CN103981186A

CN103981186A - Interfering RNA and lentivirus targeted to OLFM4 gene, and application thereof

Info

Publication number: CN103981186A
Application number: CN201410186285.2A
Authority: CN
Inventors: 黄轶; 宋利华; 李阳; 包黎明
Original assignee: Childrens Hospital of Chongqing Medical University
Current assignee: Childrens Hospital of Chongqing Medical University
Priority date: 2014-05-05
Filing date: 2014-05-05
Publication date: 2014-08-13

Abstract

The invention provides interfering RNA and a lentivirus vector targeted to the OLFM4 gene and application of the interfering RNA and the lentivirus vector in preparation of drugs used for preventing and treating metastasis of stomach cancer tumors to the abdominal cavity or/and the liver. According to the invention, since the interfering RNA can inhibit in vitro migration and invasion ability of gastric cancer cells and liver metastasis capability of gastric cancer cells, decreased expression of OLFM4 is a potential effective mode for treatment of malignant progression of late gastric cancer. It is further determined that an NF-kB signal is an upstream regulation transcription factor of expression of OLFM4 and the interfering RNA has NF-kB signal feeding back and regulating functions.

Description

RNA interfering, slow virus and the application thereof of target OLFM4 gene

Technical field

The invention belongs to genetically engineered field, relate generally to and utilize the reticent OLFM4 gene of RNAi for the preparation of preventing, treat cancer of the stomach tumour to abdominal cavity or/and the application in the medicine of hepatic metastases.

Background technology

Cancer of the stomach is the second largest common cancer of China, is also the lethal second largest reason of cancer.Although Comprehensive Therapy on Gastric Carcinoma measure development is perfect at present, make current treatment still can not obtain promising result, because most patients with gastric cancer have belonged to middle and advanced stage in the time that head examines, advanced gastric carcinoma accounts for inpatient more than 90%, and within postoperative 5 years, survival rate is hovered for a long time at 30-50%.Research at present finds that the major cause of most of malignant oncotherapy poor effect is to shift and recurrence.Cancer of the stomach late period, there is hematogenous spread through invasion and attack and be transferred to other organs as liver through portal vein in pernicious cancer cells, causes multiple Organ Failure, and therefore gastric cancer invasion and hepatic metastases are one of main reasons of late gastric cancer death.Thus, for the anti-metastasis treatment present situation of cancer of the stomach, find infiltration and hepatic metastases that a therapeutic target spot suppresses cancer of the stomach, will contribute to improve curing gastric cancer, improving, late gastric cancer survival is significant.

Say from medical angle, the unrestricted propagation of tumour cell is optimum and common trait malignant tumour; The malignant invasion of tumour is one of principal character of distinguishing benign tumour and malignant tumour with shifting.The most important Biological characteristics of malignant tumour is that malignant tumour not only can infiltrate growth at original site, involve tissue; But also can be by number of ways diffusion transfer to other positions of health.Although invasion and attack and shift and be the growth characteristics of malignant tumour, the two is different pathological process, and infiltration is the prelude shifting, but and be not equal to certain transfer, but shift the process that must comprise invasion and attack, they form sending out of malignant tumour jointly.Many treatment target spots are not equal to it and have regulation and control malignant invasion and transfer ability simultaneously the multiplication capacity regulation and control of tumour cell.Find at present, Several Kinds of Malignancy high expression level albumen, as Cyclin D1, has cell cycle regulation and cell proliferation function, but does not have the malignant invasion of control and forwarding function.

OLFM4, has another name called GW112, hGC-1, hOlfD, is that newfound a kind of sense of smell that has being produced by granulocyte colony-stimulating factor GM-CSF stimulation in 2002 mediates plain structural domain (olfactomedin domain) protein family member molecule.It is cloned the myeloblast in people at first, is positioned at No. 13 chromosome 13q14 .3 of the mankind, 510 amino acid of encoding, and the precursor that its protein product is olfactomedin4, belongs to sense of smell and mediates plain olfactomedin associated protein family.This proteinoid multilist reaches in neural system, relates to neural growth.

OLFM4 albumen is a kind of secreting glycoprotein, comprises carbon hydrate chain and disulphide polymer that N-connects, and it is combined with the multiple lectin of cell surface, as common lectin 1, canavaline lectin A, wheat germ agglutinin.The conservative halfcystine of GW112 albumen to albumen oligomerization or secrete extremely important, wherein halfcystine 83,85,246 and 437 to be that albumen dimer forms necessary, Cys2 26 is keys that polymer forms.The interaction of OLFM4 albumen and cadherin, the sense of smell that depends on OLFM4 PROTEIN C end mediates plain region.OLFM4 albumen can stick to cell surface, strengthens diffusion and the adhesive attraction of NIH3T3 and 293T/17 cell.

Summary of the invention

The RNA interfering that the object of the present invention is to provide a kind of target OLFM4 gene for the preparation of prevention, diagnosis, treatment cancer of the stomach tumour to abdominal cavity or/and the purposes in the medicine of hepatic metastases.

The object of the invention is to realize by following measures:

A RNA interfering for target OLFM4 gene, its nucleotide sequence is as follows

Positive-sense strand:

5′-CCGG AACGCTTGGAATTCACAGCTC GAGCTGTGAATTCCAAGCGTTTTTTTG-3′；

Antisense strand:

5′-AATTCAAAAA AACGCTTGGAATTCACAGCTC GAGCTGTGAATTCCAAGCGTT-3′。

The DNA sequence dna of stating the transcribed special target OLFM4 of going out gene interferential RNA (RNAi) described in external synthesizing, OLFM4 gene RNAi target spot DNA sequence dna is: AACGCTTGGAATTCACAGCTC.RNA interfering, underscore part be depicted as OLFM4 gene RNAi target spot DNA sequence dna, form " Stem (the stem) " structure division of transcribing rear RNA; Shown in frame, part is the loop ring structure of 6 bases, has and connects " stem " structure function of transcribing rear RNA.

The present invention further provides the Lentivirus slow virus that comprises above-mentioned interferential RNA, the structure of described lentiviral vectors as shown in Figure 1.Above-mentioned RNA interference sequence is through the external double-stranded DNA that synthesizes of annealing, and connect into RNAi interference carrier by two sections of restriction enzyme sites, transfection or be packaged into virus and cells infected after, in cell, can transcribe out the RNAi fragment that special inhibition OLFM4 gene messenger RNA(mRNA) (mRNA) is transcribed, effectively reduce OLFM4 gene mRNA transcriptional level and then OLFM4 protein expression is suppressed.

The RNAi lentiviral vectors of above-mentioned target OLFM4 gene, preparation method comprises the following steps:

(1) external synthetic above-mentioned DNA sequence dna;

(2) annealing pairing produces DNA double chain, the GV115 carrier after being connected into enzyme and being cut by the contained restriction enzyme site AgeI in two ends and EcoRI;

(3) proceed to the bacterium competent cell preparing, extracting DNA recombinant plasmid by connecting product; DNA sequencing is verified positive recombinant clone;

(4) Lentivirus virus packaging:

1. 24h before transfection, with the 293T cell of tryptic digestion logarithmic phase, adjusts cell density as 1.2 × 10 taking the substratum containing 10% serum ⁷cell/20ml, is re-seeded into 15cm Tissue Culture Dish, 37 DEG C, 5%CO ₂in incubator, cultivate.24h can be used for transfection in the time that cell density reaches 70%～80%.Cell state is most important for virus packaging, therefore needs to ensure good cell state and less passage number.

2. before transfection, cell culture medium is replaced by serum free medium by 2h.

3. in a sterilizing centrifuge tube, add prepared each DNA solution (pGC-LV carrier 20 μ g, pHelper1.0 carrier 15 μ g, pHelper2.0 carrier 10 μ g), mix with the Opti-MEM substratum of respective volume, adjustment cumulative volume is 2.5ml, at room temperature incubation 5 minutes.

4. Lipofectamine2000 reagent is softly shaken up, draw 100 μ l Lipofectamine2000 reagent and mix at another Guan Zhongyu 2.4ml Opti-MEM, at room temperature incubation 5 minutes.

5. the DNA after dilution is mixed with the Lipofectamine2000 after dilution, put upside down and mix lightly, not vibration.Must within 5 minutes, mix.

6., after mixing, at room temperature incubation 20 minutes, to form the transfection composite of DNA and Lipofectamine2000 diluent.

7. DNA and Lipofectamine2000 mixed solution are transferred in the nutrient solution of 293T cell, mix, in 37 DEG C, in 5%CO2 cell culture incubator, cultivate.

