CN103981177A - Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof - Google Patents
Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof Download PDFInfo
- Publication number
- CN103981177A CN103981177A CN201410165808.5A CN201410165808A CN103981177A CN 103981177 A CN103981177 A CN 103981177A CN 201410165808 A CN201410165808 A CN 201410165808A CN 103981177 A CN103981177 A CN 103981177A
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- cabbage
- restorer
- mark
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 23
- 240000007124 Brassica oleracea Species 0.000 title claims abstract description 20
- 235000003899 Brassica oleracea var acephala Nutrition 0.000 title claims abstract description 20
- 235000011301 Brassica oleracea var capitata Nutrition 0.000 title claims abstract description 20
- 235000001169 Brassica oleracea var oleracea Nutrition 0.000 title claims abstract description 20
- 210000000805 cytoplasm Anatomy 0.000 title claims abstract description 17
- 239000003147 molecular marker Substances 0.000 title abstract description 7
- 238000000034 method Methods 0.000 claims abstract description 13
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 claims description 26
- 235000000536 Brassica rapa subsp pekinensis Nutrition 0.000 claims description 26
- 241000499436 Brassica rapa subsp. pekinensis Species 0.000 claims description 26
- 239000000463 material Substances 0.000 claims description 25
- 101000708283 Oryza sativa subsp. indica Protein Rf1, mitochondrial Proteins 0.000 claims description 17
- 239000003550 marker Substances 0.000 claims description 15
- 102220427212 c.125C>G Human genes 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 230000003321 amplification Effects 0.000 claims description 7
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 7
- 238000001962 electrophoresis Methods 0.000 claims description 6
- 238000006243 chemical reaction Methods 0.000 claims description 5
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 claims description 4
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 3
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 3
- 229920002684 Sepharose Polymers 0.000 claims description 3
- 239000000872 buffer Substances 0.000 claims description 3
- 230000004087 circulation Effects 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000004043 dyeing Methods 0.000 claims description 3
- 238000003384 imaging method Methods 0.000 claims description 3
- 239000012160 loading buffer Substances 0.000 claims description 3
- 238000005498 polishing Methods 0.000 claims description 3
- 230000035558 fertility Effects 0.000 abstract description 14
- 231100000241 scar Toxicity 0.000 abstract description 8
- 238000009395 breeding Methods 0.000 abstract description 5
- 230000001488 breeding effect Effects 0.000 abstract description 5
- 230000002068 genetic effect Effects 0.000 abstract description 3
- 206010021929 Infertility male Diseases 0.000 abstract description 2
- 208000007466 Male Infertility Diseases 0.000 abstract description 2
- 238000010367 cloning Methods 0.000 abstract description 2
- 230000009456 molecular mechanism Effects 0.000 abstract description 2
- 210000000349 chromosome Anatomy 0.000 abstract 1
- 241000196324 Embryophyta Species 0.000 description 10
- 235000013311 vegetables Nutrition 0.000 description 5
- 238000011160 research Methods 0.000 description 3
- 108700003861 Dominant Genes Proteins 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 230000001086 cytosolic effect Effects 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 230000009466 transformation Effects 0.000 description 2
- 101100374343 Acidianus filamentous virus 1 (isolate United States/Yellowstone) ORF224 gene Proteins 0.000 description 1
- 244000060924 Brassica campestris Species 0.000 description 1
- 235000005637 Brassica campestris Nutrition 0.000 description 1
- 241000219193 Brassicaceae Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 240000007594 Oryza sativa Species 0.000 description 1
- 235000007164 Oryza sativa Nutrition 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000012252 genetic analysis Methods 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 208000028284 monogenic inheritance Diseases 0.000 description 1
- 230000010152 pollination Effects 0.000 description 1
- 235000009566 rice Nutrition 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000009331 sowing Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for cabbage cytoplasm male sterile line restore gene and an application thereof, the molecular marker tightly linked with the cabbage cytoplasm male sterile line gene is the InDe178 maker and restorer sequence SCAR 42 maker positioned at two sides of cabbage CMS 7311 fertility restore gene and tightly linked with the cabbage CMS 7311 fertility restore gene, the genetic distance between the molecular marker InDe178/SCAR 42 and the fertility restore gene are 0.91cM and 0.92cM respectively, and the fertility restore gene is limited in a range of 337kb of cabbage A09 chromosome. Two molecular markers can be used for molecular marker auxiliary selection of cabbage CMS 7311 fertility restore gene, selection efficiency is increased, breeding process is accelerated; and the molecular markers establish a base for map-based cloning of fertility restore gene, reveal of cytoplasm male sterility and molecular mechanism of fertility restore gene.
