG C are extended 2 min 30s, and totally 33 circulations are extended 10min after being finally 72 DEG C.The agarose gel electrophoresis of 1 % detects proves that amplification obtains being about the object fragment of 2100 bp.The PCR product that sepharose is cut after glue reclaims is connected in pMD19-T cloning vector, connect product and transform bacillus coli DH 5 alpha, converted product is coated blue white screening solid plate, 37 DEG C of overnight incubation, 8 white clones of picking are in liquid LB resistance culture base (peptone 1%, yeast soaks powder 0.5 %, NaCl 1 %, pH 7.0, penbritin 100 mg/L), after substratum muddiness, extract plasmid, plasmid is entrusted to the order-checking of order-checking company, result shows that the fragment of inserting is the goal gene of 2136 Nucleotide, its open reading frame can be encoded containing 711 amino acid whose protein.

Embodiment 2

The construction procedures of the present embodiment explanation cgt expression vector.

The present invention applies the recombinant plasmid of two kinds of expression vector establishment cgt genes, pLLP-OmpA plasmid is an expression plasmid containing coding sequence of secretory signal peptide OmpA by the control of PL promotor, pEASY-E2-OmpA is an expression plasmid that contains OmpA signal peptide by the control of T7 promotor, first application limitations restriction endonuclease BamH1 and EcoR1 carry out double digestion to plasmid pLLP-OmpA, pEASY-E2-OmpA, and sepharose is cut glue and reclaimed double digestion product.Then from cgt signal peptide sequence, design front end and express primer CGTF:CGCGGATCCAATAAGGTAAATTTTACATCG(BamH1), primer CGTR:CGGAATTCGTTTTGCCAATTCACTATAAT(EcoRI is expressed in rear end), amplification system is 1 ul upstream primer CGTF, 1 ul downstream primer CGTR, 25 ul ExTaqMix(comprise Buffer, Taq enzyme and dNTP), ddH ₂o complements to 50 ul.Amplification program is 95 DEG C of denaturation 5 min, then 94 DEG C of sex change 50s, and 55 DEG C of annealing 50s, 72 DEG C are extended 2 min 30s, and totally 33 circulations are extended 10 min after being finally 72 DEG C.After the agarose gel electrophoresis of 1 % detects, agarose gel electrophoresis is cut glue and is reclaimed cgt gene fragment.Application BamH1 and EcoR1 to goal gene double digestion after agarose gel electrophoresis reclaim endonuclease bamhi, the object fragment reclaiming is connected with pLLP-OmpA and pEASY-E2-OmpA plasmid after double digestion respectively, apply T ₄dNA ligase connects, the mol ratio of goal gene and plasmid is 10:1, connect product by two kinds and transform respectively bacillus coli DH 5 alpha competent cell, converted product is coated to the LB resistant panel containing 100 mg/L penbritins, 37 DEG C of overnight incubation, the some single bacterium colonies of picking line the resistant panel of new penbritin, carry out PCR checking with the mono-clonal of purifying, after two kinds of recombinant plasmid transformed of result, all obtain positive colony, obtained cgt gene recombination plasmid pLLP-OmpA-cgt(Fig. 1) and pEASY-E2-OmpA-cgt(Fig. 2), the positive bacterium colony of LB liquid culture, extracting plasmid.

Embodiment 3

The acquisition program of the present embodiment explanation cgt gene recombination bacterium.

Recombinant plasmid pLLP-OmpA-cgt is transformed to competent escherichia coli cell Top10F ', recombinant plasmid pEASY-E2-OmpA-cgt is transformed to competent escherichia coli cell BL21, two kinds of converted products are coated to the LB resistant panel containing 100 mg/L penbritins, 37 DEG C of incubated overnight, 6 single bacterium colonies of every kind of each picking of flat board are transferred in ammonia liquor penicillin G resistance culture base, 37 DEG C, 200 rpm are cultured to bacterium liquid and become muddy, primer CGTF is expressed in application and CGTR carries out bacterium liquid PCR checking, result proves to have obtained two kinds of recombination bacillus coli Top10F '/pLLP-OmpA-cgt and BL21/pEASY-E2-OmpA-cgt.37 DEG C of overnight incubation in two kinds of transformants of picking and 100mg/L ammonia benzyl resistance LB substratum respectively, then transfer in 100 mg/L ammonia benzyl resistance LB substratum with the inoculum size of 1 %, 37 DEG C, 200 rpm are cultured to OD600 and reach that to add final concentration at 0.6 o'clock be that the IPTG of 1mM induces, and induction time is 7 h.