8. cultivate and remove the substratum that contains transfection miscellany after 8h, every bottle of cell adds the PBS liquid of 20ml, gently double swerve once culturing bottle to wash remaining transfection miscellany, then go.

9. in every bottle of cell, add the cell culture medium 25ml containing 10% serum, in 37 DEG C, 5%CO ₂in incubator, continue to cultivate 48 hours.

(5) results of virus and concentrated

1. collect the 293T cell conditioned medium liquid of 48 hours (transfection can be and count for 0 hour) after transfection.

2. in 4 DEG C, the centrifugal 10min of 4000g, removes cell debris.

3. with 0.45 μ m filter filtering supernatant in 40ml ultracentrifugation pipe.

4. viral crude extract sample is joined to (19ml at most) in filtering cup, cover lid.Filtering cup is inserted in filtered solution collection tube.

5. after combining, carry out balance, be placed in rotary head.

6. centrifugal at 4000 × g, to the concentrated volume of the virus needing.Conventionally the time needing is 10-15 minute.

7. after centrifugal end, take out centrifugal device, filtering cup and filtered solution collection cups are below separated.

8. filtering cup is tipped upside down on sample collection cup.

9. centrifugal force is no more than 1000g, and the time is 2 minutes.Excessive speeds can cause sample loss.Filtering cup is removed from sample collection cup.In sample collection cup, be viral concentrated solution.

10. viral concentrated solution is shifted out, after packing, be kept in viral pipe, preserve for-80 DEG C long-term.Get wherein one and carry out viral biology titer determination.

(6) Lentivirus titer determination

1. measure the day before yesterday, for measuring required cell (293T cell: the adherent growth) bed board of titre, 96 orifice plates, each hole adds 4 × 10 ⁴individual cell, volume is 100 μ L;

2. according to viral expection titre, prepare 7-10 aseptic Ep pipe, every pipe adds the serum free medium of 90 μ l.

3. get virus stock solution used to be determined 10 μ l and join in first pipe, after mixing, get 10 μ l and join in second pipe.Continue a to the last pipe of identical operation.

4. choose required cell hole, suck 90 μ l substratum, abandon; The viral solution that adds 90 μ l to dilute.Putting into incubator cultivates.

5. after 24 hours, add perfect medium 100 μ l.Careful operation, does not blow afloat cell.

6. after 4 days, observe luciferase expression feelings Saeka and observe luciferase expression situation.Fluorocyte number reduces with the increase of extension rate.

7. titre is calculated: according to GFP expression in fluorescence picture.

Above-mentioned interferential RNA or slow virus for the preparation of prevention, diagnosis, treatment cancer of the stomach tumour to abdominal cavity or/and the purposes in the medicine of hepatic metastases.

Above-mentioned interferential RNA or the slow virus purposes in the medicine for the preparation of the conduction of inhibition NF-KB signal pathway.

Beneficial effect

1. the invention provides the purposes that OLFM4 gene is new, the transfer of stomach cancer cell to liver and abdominal cavity that it has utilized the reticent OLFM4 expression inhibiting of RNAi, has established and has shifted control target spot, is the curative effect that a kind of effective Intervention Strategy improves cancer of the stomach.

2. the present invention has designed and has built RNA interfering and the carrier thereof of selectively targeted OLFM4 gene, energy stable transfection stomach cancer cell line, thus suppress OLFM4 protein expression, thus the intervention for the treatment of for Metastasis of Gastric Cancer for the transfer of inhibition cancer of the stomach provides Effective target site.

3. the present invention proves to utilize the OLFM4-siRNA of lentivirus mediated not only to have the external migration and the invasive ability that suppress stomach cancer cell, can also have the hepatic metastasis ability that suppresses stomach cancer cell; Make to weaken OLFM4 and express the effective means with potential treatment late gastric cancer malignant progression.And further clear and definite NF-kB signal be OLFM4 express upstream regulative transcription factor, also there is feedback regulation NF-kB semiotic function.In the key issue that the present invention treats at cancer of the stomach anti-metastasis at the OLFM4-siRNA of lentivirus mediated, there is following innovation

(1) the OLFM4-siRNA mode of employing lentivirus mediated, can be used as inside and outside siRNA and transmits effective means; And the siRNA of its expression can specificity suppress OLFM4 genetic expression, reach the stable effect that suppresses OLFM4 genetic expression in stomach cancer cell.

(2) the stable inhibition that lentivirus mediated OLFM4-siRNA expresses OLFM4, has the external migration of stomach cancer cell of attenuating and invasive ability; Especially significantly suppressed the hepatic metastasis ability of stomach cancer cell in body.

(3) down-regulated expression of OLFM4 gene can feedback inhibition NF-KB signal pathway, utilizes and suppresses OLFM4 by feedback inhibition NF-KB signal, suppresses the hepatic metastasis ability of stomach cancer cell.

Brief description of the drawings

The RNAi lentiviral vectors structure iron of Fig. 1 target OLFM4 gene

Titer determination fluorescence photo (the sample explanation: add 10ul virus stock solution used in first Ep pipe, be designated as 1E+1 μ l of the RNA interfering slow virus building in Fig. 2 embodiment 1; In second Ep pipe, carried out ten times of dilutions for the first time, gained virus stock solution used is 1/10 in first Ep, is designated as 1E+0 μ l; In the 3rd Ep pipe, carried out ten times of dilutions for the second time, gained virus stock solution used is 1/10 in second Ep, is designated as 1E-1 μ l)

OLFM4-siRNA sequence order-checking collection of illustrative plates in Fig. 3 embodiment 1

NC-siRNA negative control (NC-GFP-LV) sequence order-checking collection of illustrative plates in Fig. 4 embodiment 1

Fluorescent effect after MKN-45 cell infection slow virus 48h in Fig. 5 embodiment 1

In Fig. 6 embodiment 1, after selected by flow cytometry apoptosis, record GFP+ fluorescence rate

In Fig. 7 embodiment 1, detecting OLFM4mRNA in cell through Real-time PCR expresses

In Fig. 8 embodiment 1, OLFM4 strikes and subtracts rear Western blot detection OLFM4 protein expression

In Fig. 9 embodiment 2, Transwell method is measured transfer ability, and left figure is typical picture (200 ×) in three experiments, and right figure is the average migrating cell number in lower 10 the random visuals field of microscope

In Figure 10 embodiment 2, Transwell method is measured MKN-45 cell invasion ability, and left figure is typical picture (200 ×) in three experiments, and right figure is the average invasion and attack cell count in lower 10 the random visuals field of microscope

Liver surface and the comparison of mesentery metastatic tumour tubercle quantity after tail vein injection and abdominal injection MKN-45 in Figure 11 embodiment 2, upper figure is metastatic tumour typical picture under naked eyes, figure below is liver surface and mesentery metastatic tumour tubercle mean number

HE staining examine metastatic tumour tissue in Figure 12 embodiment 2

In Figure 13 embodiment 3, comparison OLFM4 strikes and subtracts NF-κ B correlative protein expression level in rear total protein

In Figure 14 embodiment 3, relatively OLFM4 strikes and subtracts NF-κ B pathway associated protein expression level in the expression of OLFM4 in rear plasmosin and endochylema karyon albumen

It is obviously suppressed that in Figure 15 embodiment 3, OLFM4 strikes the combination activity of low rear karyon albumen and NF-κ B DNA

Amplification curve (A) and the part melt curve analysis (B) of the gene test of people's metastases Real-time pcr chip in Figure 16 embodiment 3

Embodiment

Below in conjunction with embodiment, the specific embodiment of the present invention is further described, does not therefore limit the present invention among described scope of embodiments.

The foundation of the structure of embodiment 1 lentiviral vectors and the strain of sense of stability transfect cell

1 material

1.1 cell strain

Human stomach cancer cell line MKN-45 is purchased from Shanghai cell institute of Sheng Ke institute.

1.2 slow viruss build RNA sequence

OLFM4-RNAi interfered target sequence: AACGCTTGGAATTCACAGCTC

NC-RNA sequence: TTCTCCGAACGTGTCACGT

1.3 design of primers

OLFM4 amplimer sequence:

OLFM4-F：5′-ACAGAGTGGAACGCTTGGAA-3′

OLFM4-R：5′-CCTTCTCCATGATGTCAATTCG-3′

Internal reference β-actin amplimer sequence:

β-actin-F：5′-CCAACCGCGAGAAGATGA-3′

β-actin-R：5′-CCAGAGGCGTACAGGGATAG-3′

1.4 main agents and consumptive material

1.5 key instrument

2 methods

2.1 cell cultures

DMEM culture medium culturing containing 10%FBS for all stomach cancer cell lines, adds 1ml microbiotic (containing 1% penicillin and Streptomycin sulphate) in 100ml substratum, cultivate in 37 DEG C, the incubator of 5%CO2.Conventional within two days, change liquid or grow to 80% until attached cell go down to posterity while converging, go down to posterity and use 0.25% trysinization, the vegetative period cell of taking the logarithm is tested.