Description
Technical field
The invention belongs to agriculture plant molecular marker assistant breeding field, relate to a kind of cabbage cytoplasm male sterile and can educate the closely linked molecule marker of gene and application.
Background technology
Chinese cabbage (Brassica campestris L.ssp.pekinensis (Lour.) Olsson) is that Cruciferae rape belongs to one of most important vegetable crop in Chinese cabbage kind, originates in China, is China and even worldwide bulk vegetable.As far back as the nineties in last century, vegetable or flower institute of Shaanxi Province Academy of Agricultural Sciences is just bred as CMS7311 (Zhang Lugang by species hybridization and the technology that backcrosses transformation to Chinese cabbage in cabbage type rape C MS, Hao Dongfang, the research that Chinese cabbage temperature sensitive cytoplasmic male sterile line CMS7311 fertility transforms, Botany Gazette, 2001,43 (11): 1123-1128), further research confirms that this CMS also contains abnormal open reading frame ORF224, and with part temperature-sensing property; And in Chinese cabbage, find the restorer that can recover CMS fertility, determine that recovering gene is monogenic inheritance.Because traditional fertility Phenotypic Selection will be bloomed by the time, by field, directly observed.For carrying the excellent material that recovers gene, be sterile line by its transformation, must be through hybridization, selfing judges the processes such as its genotype simultaneously with sterile line test cross, and operating wastes time and energy, and the cycle is long, and breeding process is slow.In order to accelerate Chinese cabbage cytoplasm male sterile breeding speed, adopt modern biotechnology, carry out molecular mark very urgent.
Summary of the invention
The object of the invention is to, provide a kind of cabbage cytoplasm male sterile can educate the closely linked molecule marker of gene, wherein:
(1) provide each 1 of the InDel mark of Chinese cabbage CMS7311 fertility restorer gene and SCAR mark;
(2) provide the PCR primer sequence of InDel mark and SCAR mark;
(3) provide cabbage cytoplasm male sterile and fertility restorer gene thereof are carried out to the method for in assisted Selection process, above-mentioned mark being applied.
In order to realize above-mentioned task, the present invention takes following technical solution:
A kind of and cabbage cytoplasm male sterile can be educated the closely linked molecule marker of gene, it is characterized in that, described can educate the closely linked molecule marker of gene with cabbage cytoplasm male sterile and be and be positioned at Chinese cabbage CMS7311 fertility restorer gene both sides InDel78 mark closely linked with it and restorer sequence SCAR42 mark, wherein, InDel78 mark is comprised of restorer sequence InDel78F and sterile line sequence InDel78S;
Described restorer sequence InDel78F size is 1146bp, and concrete sequence is as follows:
5-
ATCATATCCTGTCTATTTCGTGCTTCTCCTAAAAGAGTGATCTTAAGACCCAATCATCATGAGAATGTTTCTAGCTCTCTTCCTTCTCTTGGCCTTGACCACATCTTCAAGTAAGTACCTTTCTTCTCTTCTTGGTATACGGTCCAATAACAGTATTTAAGATTTTATTTCTATGTCTTTCTTTCTCTCTAGATGCAACTTACTGCCTCTGCAAAGATGGGACAGAAGACAACGCACTTCAAGCATCAATAGACTATGTTTGTGGAAAATTAGATTGCAACCCAATCCTTGACAAGGGTGCTTGTTATCAACCAAACACCATCAAAAGCCACTGTGATTGGGCTGTTAACAGCTACTTCCAGAATGTAGCTCAAGCCCCTGGAAGCTGCGACTTCTCTGGAACTGCCACTACCAGTCAAAACCCACCTSCATGTAAGTAAAAAAGTTTACATTTTGATGCGAAAAGTTGTGGTCTTGATGAGGTTCTTTTGTGCAGATTTGGTTACCGGATGTGTCTATCCTTCAAGCGCTAGGTAACTAATGATCACTAACACAAACCTAAGCCTAACTCATTTACATGGATATGACTTATAAAAAGTTTGGTGTGTGTATTAACAGCTCTCCAGGGTCGCTTCCTTCAACTACACCACCACCGGGAACAAAGCAGACAAACGGAACCGTTACTCCAACCAACGGTGCTTCTGTTTATCAACACTAGCGCTTCTGATGTAACGTTCGTATGGAGACAAAGACATCCACATCGGTCCGTCTTTGGTTCCCTTTTGGGTAGAAAAGGAAGCTTCAGTCGTCATTGTGGTTTATATTTCTGTTGTTGCATTTATGTGAAAGTTGCTCTAATTAGAATCTTGAGTAAATAAATAAAATAAAAACAGAGCATTATGATAAAGACTTGTCAATAAAAAGATACCATATTTTTATAATTTCTAATGATCAATCATATAGACTAAAGCAAAATTTATTCACCATTTTAGTAGCTTCAACATCCAATTTAGATTATTGTTCTACAACTTCAACAACGCAACTGCCACCAGCATCATTTTGTAGTAATCTAATCTACCAGATGTTATTCAGTTAAAAAAAATATACTGTGGCAAAGAAAGA