Respectively get 8 mL bacterium liquid centrifugal, 3 mLPBS damping fluids suspend and precipitate, ice-bath ultrasonic fragmentation, and ultrasound parameter is power 400 W, ultrasonic 2s, interval 2s, works 80 times; The upper cleer and peaceful precipitation of getting respectively after fragmentation is carried out SDS-PAGE electrophoretic analysis.SDS-PAGE adopts the separation gel of 12 % and the concentrated glue of 4 %, coomassie brilliant blue R250 dyeing.SDS-PAGE result shows that two kinds of recombination bacillus colis have all realized the expression of CGTase, and Top10F '/pLLP-OmpA-cgt expression is shown in Fig. 3, and BL21/pEASY-E2-OmpA-cgt expression is shown in Fig. 4.

Embodiment 4

The exocytosis of this example explanation recombinant C GTase is expressed.

The qualitative detection of restructuring recombinant C GTase Extracellular enzyme activity: the seed liquor of two kinds of recombination bacillus colis is inoculated in the LB liquid nutrient medium that 50 mL contain penbritin according to 1% inoculum size, and 37 DEG C, 200 rpm cultivate, OD ₆₀₀reach the induction of the IPTG with final concentration 1mM in 0.6 o'clock, 25 DEG C are continued to cultivate, get 1mL bacterium liquid every 6 h, after ultracentrifugation, get the Zulkovsky starch solution of upper cleer and peaceful 100 ul 2 % of 100 ul in 60 DEG C of reaction 5 min, amylolytic activity is observed in the colour developing of iodine liquid, find that recombinant bacterium Top10F '/pLLP-OmpA-cgt and BL21/pEASY-E2-OmpA-cgt all have the ability of the outer degraded starch of born of the same parents, illustrate that the two has all realized extracellular expression.

The mensuration of recombinant C GTase Extracellular enzyme activity: the activity that detects extracellular enzyme cyclization product alpha-cylodextrin taking BL21/pEASY-E2-OmpA-cgt as example application Methyl Orange Discoloration method.Getting the fermented liquid supernatant obtaining after centrifugal is crude enzyme liquid 0.1mL, join 3 %(w/v that 0.9 ml is housed uses in advance 50 mmol/L sodium phosphate buffers (pH 6.0) preparations) in the test tube of Zulkovsky starch solution, at 60 DEG C, react after 10 min, add the hydrochloric acid soln termination reaction of 1.0 mL 1mol/L, add again 1.0 ml to use in advance the methyl orange solution of 0.1 mmol/L of 50 mmol/L sodium phosphate buffers (pH 6.0) preparation, after mixing, at 16 DEG C, be incubated 20 min, application microplate reader is measured absorbance A at wavelength 505 nm places, blank absorbance A 0 is set, proofread and correct absorbance A 1(Zulkovsky starch+methyl orange solution) and proofread and correct absorbance A 2(enzyme liquid+methyl orange solution), each measured value arranges three repetitions, calculation formula △ A=(A0-A)-(A0-A1)-(A0-A2), calculate the concentration of alpha-cylodextrin according to alpha-cylodextrin typical curve, enzyme activity unit is defined as under above-mentioned reaction conditions per minute and generates the required enzyme amount of alpha-cylodextrin of 1 μ mol.The cyclisation activity that measurement result is presented at extracellular enzyme while being induced to 70 h reaches 12 U.

Embodiment 5

This example has been determined the thermotonus scope of this recombinant C GTase enzyme.Apply above-mentioned Methyl Orange Discoloration method and measure the enzyme work under differing temps of this enzyme, result as shown in Figure 5.