The structure of 2.2 slow viruss

2.2.1 design and synthesize the DNA sequence dna for OLFM4 gene RNA interfering:

Positive-sense strand: 5 '-CCGG aACGCTTGGAATTCACAGCTC gAGCTGTGAATTCCAAGCGTTtTTTTG-3 ';

Antisense strand: 5 '-AATTCAAAAA aACGCTTGGAATTCACAGCTC gAGCTGTGAATTCCAAGCGTT-3 ';

2.2.2RNAi the preparation of slow virus, packaging and titre detect

(1) justice and antisense strand annealing pairing is produced to DNA double chain, the GV115 carrier after being connected into enzyme and being cut by the contained restriction enzyme site AgeI in two ends and EcoRI, is shown in Fig. 1;

(2) proceed to by connecting product the bacterium competent cell preparing, DNA sequencing is verified positive recombinant clone, and order-checking collection of illustrative plates is shown in Fig. 3 and Fig. 4;

(3) Lentivirus virus packaging:

1. 24h before transfection, packs 293T cell by the virus of tryptic digestion logarithmic phase, adjusts cell density as 1.2 × 10 taking the substratum containing 10% serum ⁷cell/20ml, is re-seeded into 15cm Tissue Culture Dish, 37 DEG C, 5%CO ₂in incubator, cultivate.24h can be used for transfection in the time that cell density reaches 70%～80%.Cell state is most important for virus packaging, therefore needs to ensure good cell state and less passage number.

4. Lipofectamine2000 reagent is softly shaken up, Jue gets 100ul Lipofectamine2000 reagent and mixes at another Guan Zhongyu 2.4ml Opti-MEM, at room temperature incubation 5 minutes.

7. DNA and Lipofectamine2000 mixed solution are transferred in the nutrient solution of 293T cell, mix, in 37 DEG C, 5%CO ₂in cell culture incubator, cultivate.

(4) results of virus and concentrated

2. in 4 DEG C, the centrifugal 10min of 4000g, removes cell debris.

5. after combining, carry out balance, be placed in rotary head.

8. filtering cup is tipped upside down on sample collection cup.

(5) Lentivirus titer determination

2. according to viral expection titre, prepare 7～10 aseptic Ep pipes, every pipe adds the serum free medium of 90 μ l.

7. titre is calculated: according to GFP expression in fluorescence picture.

As observed 2 cells with fluorescence in the hole that adds 1E-6 μ l virus stock solution used, illustrating in this hole has at least 2 virions to infect cell, this viral titre equals cell count with fluorescence divided by virus stock solution used amount, be exactly 2/ (1E-6)=2E+6, unit is TU/ μ l, also just equals 2E+9TU/ml.

With the slow virus of puromycin resistance, judge titre numerical value by metainfective viable cell quantity, if observe 3 cell survivals in the hole that adds 1E-5 μ l virus stock solution used, illustrating in this hole has at least 3 virions to infect cell, this viral titre equals cell count with fluorescence divided by virus stock solution used amount, in this example, be exactly 3/ (1E-5)=3E+5, unit is TU/ μ l, also just equals 3E+8TU/ml.Puromycin resistance medicine adds the time of cell different with dosage, can cause the difference of titre result.(seeing Fig. 2)

(6) obtain two kinds high titre slow viruss: contrast slow virus NC-GFP-LV and OLFM4 strike the RNA interfering slow virus Si-OLFM4-LV subtracting.

The infection of 2.3 slow viruss

2.3.1 cell grouping

Experiment is divided into 3 groups:

Interference group: infect the MKN-45 cell that disturbs slow virus OLFM4-RNAi-LV

Negative group: the MKN-45 cell that infects negative control slow virus NC-GFP-LV

Blank group: the MKN-45 cell that does not infect slow virus

2.3.2 cell bed board (24 well culture plate): infect the MKN45 stomach cancer cell in vegetative period of taking the logarithm the day before yesterday, outwell substratum, with after twice of PBS rinsing, every bottle adds 0.25% pancreatin 400ul, shakes up gently, the cell at the bottom of pancreatin is covered bottle completely.Two culturing bottles are put back to 37 DEG C, the incubator of 5%CO2 and are hatched the about 5min of digestion.Treat that under microscope, the obvious shrinkage of observation of cell form becomes circle, edge refractivity strengthens, add the appropriate DMEM containing foetal calf serum to stop trysinization, and move on to respectively in two 15ml centrifuge tubes after making cell suspension with the dropper piping and druming bottle end, 750rbp, 3min is centrifugal.Use PBS washed twice, centrifugal.Two centrifuge tubes add respectively 1mlDMEM, dispel into single cell suspension, get 10ul for counting.Such as: cell counting result is: 6.4 × 10 ⁵individual/ml, and every hole of 24 orifice plates need to inoculate 3.5 × 10 ⁴individual cell, inoculating 4 holes needs 1.4 × 10 ⁵individual cell, joins in 4mlDMEM therefore need to get 220ul cell suspension, after mixing, on average joins in 4 holes of 24 orifice plates every hole 1ml.Be uniformly distributed in each hole at Microscopic observation cell, put back to 37 DEG C, the incubator of 5%CO2 and cultivate 24h.

2.3.3 slow virus infection stomach cancer cell: observe 24 orifice plate cell attachments evenly good, cytogamy degree approximately 60%.Take out slow virus NC-GFP-LV and Si-OLFM4-LV from-80 DEG C of refrigerators, take out Polybrene from-20 DEG C of refrigerators, take out Opti-MEM substratum from 4 DEG C of refrigerators, place 15min in room temperature.Get in 0.9mlOpti-MEM substratum to 1.5mlEP pipe, and add wherein 0.72ulPolybrene, fully mix, manage 3 1.5mlEP pipes of average packing by 300ul/, and on EP pipe, carry out mark: 0ul, 40ul, 40ul.The slow virus (NC-GFP-LV) that adds successively 0ul, 40ul, 40ul by the good order of mark, light shaking mixes, and forms and infects mixture, under room temperature, hatches 10-15min.From 37 DEG C, 5%CO ₂incubator take out 24 well culture plates, with liquid-transfering gun sucking-off substratum gently, and with PBS twice of rinsing gently.The first hole adds 1.0ml to contain the perfect medium of serum, is used as blank.The second hole adds the infection mixture 300ul containing 0ul slow virus, as condition contrast.The 3rd hole and the 4th hole add the infection mixture 300ul containing 40ul slow virus, as experimental group.Shake is evenly infected cell gently up and down.After 6h, add the perfect medium of 700ul containing serum.37 DEG C, 5%CO ₂incubator incubated overnight, after 12h, renew fresh perfect medium.After infecting 48h, observe fluorescence.The same NC-GFP-LV of infection step of Si-OLFM4-LV.

2.3.4 observe fluorescence rate: infect after 48h and observe fluorescence, do not obtain the about 40-70% of fluorescence rate not etc. at fluorescence microscopy Microscopic observation.(seeing Fig. 5)

2.4 selected by flow cytometry apoptosis are also surveyed fluorescence rate

2.4.1 sorting cells is prepared:

(1) MKN-45-GFP, MKN-45-Si-OLFM4 two class cells, 2 bottles, large size culturing bottle, total cellular score is greater than 10 ⁷individual.

(2) parental cell MKN-45, as control group sample, proofreaies and correct and uses using machine before sorting.

2.4.2 sorting the day before yesterday:

(1) prepare 8 disposable sterilized centrifuge tubes of aseptic 15ml (another 4 for subsequent use).In every centrifuge tube, adding 15ml foetal calf serum (FBS) to carry out embedding spends the night.

(2) wash clean streaming pipe, dries, and after uv irradiating 30min, fills with 75% alcohol the streaming pipe that 6 dresses treat that sorting cells is used, and is put in the interior uv irradiating of Bechtop and spends the night, and carries out disinfection.

(3) by tomorrow required use object be all put in worktable, uv irradiating spends the night.

(4) autoclave sterilization cell filter (size: 300 orders, are placed in lunch box and also with cloth, lunch box are wrapped), and after drying, put worktable irradiation into and spend the night.

2.4.3 sorting same day:

(1) preparation aseptic culture medium: containing 30%FBS and 4% dual anti-DMEM.