GAAA CCTATGTGCCTCGTTATAAC-3；
Described sterile line sequence InDel78S size is 881bp, and concrete sequence is as follows:
5-
ATCATATCCTGTCTATTTCGTGCTTCTCCTAAAAGAGTGATCTTAAGACCCAATCATCATGAGAATGTTTCTAGCTCTCTTGCTTCTCTTGGCCTTGACCACATCTTCAAGTAAGTCTTTCTTCTCTTCTTCCTAAAGTCTACATTTTGATGAAAAAAGTTGCGGTCTTGATGAGGTCTTTTGTGCAGRTTTGGTTACCGGATGTGTCTATCCTTCAAGCGCTAGGTAACTAATGATCACTAACACAAACCTAAGCCTAACTCATTTACATGGATATGACTTATAAAAAGTTTGGTGTGTGTATTAACAGCTCTCCAGGGTCGCTTCCTTCAACTACACCATCACCGGGAACAAACAAGACAAACGGTGCTTCCAGTTTGGTCATTTCCCCTGCTTTCGCAATCTGTTTATCAACACTAGCGCTTCTGATGTAACGTTCGTGTGGAGACAAAGACATCCACATGGGTCCGTCTTTGGTTCCCTTTTGGGTGGAAAAGGAAGCTTCAGTGGTCATTGTGGTTTATATTTCTGTTGTTGCATTTATGTGAAAGTTGCTCTAATTAGAATCTTGAGTAAATAAATAAAATCAAAACAGAGCATTATGATAAAGACTTGTCAATAAAAAGATACCATATTATTATAATTTCTAATGATCAATCATATAGACTAAAAATTTATTCACCATTTTAGTAGCTTCAACATCCAATTTAGATTATTGTTCTACAACTTCAACAACGCAAGTGCCACCAGACATCATTTTGTAGTAATCTACCAGTTGTTATTCAGTTAAAACTAAGGTTTCTCTCTTTAGGTGTTAGTTATTCAGTTAAAAGAATATACTATGTGGCAAAGAAAGA
GAAACCTATGTGCCCGTTATAACA-3
Described restorer sequence SCAR42 mark size is length 458bp, and concrete sequence is as follows:
5-
GGACCAACTATACTTATCCTGTTACTAATCCTGTTGCCGAGCCTAGATTCTCTTTCTCCTCAAAGAAATCTATGAAGGCCGTTCGTTCTCCTATACCGTCACCTCTGAAGATGAACACACAGCCTCTCTTATGGTATTCCTCTCACGAAACAGCGACTAACGGCTCCTCTTCTCCTTCTTGCTCCTTGACAAAAACGGCAAGCATTTCCTCTTCCGCTGATGAAAACTACACGGAGTTTTTCCCGCAAGAACATTCTGATTCTGGTCTCTTGCAAGATATCGTTCAAGAGTTCTTGAAGAAGAAACGCAACCAGCCTCCGCCACTGATACCACCACCACCACCACCGCCATCTCCACCGATGGTTGGACATCTTGAAAACTTCCGTGAATTCTCCGCCAACAGTTTGTTTCAACCGATGGTGGAGACATCAAAATT
AGATTGCTACGGAAACATTAGT-3。
The sequence of the PCR specificity amplification primer of described restorer sequence InDel78F, sterile line sequence InDel78S and restorer sequence SCAR42 mark is as follows:
ID78F:5-ATCATATCCTGTCTATTTCGTGCT-3；
ID78R:5-GTTATAACGAGGCACATAGGTTTC-3；
SC42F1:5-GGACCAACTATACTTATCCTGTTACT-3；
P42R:5-ACTAATGTTTCCGTAGCAATCT-3。
Above-mentioned cabbage cytoplasm male sterile can be educated the application of the closely linked molecule marker of gene in assisted Selection, and concrete grammar is:
A, by CTAB method, extract detected materials genomic dna, specifically with reference to the method for (2006) such as Wang Qi;
B, pcr amplification: wherein reaction system is 25ul system, and the content of each component materials is respectively: 20ng template DNA; 2.5ul10 * buffer; 1.8mM MgCl
2; 0.25mmol/L dNTP; 1pmol/L primer: 1.5U Taq archaeal dna polymerase; ddH
2o polishing, to 25ul, mixes, centrifugal; Amplification program: 94 ℃/5min of denaturation, then 94 ℃/60s, 56 ℃/45s, 72 ℃/1min, after 35 circulations, 72 ℃ are extended 5min;
C, electrophoresis: the 6 * loading buffer that gets 6ul pcr amplification product and 2ul mixes, click and enter in 0.8% sepharose, and electrophoresis 25min under 150V voltage observes and takes pictures after EB dyeing in gel imaging instrument;
D, judgement:
Using primer I D78F/ID78R to amplify the object band of 1146bp, this material is 99.09% with the probability of Chinese cabbage CMS fertility restorer gene;
Using primer SC42F1/R to amplify the object band of 458bp, this material is more than 99.08% with the probability of Chinese cabbage CMS fertility restorer gene;
If two pairs of primers amplify respectively object band simultaneously, to have the probability of Chinese cabbage CMS fertility restorer gene be 100% to detected materials.