Embodiment 6

This example has been determined the reaction product of this recombinant C GTase enzyme.Get recombinase after appropriate purifying in 3% Zulkovsky starch solution, 60% reaction 3h, use HPLC assay products composition after the filtering with microporous membrane of 0.22 μ m for reaction product.With α, tri-kinds of cyclodextrin standard substance of β and γ in contrast.Chromatographic column is nh 2 column, and moving phase is 60% acetonitrile, and flow velocity is 0.9mL/min, and column temperature is 30 degree, application differential refraction detector detector.Detected result shows that the mass ratio of alpha-cylodextrin is 32.04%, and beta-cyclodextrin is 56.24%, and γ-cyclodextrin is 11.72%.Peak figure result is as Fig. 6.

SEQUENCE LISTING

<110> Fujian Province Agriculture InstituteSoil and Fertilizer Institute

<120> high temperature cyclodextrin glucosyl transferase gene and recombinant expressed

<130> 6

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 2136

<212> DNA

<213> cgt gene base sequence

<400> 1

atgaaaagat ggctttcatt gattttctgc atgtcacttg tattcagcgc aatgtttttg 60

atgtctgata cgcagaaagt caccgttcca gcagctggaa atcttaataa ggtaaatatt 120

acatcggatg ttgtctatca aattgtattg gatcgatttg tcgatggaaa tacatcctat 180

aatccaagtg gagcattatt tagttcacga tgtacgaatt tacgcaagta ttgcggtcga 240

gactggcaag gtatcatcaa taaaattgac gatgggtatt taacagatat gggggtgtca 300

gcgatctgga tttctcagcc tgtagaatat gtattttctg tgatgaatga tgcaagccgt 360

tccacatcct accacggtta ttgggcgggc gattttaaaa agccaaatcc tttttttcgt 420

accctcagtg atttccaacg tttagttcat gccgcacatg caaaaggaat aaaggtagtt 480

attgactttg ctcccaacca tacttctgct gcctcagaaa ctgatccttc ttatatgcaa 540

aacggccgtc tgtatgataa cggtacagtc attggcggtt ataccaatga tacaaatcgc 600

tatttccatc ataatggcgg cacaacgatc tcaaatttag aggatgggat ttatcgatat 660

ctgtttgact tggcggacct taaccatgag aatcctgtta ttgataggta tttaaaacat 720

gcggtaaaaa tgtggataga tatgggattt gatggtatcc gtatggatgc ggtgaaggac 780

atgccgtttg gatggcaaaa atctctgttg gatgagattg ataactatcg tcctgtcgtt 840

acgtttgggg agtggttttt gtcagaatat gaagtggacg cgaacaatca tggctttccc 900

aatgaaagtg gaatgagttt gctcgatatt cgtttcggac aaaaacttcg tcaagtagtg 960

cgcaataaca gcgataattg gtatggtttt catcaaatga ttcaagatac agcatcagca 1020

tatgacgagg ttctcgatca agtgacattc atagacaacc atgatatgga tcggtttatg 1080

attgacggag gagatccgcg caaggtggat atggcacttg ctgtattatt gacatcccgt 1140

ggcgtaccga atatttacta tggtacagag caatacatga ccggtaacgg cgatcccaac 1200

aatcgtaaga tgatgggctc attcaataaa aatactcgcg catatcaagt gattcaaaaa 1260

ctatcttctc tccgacgaaa gaatccggcg ctagcctatg gtgatacgga tcagcgttgg 1320

atcaatggcg acgtgtaagt ctatgagcga cagtttggca aagatgtagt cttagttgcc 1380

gttaatcgta gttcaaggag aaattattca attactggct tatttacggc tttaccggca 1440

ggaacgtata cggatcacct aggcggcctt ttagacggaa acacaataca tgtcggttca 1500