(2) prepare aseptic sorting damping fluid: the substratum or the PBS damping fluid (can not have bubble when sorting, and serum easily producing bubble, therefore can not contain FBS) that do not contain FBS.

(3) outwell the serum (can reclaim) of 4 15ml centrifuge tubes, only stay the pure FBS of 3ml and add 30ul dual anti-when sorting is complete (ensure serum-concentration be greater than 5%), for the use that accesses of cell after sorting.(when sorting, also have other liquid to be connected in pipe together, thus must fill the pure FBS of 3ml, and a 15ml centrifuge tube may also can not load, therefore a kind of cell must be prepared two 15ml centrifuge tubes.) on each centrifuge tube by the cell title that accesses on marker mark, in order to avoid obscure while accessing.

(4) single cell suspension preparation:

[1] all cells is washed after twice with PBS, with 0.25% pancreatin 37 degree digestion, digestion time becomes circle with the obvious shrinkage of cellular form under microscope and is as the criterion (make sure to keep in mind can not over-effect), adds containing in 10%FBS substratum and pancreatin, blows and beats into individual cells suspension.Move to respectively in 15ml centrifuge tube 1000rbp, centrifugal 5min.

[2] outwell supernatant liquor, add 5mlPBS, after dispelling, respectively get 10ul for cell counting.

[3] add 5mlPBS again wash, centrifugal, 1000rpm, 5min is centrifugal.

[4] outwell 75% alcohol in streaming pipe, and cover 2-3 time with PBS wash formula pipe and pipe.

[5] each centrifuge tube adds 1ml sorting damping fluid, and (making final single cell suspension concentration is 5-10 × 10 to dispel into cell suspension ⁶/ ml, total cellular score is 10 ⁷individual), move on to separately 1.5mlEP pipe.

[6] prepare single cell suspension: be ready to streaming pipe and cell filter, with sucking-off completely after several lower cell suspensions of 1ml liquid-transfering gun suction, left hand is held strainer and is overdoed on spirit lamp, and be pressed in the streaming pipe mouth of pipe, the armed aligning streaming of the right hand mouth of pipe is got cell suspension fast from the mesh of filter, is single cell suspension (pipe subscript clear-cells title, cell concn) in streaming pipe.

(5) parental cell MKN-45 prepares same sorting cells.But cell concn is 10 separately ⁵-10 ⁶/ ml, prepares 1ml cell suspension.With the resuspended filtration of sorting damping fluid, proofread and correct and observation of cell background use using machine before sorting.

(6) upper machine sorting, the cell obtaining after sorting is centrifugal immediately, 1000rpm, 5min.With one or 2 small size disposable sterilized plastics air-permeable envelope culturing bottles cultivations of 50ml (being conducive to cell attachment), add 4ml to contain 30%FBS and 4% dual anti-DMEM, 37 DEG C, the incubator of 5%CO2 are cultivated, and change fresh culture every day, within about 4-6 days, press normal cell cultivation.

(7) record GFP fluorescence rate: see Fig. 6.

2.5Real-time PCR detects OLFM4mRNA and expresses

2.5.1Tripure method is extracted cell total rna:

(1) after the attached cell digestion of taking the logarithm vegetative period, proceed to 1.5mlEP pipe, 1000rpm, 5min.Clean with PBS one twice, abandon supernatant.

(2) to every 5 × 10 ⁶-1 × 10 ⁷in individual cell, add the Tripure of 1ml.

(3) with liquid-transfering gun repeatedly pressure-vaccum until in lysate without obvious sediment (concussion also can), room temperature leaves standstill 5min.

(4) add the chloroform (CH of 1/5Tripure volume ₃cL ₃) 200 μ l, cover tightly pipe lid, firmly concussion (chloroform boiling point is low, volatile), when concussion, careful pipe lid flicks suddenly, treats fully emulsifiedly, and solution is after milky white shape (without noted phase separation phenomena), then room temperature leaves standstill 5min.

(5) 12000rpm, 4 DEG C of centrifugal 15min.

(6) the careful EP pipe that takes out from whizzer, is now divided into three-phase, that is: colourless supernatant liquor, middle white protein layer and be with coloured lower floor organic phase.Draw supernatant liquor and shift 400 μ l to (must guard against sucking-off middle layer) in another new EP pipe.

(7) in supernatant, add isopyknic Virahol, after the EP that turns upside down pipe fully mixes, leave standstill 15min at 15-30 DEG C.

(8) 12000rpm, 4 DEG C of centrifugal 10min, generally after centrifugal, test tube bottom there will be precipitation.

(9) carefully abandon supernatant, add 75%DEPC ethanol 1ml (being sure not to touch precipitation) along tube wall lentamente, washing tube wall gently turns upside down, 12000rpm, after 4 DEG C of centrifugal 5min, carefully discard ethanol (in order to control better the salt ion content in RNA, should as far as possible eliminate ethanol).

(10) drying at room temperature precipitation 2-5min (cannot centrifugal or heat drying), otherwise RNA will be difficult to dissolve, add appropriate (20-50 μ RNase free water (DEPC water) dissolution precipitation l), can blow and beat gently precipitation with liquid-transfering gun if desired, after RNA dissolves completely in-80 DEG C of preservations.

(11) survey RNA concentration and purity (1:40 dilution): 80 μ l ddH ₂o Blank, 2 μ l RNA+78 μ lddH2O survey.If A260nm/A280nm between 1.6-2.0, illustrates that RNA purity is higher, can be used as reverse transcription template.When reverse transcription, concentration is preferably diluted in 100-200ng/ μ l.

2.5.2 reverse transcription

(1) the mixing of 4x DN Master Mix and gDNA Remover (only in the time of first use):

4x DN Master Mix110μl+gDNA Remover2.2μl

(2) sex change of RNA:

RNA thermally denature under 65 DEG C of conditions, after 5 minutes, is placed in to cooled on ice immediately.

(3) remove genomic dna reaction (DNase reaction):

Be formulated as follows reaction solution on ice.

After reaction solution is stirred lightly, incubation 5 minutes under 37 DEG C of conditions.

Can as required, expand reaction system.

(4) reverse transcription reaction:

Then, be formulated as follows reaction solution on ice.

After reaction solution is stirred lightly, react by following temperature:

After reaction finishes, under 4 DEG C or-20 DEG C of conditions, preserve.When Real-time PCR, directly or after dilution add as template.

2.5.3Real-time PCR：

(1) preparation of the reaction solution of the SYBR Green of Roche (Roche):

Note: when actual preparation, doubly (n is sample number first other components except cDNA to be blended together in advance to n+ α, three parts, a sample (triplicate), α is dispensing loss (I am generally the amount of a pipe)) mixed solution, then be dispensed into each pipe (being n pipe), finally in every pipe, add respectively corresponding sample solution (cDNA).Can reduce like this to operate because of individual the experimental error causing.

(2) cycling condition of PCR:

[1]95℃，30s；

[2] PCR circulation (× 40cycles):

Sex change: 95 DEG C, 5s;

Annealing: 60 DEG C, 10s;

Extend: 72 DEG C, 15s (data collection) collects fluorescence

[3] melt curve analysis analysis (Melting Curve Analysis).

(3) copy CT value.

(4) calculate CT value:

[1] multiple (fold change)=2 changing ^{-Δ Δ CT}(exponential relationship);

[2] Δ Δ CT=(CT target gene one CT internal reference) treatment group-(CT target gene one CT internal reference) untreated fish group

1.2.5.4 experimental data acquired results

Detect OLFM4mRNA in cell through Real-time PCR and express, result demonstration, gene silencing slow virus has obvious restraining effect to OLFM4 genetic expression in MKN-45 cell.Compared with negative control, interference group MKN-45-Si-OLFM4 cell OLFM4mRNA expresses obviously and reduces (P ﹤ 0.01) (Fig. 7).

2.6Western blot detects OLFM4 protein expression

2.6.1 the extraction of monolayer adherence total protein of cell

(1) after the large bottle digestion of attached cell 2 of taking the logarithm vegetative period, proceed to 15ml EP pipe, 1000rpm, 5min.Clean with the PBS (0.01M pH7.2～7.3) of 4 DEG C of precoolings one twice, abandon supernatant.

(2) after PBS being abandoned only, centrifuge tube is inverted on ice, after setting 5min, available suction paper exhausts remaining PBS along the mouth of pipe.

(3) add 10 μ l PMSF (100mM) and 10 μ l inhibitors of phosphatases preparation cell pyrolysis liquid by 1ml RIPA, shake up and be placed on ice.(PMSF will shake up and just can mix with lysate when without crystallization.)