Of the present invention and cabbage cytoplasm male sterile can be educated the closely linked molecule marker of gene, wherein the genetic distance of molecule marker InDel78 and SCAR42 and fertility restorer gene is respectively 0.91cM and 0.92cM, fertility restorer gene is defined in the scope of a 337kb of Chinese cabbage A09 karyomit(e).Not only can be applicable to the molecular marker assisted selection of Chinese cabbage CMS7311 fertility restorer gene, improve efficiency of selection, accelerate breeding process, also the molecular mechanism for the map based cloning of further fertility restorer gene, announcement cytoplasmic male sterility and fertility restorer thereof lays the foundation.
Accompanying drawing explanation
Fig. 1 is that InDel78 is marked at F
2amplification on individuality;
Fig. 2 is evaluation and the sterile strain checking of SCAR42 mark.
In Fig. 1 and 2, symbol is expressed as:
F: can educate individual plant; S: sterile individual plant; M:DL2000DNA Marker; Asterisk * expressive notation detected result and field fertility phenotype are inconsistent.
Fig. 3 is the linkage inheritance figure between fertility restorer gene BcRfp and two marks.This figure is three-primer (SC42F1, P42F and P42R) pcr amplification result; Wherein, the object fragment of 458bp is the amplification of SC42F1 and P42R; In contrast, approximately 750bp's is P42F and P42R amplification compared with large fragment, can be used to indicate having or not of template DNA in PCR process.
In figure, F: can educate individual plant; S: sterile individual plant; M:DL2000DNA Marker; Asterisk expressive notation detected result and field fertility phenotype are inconsistent.
Below in conjunction with drawings and Examples, the present invention is described in further detail.
Embodiment
Embodiment 1: excavate with the InDels mark that Chinese cabbage CMS7311 fertility restorer gene BcRfp is chain
(1) structure of segregating population
With by 83～2 Chinese cabbages (see to flat, 1996, " rice field kind autumn vegetable combination pattern ", vegetables, 01:28 page) the Chinese cabbage male sterile restoring line 01S325 of selfing 5 generations incubation, as male parent, gives male sterile line CMS7311 pollination, and the F1 plant that obtains all shows as and can educate.By individual plant selfing, build F
2for segregating population, in 258 strain individualities of sowing, field fertility investigation demonstration, 186 strains are male-fertile, 72 strains are male sterile individual plant, through x2 test, show that fertility separating ratio meets 3:1 (x
0 2=1.013, x
0.05,
1 2=3.841), show that the fertility restorer of this male sterile line is by the dominant gene of Dominant gene.