aatggagcag ttaatgcttt cgacttagga ccaggggaag ttggcgtgtg cgcatacagt 1560

gcagcagaaa gcgcgcctat aattggtcat gttggaccga tgatgggcca tgtcggtcat 1620

caagtaacca ttgatggaga tggatttgga acaaatatgg gcactgtcaa cttcggaaca 1680

acagctgcca atgttgtgtc atggtctaac aatcaaaacg atgtggctgt gccaaatatg 1740

acaccaggaa aatataatat taccgtccaa tcatcaagcg gtcaaacgag tgcggcttat 1800

gataactttg aagtattaac aagtgatcaa gtctcagtgc ggtttgttgt taataacgct 1860

actaccaatc tagggcaaaa tatatacatt gttggcaacg tatatgagct cggcaactgg 1920

gacactagta aggcaatcgg tccaatgttc aatcaagtgg tttactccta tcctacatgg 1980

tatatagatg tcagtgtccc agaaggaaag acaattgagt ttaagtttat taaaaaagat 2040

agccaaggta atgccatttg ggaaagcggt tccaatcatg tttacacgac accaacgaat 2100

acaactggaa aaattatagt gaattggcaa aactaa 2136

<210> 2

<211> 710

<212> PRT

<213> aminoacid sequence

<400> 2

Met Lys Arg Trp Leu Ser Leu Ile Phe Cys Met Ser Leu Val Phe Ser

1 5 10 15

Ala Met Phe Leu Met Ser Asp Thr Gln Lys Val Thr Val Pro Ala Ala

20 25 30

Gly Asn Leu Asn Lys Val Asn Ile Thr Ser Asp Val Val Tyr Gln Ile

35 40 45

Val Leu Asp Arg Phe Val Asp Gly Asn Thr Ser Tyr Asn Pro Ser Gly

50 55 60

Ala Leu Phe Ser Ser Arg Cys Thr Asn Leu Arg Lys Tyr Cys Gly Arg

65 70 75 80

Asp Trp Gln Gly Ile Ile Asn Lys Ile Asp Asp Gly Tyr Leu Thr Asp

85 90 95

Met Gly Val Ser Ala Ile Trp Ile Ser Gln Pro Val Glu Tyr Val Phe

100 105 110

Ser Val Met Asn Asp Ala Ser Arg Ser Thr Ser Tyr His Gly Tyr Trp

115 120 125

Ala Gly Asp Phe Lys Lys Pro Asn Pro Phe Phe Arg Thr Leu Ser Asp

130 135 140

Phe Gln Arg Leu Val His Ala Ala His Ala Lys Gly Ile Lys Val Val

145 150 155 160

Ile Asp Phe Ala Pro Asn His Thr Ser Ala Ala Ser Glu Thr Asp Pro

165 170 175

Ser Tyr Met Gln Asn Gly Arg Leu Tyr Asp Asn Gly Thr Val Ile Gly

180 185 190

Gly Tyr Thr Asn Asp Thr Asn Arg Tyr Phe His His Asn Gly Gly Thr

195 200 205

Thr Ile Ser Asn Leu Glu Asp Gly Ile Tyr Arg Tyr Leu Phe Asp Leu

210 215 220

Ala Asp Leu Asn His Glu Asn Pro Val Ile Asp Arg Tyr Leu Lys His

225 230 235 240

Ala Val Lys Met Trp Ile Asp Met Gly Phe Asp Gly Ile Arg Met Asp

245 250 255

Ala Val Lys Asp Met Pro Phe Gly Trp Gln Lys Ser Leu Leu Asp Glu

260 265 270

Ile Asp Asn Tyr Arg Pro Val Val Thr Phe Gly Glu Trp Phe Leu Ser

275 280 285

Glu Tyr Glu Val Asp Ala Asn Asn His Gly Phe Pro Asn Glu Ser Gly

290 295 300

Met Ser Leu Leu Asp Ile Arg Phe Gly Gln Lys Leu Arg Gln Val Val

305 310 315 320

Arg Asn Asn Ser Asp Asn Trp Tyr Gly Phe His Gln Met Ile Gln Asp

325 330 335

Thr Ala Ser Ala Tyr Asp Glu Val Leu Asp Gln Val Thr Phe Ile Asp

340 345 350

Asn His Asp Met Asp Arg Phe Met Ile Asp Gly Gly Asp Pro Arg Lys

355 360 365

Val Asp Met Ala Leu Ala Val Leu Leu Thr Ser Arg Gly Val Pro Asn

370 375 380

Ile Tyr Tyr Gly Thr Glu Gln Tyr Met Thr Gly Asn Gly Asp Pro Asn

385 390 395 400