(4) every tube cell adds 600 μ l containing the lysate (need determine according to cell quantity) of PMSF, in cracking 40min on ice, for making the abundant cracking culturing bottle of cell will frequent waggle.Shake once every 8min.

(5) for cracking is abundant, available 1ml skin test injection syringe suction during this time.After cracking fully, cell debris and lysate are moved in 1.5ml centrifuge tube with liquid-transfering gun.(whole operation is carried out on ice as far as possible.)

(6) at 4 DEG C, the centrifugal 5min of 12000 × g.(precooling whizzer in advance)

(7) supernatant after centrifugal is transferred in 1.5ml EP pipe, after surveying concentration, used immediately 5 × loading in boiling water, to boil 5min (in proportion: albumen: 5 × loading=1: 4).After packing in-80 DEG C of preservations.Avoid multigelation.

2.6.2SDS-PAGE electrophoresis

(1) clean sheet glass:

Left hand fastening sheet glass, the right hand dips in an alcohol with gauze and wipes gently examination, then dries use.

(2) encapsulating and loading:

[1] after sheet glass alignment, put into glue folder clamping.Then pinch to be vertically stuck in to join on glue frame toward both sides and prepare encapsulating.

[2] prepare 10% separation gel 5ml in the ratio in 1.1.6 (13), mix immediately encapsulating immediately after adding TEMED.When encapsulating, available 1ml rifle imbitition glue is got gently along glass edges of boards, in the time that glue face is raised to draw-in groove greenbelt mid-line height.Then add one deck dehydrated alcohol along little glass plate, the gelling after fluid-tight faster.

[3] 37 DEG C of baking boxs are placed 30min, in the time having a refracted ray between dehydrated alcohol and glue, illustrate that glue is solidifying.With hand hold shelf remove photoresist upper strata dehydrated alcohol and with worry paper alcohol is blotted.Wiping comb.

[4], in the concentrated glue 2ml of the ratio preparation 5% in 1.1.6 (13), add after mixing immediately after TEMED and get final product encapsulating.After remaining space is filled to concentrated glue, corresponding comb is inserted in concentrated glue gently.In the solid process of concentrated gelling, to mend glue on both sides.37 DEG C of baking boxs are placed 45min, until after concentrated gelling admittedly, take out glass plate water and rinse concentrated glue, sandwich in electrophoresis chamber.

[5] put it in electrophoresis chamber.Filling it up with after electrophoresis liquid two hands pinches respectively toward the both sides of comb and is extracted gently straight up.

[6] add the protein sample containing the liquor capacity of 50 μ g-150 μ g albumen.(loading cumulative volume is generally no more than 15 μ l, well can add to greatest extent 20 μ l samples.)

[7] new albumen for the first time the used time need do preliminary experiment, can loading 10 μ l, only do a kind of albumen of internal reference, regulate best applied sample amount according to internal reference band gray-scale value.(than surveying protein concentration quantitatively accurately)

[8] start loading after adding enough electrophoresis liquid.Electrophoresis liquid will cover the little sheet glass of interior survey.With the adherent absorption protein sample of 10 μ l liquid-transfering gun, rifle head is inserted to and in well, slowly adds sample.After having gone up sample, need to fill inside groove electrophoresis liquid.(get marker3 μ l 1x loading buffer and be diluted to required applied sample amount, carry out application of sample together with protein sample), (1x loading buffer flanging for both sides; And when diluted protein, be also with 1x loading buffer).

(3) electrophoresis:

Voltage is that 80v turns 30min (concentrated glue) → voltage 120v and turns 80min (separation gel).Electrophoresis has just been run out of and can have been stopped electrophoresis to tetrabromophenol sulfonphthalein, carries out transferring film.(now can ice making half basin, during for transferring film.)

2.6.3 transferring film (wet turning)

(1) after electrophoresis finishes, according to cutting to obtain the size of glue, prepare filter paper and pvdf membrane (nitrocellulose filter), while cutting film, must wear gloves, because albumen on hand can polluted membrane, and pvdf membrane is poisonous, can on pvdf membrane, make marks as required.(when cutting film, cut a small gap in its upper right corner according to custom when film concave upright, for distinguishing the protein powder after transferring film.)

(2) pvdf membrane shearing is activated, in anhydrous methanol, put 15-20s, then at ddH ₂in O, put 1min, proceed to electricity and turn in liquid and soak, prepare transferring film.

(3) in the basin that is added with transferring film liquid, put into clip, two blocks of sponge pads, glass rod, the filter paper that transferring film uses and the film of waking up.

(4) cut glue: first sheet glass is prized to just peelable glue, when sled, action wants light, be on two limits sled repeatedly gently.Prize sheet glass a little while and just start to become flexible, until sled removes little glass plate, glue is retained on large glass plate.Cut the glue of suitable size by required kD value.

(5) clip is opened to the fine flour maintenance level that makes.Spread a sponge pad in the above, at mat upper berth thick layer filter paper, membrane cover (is kept to breach in the upper right corner of film) on filter paper with tweezers, and constantly drench transferring film liquid and make between film and filter paper without bubble.

(6) carefully peel with tweezers the glue cutting and turn out and be placed on film, it is alignd with tweezers adjustment with filter paper and film, and constantly drench transferring film liquid and make glue and intermembranous without bubble and roll with glass rod the bubble that degass gently.At thick filter paper of glue upper cover and remove another sponge pad on bubble bonnet, close clip and be soaked in transferring film liquid.(transferring film liquid, containing methyl alcohol, will be worn gloves when operation, will open the door to ventilate in laboratory.)

(7) clip is put into transferring film groove, be made the black flour of black flour to groove of folder, to groove red of the fine flour of folder.

When electrotransfer, meeting heat production, puts an ice chest on one side of groove and lowers the temperature, and transferring film groove will be placed in half basin ice simultaneously.Transferring film condition: constant current 250mA, 1kD turns 1min conventionally.

2.6.4 immune response

(1) sealing: after transferring film finishes, carefully film is moved in the plate that contains 5% confining liquid to (if film is many, available ballpoint pen does a mark with difference on film limit), shake sealing 1h on decolorization swinging table under room temperature with tweezers.

(2) primary antibodie is hatched: primary antibodie is diluted to proper concn (in 1.5ml centrifuge tube) with confining liquid, with rifle, primary antibodie being evenly laid on to envelope has on the culture dish of paraffin (size is about the size of film), film is taken out from confining liquid with tweezers, the protein powder that ensures film (that is: makes the small gap of film in the lower right corner) down and lies in the primary antibodie of completing.And this culture dish is placed in a Thin film glove to sealing.Spend the night in 4 DEG C.

(3) wash film: second day, at room temperature on decolorization swinging table, wash twice with TBST, each 10min; Wash once again 10min with TBS.

(4) two anti-hatching: the ratio on by specification is prepared two anti-diluents (two anti-often can be repeatedly used), and washed film is put in two anti-diluents, hatches 1～2h under room temperature on decolorization swinging table.

(5) wash again film: at room temperature on decolorization swinging table, wash twice with TBST, each 10min; Wash once again 10min with TBS.

(6) chemoluminescence: moistening film is placed on the flat board of glass or plastic, chemical luminescence for liquid 100-200 μ l is evenly dripped on film to exposure immediately! (can reduce chemical luminescence for liquid consumption)

(7) gel images analysis: film is scanned or take pictures, by molecular weight and the clean optical density value of gel images treatment system evaluating objects band.

1.2.6.5 interpretation of result

Detect OLFM4 protein expression situation through Western blot, result demonstration, gene silencing slow virus has obvious restraining effect to OLFM4 protein expression in MKN-45 cell.Compared with negative control, in interference group MKN-45-Si-OLFM4 cell, OLFM4 protein expression obviously reduces (P ﹤ 0.01) (Fig. 8).

3 conclusions

By lentivirus mediated, RNA disturbs, and reticent target gene OLFM4 has successfully set up stable infection stomach cancer cell line MKN-45-NC-GFP and MKN-45-Si-OLFM4.Through Real-time PCR and Western blot qualification, after reticent OLFM4 gene, in stomach cancer cell, the expression of OLFM4mRNA and albumen is all obviously suppressed, successfully sets up the stable stomach cancer cell model of OLFM4 gene silencing.