(2) DNA extraction and label screening
(1) by CTAB method, extract detected materials genomic dna, specifically with reference to the method for (2006) such as Wang Qi;
(2) design of primers: laboratory early-stage Study result has been positioned fertility restorer gene in the physical distance of about 1M on Chinese cabbage genome A09 karyomit(e).This research is based on existing positioning result and relevant Chinese cabbage genome sequence, design and synthesize a series of primers, by sterile and Fertile material pcr amplification, order-checking, identify, find a series of InDel marks, be respectively: InDel37, InDel55, InDel78, InDel42, InDel55, InDel60 etc.Genetic analysis shows, two mark InDel78 and InDel42 are distributed in fertility restorer gene Rf two ends, and genetic distance is respectively 0.91cM and 0.92cM, and goal gene is limited in the scope of about 337Kb.Wherein InDel78 object clip size between sterile and Fertile material differs about 265bp left and right, adopts the 0.8% common agarose gel electrophoresis completely can be separated, therefore can be directly used in the molecule marker of fertility restorer gene.Wherein InDel78 and InDel42 the primer sequence are as follows:
ID78F：5-ATCATATCCTGTCTATTTCGTGCT-3；
ID78R：5-GTTATAACGAGGCACATAGGTTTC-3；
P42F：5-ATGGAAGAAGCCCTAAGAAAGT-3；
P42R：5-ACTAATGTTTCCGTAGCAATCT-3。
Embodiment 2: the SCAR of mark InDel42 transforms and identifies
(1) conversion of SCAR mark
Because the PCR product of mark InDel42 in sterile material lacks 12bp than Fertile material, adopt 0.8% agarose gel electrophoresis to be difficult to both effectively separated, this mark can only be converted into SCAR42 mark, can make a distinction.Sequence following (line part is sterile material deletion sequence) in fertile plant:
ATGGAAGAAGCCCTAAGAAAGTTCAACGAATCTACCTACTCCTTCATACCCGGTTACGAACCCGACCCGATTCCTCTAACGAGAATCTTTGCCAATGATGCAAACTCCCCGCAGGTTAACAACACACCGTCTTCAAAGGAGGCAATAGTGACCATCACCGGATCTGGCAGGACAAGGTACCGTGGCGTTCGCCGAAGGCCGTGGGGACGTTACGCGGCGGAGATACGTGATCCCACGTCGAAGGAGAGACGTTGGCTCGGAACGTTCGATACGGCGGAGCAAGCCGCTTGTGCTTACGACTGTGCAGCTCGTGAGTTTCGTGGATCTAAGGCTCGGACCAACTATACTTATC
CTGTTACTAATCCTGTTGCCGAGCCTAGATTCTCTTTCTCCTCAAAGAAATCTATGAAGGCCGTTCGTTCTCCTATACCGTCACCTCTGAAGATGAACACACAGCCTCTCTTATGGTATTCCTCTCACGAAACAGCGACTAACGGCTCCTCTTCTCCTTCTTGCTCCTTGACAAAAACGGCAAGCATTTCCTCTTCCGCTGATGAAAACTACACGGAGTTTTTCCCGCAAGAACATTCTGATTCTGGTCTCTTGCAAGATATCGTTCAAGAGTTCTTGAAGAAGAAACGCAACCAGCCTCCGCCACTGATACCACCACCACCACCACCGCCATCTCCACCGATGGTTGGACATCTTGAAAACTTCCGTGAATTCTCCGCCAACAGTTTGTTTCAACCGATGGTGGAGACATCAAAATT
AG ATTGCTACGGAAACATTAGT。
Based on above deletion sequence, redesign SCAR primer SC42F1, for the P42R combination of primers amplification object band with original.
SC42F1 primer sequence is: 5-GGACCAACTATACTTATCCTGTTACT-3.
(2) evaluation of SCAR mark
In order to verify the reliability of this SCAR42 mark, applicant is to F
2for isolates individual plant, increase.Amplification shows, it can not amplify band in sterile, and in Fertile material, no matter be heterozygosis Fertile material or pure and mild Fertile material, all can amplify object band.
Two of embodiment 3:InDel78 and SCAR42 are marked at the application in the assisted Selection with Chinese cabbage CMS7311 fertility restorer gene
(1) by CTAB method, extract detected materials genomic dna, concrete grammar is the same;
(2) PCR reaction
(1) PCR reaction system: 25ul system, the content of each component materials is respectively: 20ng template DNA; 2.5ul10 * buffer; 1.8mM MgCl
2; 0.25mmol/L dNTP; 1pmol/L primer: 1.5U Taq archaeal dna polymerase; ddH
2o polishing, to 25ul, mixes, centrifugal;
(2) pcr amplification program: 94 ℃/5min of denaturation, then 94 ℃/60s, 56 ℃/45s, 72 ℃/1min, after 35 circulations, 72 ℃ are extended 5min;
(3) electrophoresis: the 6 * loading buffer that gets 6ul pcr amplification product and 2ul mixes, clicks and enters in 0.8% sepharose, and electrophoresis 25min under 150V voltage observes and takes pictures after EB dyeing in gel imaging instrument;
(4) interpretation of result:
Using primer I D78F/R to amplify the object band of 1146bp, this material is 99.09% with the probability of Chinese cabbage CMS fertility restorer gene; Using primer SC42F1/R to amplify the object band of about 458bp, this material is more than 99.08% with the probability of Chinese cabbage CMS fertility restorer gene; If two pairs of primers amplify respectively object band simultaneously, to have the probability of Chinese cabbage CMS fertility restorer gene be 100% to detected materials.