Asn Arg Lys Met Met Gly Ser Phe Asn Lys Asn Thr Arg Ala Tyr Gln

405 410 415

Val Ile Gln Lys Leu Ser Ser Leu Arg Arg Lys Asn Pro Ala Leu Ala

420 425 430

Tyr Gly Asp Thr Asp Gln Arg Trp Ile Asn Gly Asp Val Val Tyr Glu

435 440 445

Arg Gln Phe Gly Lys Asp Val Val Leu Val Ala Val Asn Arg Ser Ser

450 455 460

Arg Arg Asn Tyr Ser Ile Thr Gly Leu Phe Thr Ala Leu Pro Ala Gly

465 470 475 480

Thr Tyr Thr Asp His Leu Gly Gly Leu Leu Asp Gly Asn Thr Ile His

485 490 495

Val Gly Ser Asn Gly Ala Val Asn Ala Phe Asp Leu Gly Pro Gly Glu

500 505 510

Val Gly Val Cys Ala Tyr Ser Ala Ala Glu Ser Ala Pro Ile Ile Gly

515 520 525

His Val Gly Pro Met Met Gly His Val Gly His Gln Val Thr Ile Asp

530 535 540

Gly Asp Gly Phe Gly Thr Asn Met Gly Thr Val Asn Phe Gly Thr Thr

545 550 555 560

Ala Ala Asn Val Val Ser Trp Ser Asn Asn Gln Asn Asp Val Ala Val

565 570 575

Pro Asn Met Thr Pro Gly Lys Tyr Asn Ile Thr Val Gln Ser Ser Ser

580 585 590

Gly Gln Thr Ser Ala Ala Tyr Asp Asn Phe Glu Val Leu Thr Ser Asp

595 600 605

Gln Val Ser Val Arg Phe Val Val Asn Asn Ala Thr Thr Asn Leu Gly

610 615 620

Gln Asn Ile Tyr Ile Val Gly Asn Val Tyr Glu Leu Gly Asn Trp Asp

625 630 635 640

Thr Ser Lys Ala Ile Gly Pro Met Phe Asn Gln Val Val Tyr Ser Tyr

645 650 655

Pro Thr Trp Tyr Ile Asp Val Ser Val Pro Glu Gly Lys Thr Ile Glu

660 665 670

Phe Lys Phe Ile Lys Lys Asp Ser Gln Gly Asn Ala Ile Trp Glu Ser

675 680 685

Gly Ser Asn His Val Tyr Thr Thr Pro Thr Asn Thr Thr Gly Lys Ile

690 695 700

Ile Val Asn Trp Gln Asn

705 710

<210> 3

<211> 21

<212> DNA

<213> artificial sequence

<400> 3

atgaaaagat ggctttcatt g 21

<210> 4

<211> 21

<212> DNA

<213> artificial sequence

<400> 4

gttttgccaa ttcactataa t 21

<210> 5

<211> 30

<212> DNA

<213> artificial sequence

<400> 5

cgcggatcca ataaggtaaa ttttacatcg 30

<210> 6

<211> 29

<212> DNA

<213> artificial sequence

<400> 6

cggaattcgt tttgccaatt cactataat 29

Claims (4)

1. the gene of a coded high temperature cyclomaltodextrin glucanotransferase, is characterized in that: described gene is cgt gene, and its base sequence is as shown in SEQ ID NO:1.

2. the protein of genes encoding as claimed in claim 1, is characterized in that: its aminoacid sequence is as shown in SEQ ID NO:2.

3. the recombinant expression vector of gene as claimed in claim 1, is characterized in that: described recombinant expression vector is pLLP-OmpA-cgt and pEASY-OmpA-cgt, and this expression vector contains cgt gene described in secretion type expression signal peptide OmpA and claim 1.

4. gene recombinant expressed according to claim 3, it is characterized in that: in two kinds of host cell Top10F ' and BL21, be transformed into respectively expression vector pLLP-OmpA-cgt and pEASY-OmpA-cgt, realize cgt gene secretion expression in two kinds of host cells.