Foundation and the qualification of embodiment 2 Gastric cancer with liver metastasis animal models

1 material

1.1 cell strains:

MKN-45-NC-GFP MKN-45-Si-OLFM4

1.2 animals: Balb/c (nu/nu) nude mice, 6～8 week age, body weight 18～20g, SPF rank, purchased from Medical University Of Chongqing's animal center

1.3 main agents and consumptive material

Matrigel prestige lattice Lars biotechnology (Beijing) company limited

Transwell cultivates cell U.S. company BD

4% paraformaldehyde Beijing Suo Laibao company

2 methods

2.1Transwell measuring cells in vitro migration and invasion ability

2.1.1Transwell cell method is measured transfer ability

(1) cell is pressed to 2 × 10 ⁵/ hole is laid on 24 orifice plates, in 10%FBS-1640 substratum, cultivates 6-8h for 37 DEG C, treats cell attachment.(morning on the same day)

(2) after 6-8h, remove 10%FBS-1640 substratum, be replaced with 0.5%FBS-1640 substratum, hunger is spent the night.

(3) preparation Transwell chamber24 orifice plate cell (aperture: 8 μ m), add 500 μ l0.5%FBS-1640 substratum in 24 orifice plates.Cell takes out under aseptic condition, puts into 24 orifice plates with aseptic nipper gripping, gets rid of bubble.

(4) cell dissociation counting hunger being spent the night, with the substratum rinsing both sides of serum-free, adjusting cell density is 1 × 10 ⁵/ ml.

(5) get the cell 200 μ l that adjust, fully mix and add chamber on cell, softly mix 37 DEG C of cellar culture 8h, Microscopic observation cell migration state.Every group is repeated 3 samples.

(6) take out cell cell, carry out mark, under wet condition, wipe gently with cotton swab the cell that does not move on cell upper strata, cell is put in methyl alcohol and fixed 10-15min, with twice of the soft rinsing of PBS, 0.1% violet staining 20min, the unnecessary staining fluid of decorporating, dries, film is cut, put on slide glass, 10 ×, imaging under 20 × light microscopic, obtain at random 10 visuals field and calculate average cell number, by mean ± standard deviation, the difference of adding up both.

2.1.2Transwell cell method is measured invasive ability

(1) Matrigel matrigel (10mg/ml, 5ml), is only distributed in 10 EP pipes by 0.5ml/; Used time adds the DMEM of 0.5ml.Before using, be transferred to 4 DEG C from-20 DEG C and treat that it melts naturally, and be placed in and maintain liquid state on ice.

(2) solution preparation: 1%FBS-DMEM substratum (upper chamber), 20%FBS-DMEM substratum (lower chamber).

(3) coated basilar membrane (operation on ice): with the precooling DMEM substratum dilution Matrigel glue of serum-free, by the dilution proportion of 1: 8.Get 100 μ l dilution glue and be added to 24-well transwell in chamber bottom coated transwell cell, 4 DEG C are spent the night air-dry.

(4) aquation basilar membrane: with serum free medium fine laundering gel, hatch at least 2h of transwell for 37 DEG C.

(5) inoculating cell:

[1] trypsin digestion obtains cell from Tissue Culture Flask, and PBS washes the twice rear 1%FBS-DMEM of using re-suspended cell and counts, and adjusting cell density is 1 × 10 ⁵/ ml.

[2] in lower chamber, add 600 μ l cell culture mediums, contain 5 μ g/ml fibronectin as being adhered subtribe.

[3] upper chamber adds 200 μ l cell suspensions, and every group is repeated 3 samples.

Hatch 48h for [4] 37 DEG C.

(6) dyeing and counting:

[1] cotton swab is wiped the non-invasion and attack cell above chamber.

[2] remove transwell, be inverted, air-dry.

In [3] 24 orifice plates, add 500 μ l0.1% Crystal Violet Dyes, cell is placed in one, film is immersed in substratum, 37 DEG C are taken out after hatching 30min, and PBS cleans, and dries, and when photograph, cell is just being placed on slide glass.

[4] on diameter, get 10 visuals field, take a picture, counting.

2.1.3 experimental result

Porous biomembrane Transwell culture systems is a usual in recent years experimental technique for the behavior of study tumor cell migration and invasion.This Transwell experimental result shows, compares with negative control group, disturbs obviously suppressed (P ﹤ 0.01) (Fig. 9 and Figure 10) of migration and invasion ability of gene silencing group MKN-45-Si-OLFM4 cell.

Animal metastasis model in 2.2 bodies

2.2.1 nude mice grouping

All nude mices need be carried reclaiming and raise to conform the last week.40 nude mices, are divided into 4 groups at random, and 10 every group, totally 8 cages, 5, every cage.

2.2.2 nude mice injection

(1) the total cellular score difference under different injection systems.

(2) monoclonal cell that enlarged culturing sub-elects, the cell of collection logarithmic phase, PBS washing 2 times, add 0.25% pancreatin in 37 DEG C of digestion 5min, add DMEM containing foetal calf serum to stop trysinization, centrifugal, abandoning supernatant, add PBS wash again, centrifugal 2 times.Preparation does not contain PBS cell suspension the cell counting of serum.

(3) carry out respectively nude mice injection by upper table design, and carry out mark.All nude mices are all raised in gnotobasis, nude mice ad lib drinking-water, and raising condition is identical.

(4) abdominal injection group is raised 4 weeks, and tail vein injection group is raised 6 weeks.

2.2.3 nude mice is dissected

(1) abdominal injection 4 weeks, tail vein injection, after 6 weeks, adopt the method for neck dislocation to put to death nude mice.

(2) cut nude mice abdominal cavity open, take pictures and leave and take the form in whole abdominal cavity, win respectively mesentery and liver, wash blood with PBS.Retract carefully mesentery, take pictures, and the tumor nodule of counting >=1mm; Carefully liver is spread out, taken pictures, and count the tubercle of liver surface.

(3) the mesenteric tumor tubercle under the different injection systems of the each cell strain of picking, a part adds appropriate 4% paraformaldehyde fixes, and a part is freezing in-80 DEG C immediately.

(4) the transfer liver under the different injection systems of the each cell strain of picking, it is solid that a part adds appropriate 4% paraformaldehyde

Fixed, a part is freezing in-80 DEG C immediately.

2.2.4 interpretation of result

Abdominal injection group is raised 4 weeks, and tail vein injection group is raised 6 weeks, adopts the method for neck dislocation to put to death nude mice to nude mice, dissects the each internal organs in abdominal cavity and observes transfer case.Through abdominal injection group, mesentery having occurred and shifted and hepatic metastasis, there is hepatic metastasis in tail vein injection.Result shows, the liver surface of interference group and mesenteric tumor tubercle quantity are obviously less than negative control group; Compared with negative control group, obviously suppressed (P ﹤ 0.01) (Figure 11) to liver and mesenteric mesaraic metastatic capacity for MKN-45-Si-OLFM4 cell.

The HE dyeing of 2.3 tumor tissues

2.3.1HE dyeing

(1) dehydration: 70%, 80%, 90% ethanolic solns at different levels each 40min that dewaters, puts into 95%, 100% ethanol each twice, each 20min.

(2) transparent: dimethylbenzene 1 liquid: 20min, dimethylbenzene 2 liquid: 20min (will note tissues observed, transparent after).

(3) waxdip: paraffin cylinder waxdip 6h.

(4) embedding.

(5) section: the tumor tissues of embedding is carried out on slicing machine to continuous 5 μ m sections.

(6) dewaxing: section preparation (is the words that are placed on 4 DEG C of preservations if cut into slices in the roasting 30min of 60 DEG C of baking boxs, want first rewarming), section is taken out and is placed on dimethylbenzene 1 liquid 10min, dimethylbenzene 2 liquid 10min, then be placed in successively following liquid: 100% ethanol 3min, 95% ethanol 2min, 80% ethanol 3min, 75% ethanol 3min, flowing water rinses 5min.

(7) dye core: Hematorylin dye liquor 5min, flowing water rinses 5min, hydrochloride alcohol aquation 3s, flowing water rinses 2min, the anti-blue 5s of unsaturated carbonate lithium solution, flowing water rinses 5min.

(8) matter is dyed: eosin stain 1min, and flowing water rinses 5min, is then placed in 80% ethanol 3min, 95% ethanol 2min, 100% ethanol 3min, dry rear mounting is preserved.

2.3.2HE coloration result

Get the single tumor nodule of nude mice mesentery and a little hepatic tissue of hepatic metastasis tumor nodule band and confirm mesentery and liver neoplasm metastasis for HE dyeing.Compared with negative control group, MKN-45-Si-OLFM4 cell is to liver and obviously suppressed (Figure 12) of mesenteric mesaraic metastatic capacity.