Claims (4)
1. can educate the closely linked molecule marker of gene with cabbage cytoplasm male sterile for one kind, it is characterized in that, described can educate the closely linked molecule marker of gene with cabbage cytoplasm male sterile and be and be positioned at Chinese cabbage CMS7311 fertility restorer gene both sides InDel78 mark closely linked with it and restorer sequence SCAR42 mark, wherein, InDel78 mark is comprised of restorer sequence InDel78F and sterile line sequence InDel78S;
Described restorer sequence InDel78F size is 1146bp, and concrete sequence is as follows:
5-
ATCATATCCTGTCTATTTCGTGCTTCTCCTAAAAGAGTGATCTTAAGACCCAATCATCATGAGAATGTTTCTAGCTCTCTTCCTTCTCTTGGCCTTGACCACATCTTCAAGTAAGTACCTTTCTTCTCTTCTTGGTATACGGTCCAATAACAGTATTTAAGATTTTATTTCTATGTCTTTCTTTCTCTCTAGATGCAACTTACTGCCTCTGCAAAGATGGGACAGAAGACAACGCACTTCAAGCATCAATAGACTATGTTTGTGGAAAATTAGATTGCAACCCAATCCTTGACAAGGGTGCTTGTTATCAACCAAACACCATCAAAAGCCACTGTGATTGGGCTGTTAACAGCTACTTCCAGAATGTAGCTCAAGCCCCTGGAAGCTGCGACTTCTCTGGAACTGCCACTACCAGTCAAAACCCACCTSCATGTAAGTAAAAAAGTTTACATTTTGATGCGAAAAGTTGTGGTCTTGATGAGGTTCTTTTGTGCAGATTTGGTTACCGGATGTGTCTATCCTTCAAGCGCTAGGTAACTAATGATCACTAACACAAACCTAAGCCTAACTCATTTACATGGATATGACTTATAAAAAGTTTGGTGTGTGTATTAACAGCTCTCCAGGGTCGCTTCCTTCAACTACACCACCACCGGGAACAAAGCAGACAAACGGAACCGTTACTCCAACCAACGGTGCTTCTGTTTATCAACACTAGCGCTTCTGATGTAACGTTCGTATGGAGACAAAGACATCCACATCGGTCCGTCTTTGGTTCCCTTTTGGGTAGAAAAGGAAGCTTCAGTCGTCATTGTGGTTTATATTTCTGTTGTTGCATTTATGTGAAAGTTGCTCTAATTAGAATCTTGAGTAAATAAATAAAATAAAAACAGAGCATTATGATAAAGACTTGTCAATAAAAAGATACCATATTTTTATAATTTCTAATGATCAATCATATAGACTAAAGCAAAATTTATTCACCATTTTAGTAGCTTCAACATCCAATTTAGATTATTGTTCTACAACTTCAACAACGCAACTGCCACCAGCATCATTTTGTAGTAATCTAATCTACCAGATGTTATTCAGTTAAAAAAAATATACTGTGGCAAAGAAAGA
GAAA CCTATGTGCCTCGTTATAAC-3；
Described sterile line sequence InDel78S size is 881bp, and concrete sequence is as follows:
5-
ATCATATCCTGTCTATTTCGTGCTTCTCCTAAAAGAGTGATCTTAAGACCCAATCATCATGAGAATGTTTCTAGCTCTCTTGCTTCTCTTGGCCTTGACCACATCTTCAAGTAAGTCTTTCTTCTCTTCTTCCTAAAGTCTACATTTTGATGAAAAAAGTTGCGGTCTTGATGAGGTCTTTTGTGCAGRTTTGGTTACCGGATGTGTCTATCCTTCAAGCGCTAGGTAACTAATGATCACTAACACAAACCTAAGCCTAACTCATTTACATGGATATGACTTATAAAAAGTTTGGTGTGTGTATTAACAGCTCTCCAGGGTCGCTTCCTTCAACTACACCATCACCGGGAACAAACAAGACAAACGGTGCTTCCAGTTTGGTCATTTCCCCTGCTTTCGCAATCTGTTTATCAACACTAGCGCTTCTGATGTAACGTTCGTGTGGAGACAAAGACATCCACATGGGTCCGTCTTTGGTTCCCTTTTGGGTGGAAAAGGAAGCTTCAGTGGTCATTGTGGTTTATATTTCTGTTGTTGCATTTATGTGAAAGTTGCTCTAATTAGAATCTTGAGTAAATAAATAAAATCAAAACAGAGCATTATGATAAAGACTTGTCAATAAAAAGATACCATATTATTATAATTTCTAATGATCAATCATATAGACTAAAAATTTATTCACCATTTTAGTAGCTTCAACATCCAATTTAGATTATTGTTCTACAACTTCAACAACGCAAGTGCCACCAGACATCATTTTGTAGTAATCTACCAGTTGTTATTCAGTTAAAACTAAGGTTTCTCTCTTTAGGTGTTAGTTATTCAGTTAAAAGAATATACTATGTGGCAAAGAAAGA
GAAACCTATGTGCCCGTTATAACA-3；
Described restorer sequence SCAR42 mark size is length 458bp, and concrete sequence is as follows:
5-
GGACCAACTATACTTATCCTGTTACTAATCCTGTTGCCGAGCCTAGATTCTCTTTCTCCTCAAAGAAATCTATGAAGGCCGTTCGTTCTCCTATACCGTCACCTCTGAAGATGAACACACAGCCTCTCTTATGGTATTCCTCTCACGAAACAGCGACTAACGGCTCCTCTTCTCCTTCTTGCTCCTTGACAAAAACGGCAAGCATTTCCTCTTCCGCTGATGAAAACTACACGGAGTTTTTCCCGCAAGAACATTCTGATTCTGGTCTCTTGCAAGATATCGTTCAAGAGTTCTTGAAGAAGAAACGCAACCAGCCTCCGCCACTGATACCACCACCACCACCACCGCCATCTCCACCGATGGTTGGACATCTTGAAAACTTCCGTGAATTCTCCGCCAACAGTTTGTTTCAACCGATGGTGGAGACATCAAAATT
AGATTGCTACGGAAACATTAGT-3。
2. cabbage cytoplasm male sterile as claimed in claim 1 can be educated the closely linked molecule marker of gene, it is characterized in that, the sequence of the PCR specificity amplification primer of described restorer sequence InDel78F, sterile line sequence InDel78S and restorer sequence SCAR42 mark is as follows:
ID78F：5-ATCATATCCTGTCTATTTCGTGCT-3；
ID78R：5-GTTATAACGAGGCACATAGGTTTC-3；
SC42F1：5-GGACCAACTATACTTATCCTGTTACT-3；
P42R：5-ACTAATGTTTCCGTAGCAATCT-3。
3. the cabbage cytoplasm male sterile described in claim 1 or 2 can be educated the application of the closely linked molecule marker of gene in assisted Selection.
4. application as claimed in claim 3, is characterized in that, concrete grammar is:
(1) by CTAB method, extract detected materials genomic dna;
(2) pcr amplification:
A, reaction system are 25ul system, and the content of each component materials is respectively: 20ng template DNA; 2.5ul10 * buffer; 1.8mM MgCl
2; 0.25mmol/L dNTP; 1pmol/L primer: 1.5U Taq archaeal dna polymerase; ddH
2o polishing, to 25ul, mixes, centrifugal;
B, pcr amplification program: 94 ℃/5min of denaturation, then 94 ℃/60s, 56 ℃/45s, 72 ℃/1min, after 35 circulations, 72 ℃ are extended 5min;
C, electrophoresis: get the pcr amplification product of 6ul and 6 * loading buffer of 2ul mixes, click and enter in 0.8% sepharose, electrophoresis 25min under 150V voltage observes and takes pictures after EB dyeing in gel imaging instrument;
D, judgement:
Using primer I D78F/ID78R to amplify the object band of 1146bp, this material is 99.09% with the probability of Chinese cabbage CMS fertility restorer gene;
Using primer SC42F1/P42R to amplify the object band of 458bp, this material is more than 99.08% with the probability of Chinese cabbage CMS fertility restorer gene;
If two pairs of primers amplify respectively object band simultaneously, to have the probability of Chinese cabbage CMS fertility restorer gene be 100% to detected materials.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410165808.5A CN103981177B (en) | 2014-04-22 | 2014-04-22 | The molecular marker of cabbage cytoplasm male sterility restoring gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410165808.5A CN103981177B (en) | 2014-04-22 | 2014-04-22 | The molecular marker of cabbage cytoplasm male sterility restoring gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103981177A true CN103981177A (en) | 2014-08-13 |
| CN103981177B CN103981177B (en) | 2016-08-17 |
Family
ID=51273351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410165808.5A Expired - Fee Related CN103981177B (en) | 2014-04-22 | 2014-04-22 | The molecular marker of cabbage cytoplasm male sterility restoring gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103981177B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561062A (en) * | 2015-01-07 | 2015-04-29 | 岭南师范学院 | Cultivated rice hybrid infertility gene S1 and application thereof |
| CN106434696A (en) * | 2016-11-19 | 2017-02-22 | 西北农林科技大学 | Cabbage polCMS fertility restoring gene and detection method and application thereof |
| CN107312870A (en) * | 2017-09-04 | 2017-11-03 | 河南省农业科学院园艺研究所 | With molecular labeling, method and the application of capsicum sterile restoring gene close linkage |
| CN108913800A (en) * | 2018-07-24 | 2018-11-30 | 信阳师范学院 | A kind of Chinese cabbage hau CMS sterile cytoplasm specific molecular marker and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1849881A (en) * | 2006-06-05 | 2006-10-25 | 华中农业大学 | Selective breeding method for cabbage cytoplasm male sterile line |
| CN101575603A (en) * | 2009-03-31 | 2009-11-11 | 沈阳农业大学 | SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof |
-
2014
- 2014-04-22 CN CN201410165808.5A patent/CN103981177B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1849881A (en) * | 2006-06-05 | 2006-10-25 | 华中农业大学 | Selective breeding method for cabbage cytoplasm male sterile line |
| CN101575603A (en) * | 2009-03-31 | 2009-11-11 | 沈阳农业大学 | SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ZHANGLU GANG，ET AL: "investigation on the sterility changeover of male sterility line CMS7311 in heading chinese Cabbage", 《ACTA BOTANICA SINICA》 * |