3 conclusions

The cell that Transwell tests under random 10 200 × visuals field is analyzed by t inspection statistics, has confirmed that OLFM4 gene silencing cell suppresses external migration and invasion; By all nude mice mesenteric tumor tubercles and liver surface tumor nodule counting, and analyze by t inspection statistics, confirmed that OLFM4 gene silencing suppresses nude mice abdominal cavity and shifts and hepatic metastasis.Tumor tissues HE karyomit(e) has also shown that OLFM4 gene silencing suppresses nude mice abdominal cavity and shifts and hepatic metastasis.The interior experiment of body is consistent with experiment in vitro, all shows that OLFM4 gene silencing can suppress cancer of the stomach and shift to liver and abdominal cavity.

The preliminary study of embodiment 3OLFM4 to stomach cancer cell mechanism of action

1 material

1.1 cell strain

MKN-45-NC-GFP

MKN-45-Si-OLFM4

1.2 probe design

Sequence for the synthesis of NF-κ B probe is: 5 '-AGTTGAGGGGACTTTCCCAGGC-3 '.

1.3 main agents and consumptive material

Endochylema karyon protein extraction test kit	Pierce company of the U.S.
		NF-κ B p65 mouse-anti human monoclonal primary antibodie	Santa Cruz company
The anti-human polyclone primary antibodie of NF-κ B p-p65 (Ser536) rabbit	Santa Cruz company
		The anti-human polyclone primary antibodie of NF-κ B p50 rabbit/goat	Santa Cruz company
The anti-human polyclone primary antibodie of I κ B-α rabbit	Santa Cruz company
		P-I κ B-α mouse-anti human monoclonal primary antibodie	Santa Cruz company
The anti-human polyclone primary antibodie of GC-1 rabbit	Santa Cruz company
		The anti-human mono-clonal primary antibodie of SP1 rabbit	Cell Singnaling company
Horseradish peroxidase-labeled mountain sheep anti mouse two is anti-	Beijing company of Zhong Shan Golden Bridge
		Horseradish peroxidase-labeled goat antirabbit two is anti-	Beijing company of Zhong Shan Golden Bridge
EMSA chemistry kit for detecting nucleic acid	Thermo company of the U.S.

1.4 main agents preparations

(1) 5 × tbe buffer liquid: take Tris54g, Na ₂eDTA2H ₂o3.72g, boric acid 27.5g are dissolved in 800ml ddH ₂o, fully stirring and dissolving, uses ddH ₂o is settled to 1L, room temperature preservation.Used time is diluted to 0.5 × TBE.

(2) 5% non-denaturing polyacrylamide gel:

ddH ₂O	6.2ml
		5×TBE	1.0ml
30％Acr-Bis	1.7ml
		50% glycerine	1.0ml
10％AP	0.1ml
		TEMED	0.005ml

2 methods

2.1Western blot detects the expression of NF-κ B pathway associated protein

2.1.1 total protein of cell extracts

Method is the same

2.1.2 cell cytosol karyon protein extraction

(1) from refrigerator, test kit is placed in to room temperature and melts, after melting, be placed in immediately on ice.

(2) Tissue Culture Flask is placed on ice after washing twice with precooling PBS, scrape cell (preferably without trysinization with cell curet, because possible protein degradation), and with a 1ml liquid-transfering gun piping and druming bottle wall, cell is all scraped to collect 1ml EP pipe, and perform mark.The centrifugal 6min of 500 × g at 4 DEG C.Blot the remaining PBS in EP pipe with negative pressure of vacuum suction pump as far as possible.Estimate cell volume.

(3) every 20 μ l cell precipitations add cold CERI200 μ l, and add PMSF2 μ l, hatch 10min fast after vortex 15s on ice.

(4) directly add cold CERII11 μ l, after vortex 5s, hatch 1min on ice fast.

(5) fast after vortex 5s, the centrifugal 10min of 16000 × g at 4 DEG C.

(6) draw immediately in the EP pipe of supernatant to precooling, this supernatant is cell cytosol albumen.And in albumen: 5 × loading=1: 4 ratio is boiled 5min after adding 5 × loading in boiling water.After packing mark in-80 DEG C of preservations.

(7) draw after supernatant and add immediately 1mlPBS to blow and beat into after suspension, the centrifugal 5min of 16000 × g at 4 DEG C.And blot the remaining PBS in EP pipe with negative pressure of vacuum suction pump as far as possible.(this step is rule of thumb to add, in order to reduce the pollution of plasmosin to karyon albumen.)

(8) add cold NER100 μ l, piping and druming fast vortex 15s, in cracking 40min on ice.Every the quick vortex 15s of 10min.

The centrifugal 10min of 16000 × g at (9) 4 DEG C.

(10) EP that draws immediately supernatant to precooling manages, and this supernatant is cell karyon albumen.In albumen: 5 × loading=1: 4 ratio is boiled 5min after adding 5 × loading in boiling water.After packing mark in-80 DEG C of preservations.

2.1.3Western blot detects the expression step of NF-κ B pathway associated protein

Method is the same

2.1.4Western blot detects the expression of results of NF-κ B pathway associated protein

2.1.4.1Western blot detects the expression of NF-κ B pathway associated protein in total protein

From MKN-45 group cell, extract total protein, detect the expression of NF-κ B associated protein NF-κ Bp65, NF-κ B p-p65 (Ser536), NF-κ B p50, I κ B-α and p-I κ B-α through Western blot, result shows, compared with negative control, in interference group MKN-45-Si-OLFM4, the expression of NF-κ B p65 and NF-κ Bp-p65 and I κ B-α and p-I κ B-α is obviously lowered, and the expression of NF-κ B p50 does not change.

That in this description of test MKN-45 total protein, NF-κ B heterodimer works is NF-κ B p65, instead of NF-κ B p50; Strike expression (P ﹤ 0.01) that low OLFM4 gene obviously suppresses NF-κ B associated protein in MKN-45 cell (Figure 13).

2.1.4.2Western blot detects the expression of NF-κ B pathway associated protein in endochylema karyon albumen

From MKN-45 group cell, extract endochylema karyon albumen with endochylema karyon protein extraction test kit, detecting NF-κ B signal transduction pathway through West-Ern blot expresses, result shows, compared with negative control group MKN-45-NC-GFP, in interference group MKN-45-Si-OLFM4, the expression of OLFM4, NF-κ B p65, NF-κ B p-p65 and I κ B-α, p-I κ B-α is obviously lowered, and the expression of NF-κ B p50 does not change.This experiment confirmation, in interference group MKN-45-Si-OLFM4 cell cytosol albumen, OLFM4 protein expression is obviously lowered (P ﹤ 0.01); In MKN-45 endochylema karyon protein, that NF-κ B heterodimer works is NF-κ B p65, be not NF-κ B p50, in the endochylema karyon albumen of MKN-45-Si-OLFM4 cell, obviously suppressed (P ﹤ 0.01) (Figure 14) in the expression of NF-kB protein.

2.2EMSA method is measured NF-κ B DNA binding activity

2.2.1EMSA experimental procedure

(1) encapsulating: encapsulating immediately after preparation 5% non-denaturing polyacrylamide gel, room temperature gel 1h.

(2) prerunning: adopt 0.5 × tbe buffer liquid, 100V constant pressure cryogenic (on ice) prerunning 1h.

(3) preparation reaction system: prepare EMSA reaction system, incubated at room 25min by table 1 in EP pipe.

Table 1

(4) point sample: add 5 μ l5 × sample-loading buffers in each EP pipe, mix gently.By the order loading 20 μ l successively of upper table.

(5) electrophoresis: (on ice) electrophoresis under constant voltage 150V low temperature, until bromophenol blue indicator stops electrophoresis while going to the below 2/3-3/4 of glue.

(6) transferring film: adopt half-dried electroporation to carry out transferring film.The nylon membrane of positively charged and brand-new Whatman Filter Paper are together soaked in to balance 10min in 0.5 × TBE transferring film liquid, carefully take off gel, in the anodal overlapping placement of order of pressing filter paper-positively charged nylon membrane-gel-filter paper of transfer groove, each limit of aliging, roll each to the greatest extent interlayer bubble, constant voltage 15V transfer printing 30min.

(7) crosslinked: transferring film finishes, take out nylon membrane, suck unnecessary transferring film liquid (avoiding film to be blotted completely) with filter paper, film front (with glue contact surface) is upwards placed in to 10cm place, super clean bench ultraviolet lamp below and carries out UV-crosslinked 15min.

(8) sealing: film is soaked in confining liquid at room temperature the 15min that vibrates on decolorization swinging table.

(9) wash film: lucifuge, film is placed in to 20ml Blocking buffer, under room temperature, on decolorization swinging table, wash film 15min; Newly get 20ml Blocking buffer and add 66.7 μ l HRP, will wash primary film and be placed in one, under room temperature, on decolorization swinging table, wash film 15min; 1 × wash buffer drip washing film one time; Then wash film 4 times, each 5min; Under room temperature, on decolorization swinging table, wash film once, 5min with 30ml Substrate Equilibration Buffer; Film is put in and on qualitative filter paper, blots unnecessary buffer.

(10) lucifuge preparation Luminol/Ehancer Solution and Stable Peroxide Solution mixed solution, be poured into mixed solution on film, and lucifuge is hatched 10min.

(11) develop: take out nylon membrane, blot gently unnecessary liquid, at Chemilnager ^tm550 type gel image analyser imagings, measure drag zone optical density value.

2.2.2EMSA method is measured NF-κ B DNA binding activity result

From MKN-45 group cell, extract karyon albumen with endochylema karyon protein extraction test kit, by EMSA measuring transcription factor NF-KB DNA binding activity.Result confirms, obviously suppressed (P ﹤ 0.01) (Figure 15) for the karyon albumen of interference group MKN-45-Si-OLFM4 cell and NF-κ B DNA binding activity.

Tumor metastasis related gene after 2.3 people's metastases Real-time pcr chips detection OLFM4 gene silencings

2.3.1Tripure method is extracted cell total rna: method is the same

2.3.2 after people's metastases Real-time pcr chip detects OLFM4 gene silencing, tumor metastasis related gene changes: stomach cancer cell MKN-45-NC-GFP and MKN-45-Si-OLFM4, in trust, Haikang becomes Bioisystech Co., Ltd to be RT ²profiler ^tMpCR Array Human Tumor Metastasis (PAHS-028Z) detects.

2.3.3 people's metastases Real-time pcr chip detected result

The variation of MKN-45-NC-GFP and MKN-45-Si-OLFM4 two strain stomach cancer cells tumor metastasis related gene after people's metastases Real-timePCR chip detection OLFM4 gene silencing.Detected result shows, compared with MKN-45-NC-GFP group, obvious change (table 2 and Figure 16) has occurred in the expression of striking after low OLFM4 the tumor-related genes such as CCL7, CDH1, MGAT5, KISS1, MTSS1, MMP7 and PTEN in MKN-45 cell.

Table 2 OLFM4 compared with negative control group (NC-GFP group) strikes the express spectra that subtracts rear tumor metastasis related gene

3 conclusions

This research shows, in stomach cancer cell MKN-45 cell, OLFM4 gene silencing can reduce NF-κ B DNA binding activity and suppress NF-κ B correlative protein expression, illustrate that OLFM4 can feedback regulation NF-κ B signal transduction pathway, and then regulates and controls Gastric cancer with liver metastasis process.Detect that by Human Tumor Metastasis PCR Array tumor metastasis related gene CCL7, MTSS1, MMP7, CDH1, KISS1, MGAT5 and PTEN etc. have also participated in the regulation process of the low expression inhibiting Gastric cancer with liver metastasis of MKN-45.

SEQUENCE LISTING

Attached children's hospital of <110> Chongqing Medical university

RNA interfering, slow virus and the application thereof of <120> target OLFM4 gene

<160>

<210> 1

<211> 23

<212>

<213> Artificial (artificial sequence)

<400> 1

ccggaacgct tggaattcac agctcctcga ggagctgtga attccaagcg tttttttg 58

<210> 2

<211> 25

<212>

<213> Artificial (artificial sequence)

<400> 2

aattcaaaaa aacgcttgga attcacagct cctcgaggag ctgtgaattc caagcgtt 58

Claims

1. a RNA interfering for target OLFM4 gene, its nucleotide sequence is as follows:

Positive-sense strand: 5 '

-CCGGAACGCTTGGAATTCACAGCTCCTCGAGGAGCTGTGAATTCCAAGCGTTTTTT TG-3 ', i.e. SEQ ID NO.1;

Antisense strand: 5 '

-AATTCAAAAAAACGCTTGGAATTCACAGCTCCTCGAGGAGCTGTGAATTCCAAGCG TT-3 ', i.e. SEQ ID NO.2.

2. the Lentivirus slow virus that comprises the RNA interfering of target OLFM4 gene claimed in claim 1, the structure of described lentiviral vectors as shown in Figure 1.

3. Lentivirus slow virus as claimed in claim 2, preparation method comprises the following steps:

(1) external synthetic above-mentioned DNA sequence dna;

(4) Lentivirus virus packaging:

1. front 24 h of transfection, with the 293T cell of tryptic digestion logarithmic phase, adjust cell density as 1.2 × 10 taking the substratum containing 10% serum ⁷cell/20 ml, is re-seeded into 15cm Tissue Culture Dish, 37 DEG C, 5% CO ₂in incubator, cultivate, after 24 h, treat that cell density reaches 70%～80% for transfection;

2. cell culture medium is replaced by serum free medium by front 2 h of transfection;

3. in a sterilizing centrifuge tube, add prepared each DNA solution (pGC-LV carrier 20 μ g, pHelper 1.0 carrier 15 μ g, pHelper 2.0 carrier 10 μ g), mix with the Opti-MEM substratum of respective volume, adjusting cumulative volume is 2.5 ml, at room temperature incubation 5 minutes;

4. Lipofectamine2000 reagent is softly shaken up, draw 100 μ l Lipofectamine 2000 reagent and mix at another Guan Zhongyu 2.4ml Opti-MEM, at room temperature incubation 5 minutes;

5. the DNA after dilution is mixed with the Lipofectamine 2000 after dilution, put upside down and mix lightly, within 5 minutes, mix;

6., after mixing, at room temperature incubation 20 minutes, to form the transfection composite of DNA and Lipofectamine 2000 diluents;

7. DNA and Lipofectamine2000 mixed solution are transferred in the nutrient solution of 293T cell, mix, in 37 DEG C, 5%CO ₂in cell culture incubator, cultivate;

8. cultivate and remove the substratum that contains transfection miscellany after 8 h, every bottle of cell adds the PBS liquid of 20 ml, gently double swerve once culturing bottle to wash remaining transfection miscellany, then go;

9. in every bottle of cell, add cell culture medium 25 ml containing 10% serum, in 37 DEG C, 5%CO ₂in incubator, continue to cultivate 48 hours;

(5) results of virus and concentrated

1. collect after transfection the 293T cell conditioned medium liquid of 48 hours;

2. 4 DEG C, the centrifugal 10min of 4000g, removes cell debris;

3. with 0.45 μ m filter filtering supernatant in 40 ml ultracentrifugation pipes;

4. viral crude extract sample is joined to (maximum 19 ml) in filtering cup, cover lid; Filtering cup is inserted in filtered solution collection tube;

5. after combining, carry out balance, be placed in rotary head;

6. at the centrifugal 10-15 minute of 4000 × g, to the concentrated volume of the virus needing;

7. after centrifugal end, Jue goes out centrifugal device, and filtering cup and filtered solution collection cups are below separated;

8. filtering cup is tipped upside down on sample collection cup;

9. centrifugal force is no more than 1000g, and the time is 2 minutes; Filtering cup is removed from sample collection cup; In sample collection cup, be viral concentrated solution;

10. viral concentrated solution is shifted out, after packing, be kept in viral pipe, preserve for-80 DEG C long-term; Get wherein one and carry out viral biology titer determination;

(6) Lentivirus titer determination

1. measure the day before yesterday, 293T cell spreads 96 orifice plates, adherent growth, and each hole adds 4 × 10 ⁴individual cell, volume is 100 μ L;

2. according to viral expection titre, prepare 7 ~ 10 aseptic Ep pipes, every pipe adds the serum free medium of 90 μ l;

3. get virus stock solution used to be determined 10 μ l and join in first pipe, after mixing, get 10 μ l and join in second pipe, continue a to the last pipe of identical operation;

4. choose required cell hole, suck 90 μ l substratum, abandon; The viral solution that adds 90 μ l to dilute; Putting into incubator cultivates;

5. after 24 hours, add perfect medium 100 μ l;

6. after 4 days, observe luciferase expression feelings Saeka and observe luciferase expression situation; Fluorocyte number reduces with the increase of extension rate;

7. titre is calculated: according to GFP expression in fluorescence picture.

Interferential RNA as claimed in claim 1 or slow virus as claimed in claim 2 for the preparation of prevention, diagnosis, treatment cancer of the stomach tumour to abdominal cavity or/and the purposes in the medicine of hepatic metastases.

5. interferential RNA as claimed in claim 1 or slow virus as claimed in claim 2 purposes in the medicine for the preparation of the conduction of inhibition NF-KB signal pathway.