| 许小勇: "大白菜CMS7311不育发生相关基因表达研究及育性恢复基因定位", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561062A (en) * | 2015-01-07 | 2015-04-29 | 岭南师范学院 | Cultivated rice hybrid infertility gene S1 and application thereof |
| CN106434696A (en) * | 2016-11-19 | 2017-02-22 | 西北农林科技大学 | Cabbage polCMS fertility restoring gene and detection method and application thereof |
| CN106434696B (en) * | 2016-11-19 | 2022-02-08 | 西北农林科技大学 | Chinese cabbage polCMS fertility restorer gene and detection method and application thereof |
| CN107312870A (en) * | 2017-09-04 | 2017-11-03 | 河南省农业科学院园艺研究所 | With molecular labeling, method and the application of capsicum sterile restoring gene close linkage |
| CN107312870B (en) * | 2017-09-04 | 2021-01-08 | 河南省农业科学院园艺研究所 | Molecular marker closely linked with pepper sterility restoring gene, method and application |
| CN108913800A (en) * | 2018-07-24 | 2018-11-30 | 信阳师范学院 | A kind of Chinese cabbage hau CMS sterile cytoplasm specific molecular marker and its application |
| CN108913800B (en) * | 2018-07-24 | 2021-12-28 | 信阳师范学院 | Chinese cabbage hau CMS sterile cytoplasm specific molecular marker and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103981177B (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Collection and evaluation of genetic diversity and population structure of potato landraces and varieties in China | |
| Tanweer et al. | Current advance methods for the identification of blast resistance genes in rice | |
| Hirano et al. | Genetic structure of landraces in foxtail millet (Setaria italica (L.) P. Beauv.) revealed with transposon display and interpretation to crop evolution of foxtail millet | |
| Barchi et al. | A high-resolution, intraspecific linkage map of pepper (Capsicum annuum L.) and selection of reduced recombinant inbred line subsets for fast mapping | |
| CN104073487B (en) | The molecule marker of rice blast resistant gene Pi2 and application thereof | |
| Foulongne-Oriol et al. | Comparative linkage mapping in the white button mushroom Agaricus bisporus provides foundation for breeding management | |
| CN104877996A (en) | Haynaldia villosa's 6VS chromosome specific molecular marker 6VS-BH1 and application thereof | |
| CN104152450B (en) | The InDel molecular labelings isolated with cucumber powdery mildew resistance main effect gene | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN103981177A (en) | Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof | |
| CN105483217A (en) | Molecular marker method for identifying paddy rice Dongxiang wild cytoplasmic male sterility sources | |
| CN102220316B (en) | Preparation method and application of molecular marker of rape male sterile restoring gene | |
| CN104178560A (en) | Molecular marking method of rice stigma exsertion major QTL sites | |
| Kanno et al. | Conversion of a male-specific RAPD marker into an STS marker in Asparagus officinalis L. | |
| Honma et al. | Molecular mapping of restorer-of-fertility 2 gene identified from a sugar beet (Beta vulgaris L. ssp. vulgaris) homozygous for the non-restoring restorer-of-fertility 1 allele | |
| CN105132570B (en) | A kind of primer sets of assistantly screening anti-stripe rust wheat and its application | |
| Mihovilovich et al. | An RGA-derived SCAR marker linked to PLRV resistance from Solanum tuberosum ssp. andigena | |
| CN105176978B (en) | Tomato yellow leaf curl disease-resistant gene ty 5 molecular labeling primer and its application | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN105647920A (en) | InDel molecular marker based on TYLCV (tomato yellow leaf curl virus) resistance gene Ty-3 | |
| Cao et al. | Inheritance and molecular mapping of an alien stripe-rust resistance gene from a wheat-Psathyrostachys huashanica translocation line | |
| CN105441544B (en) | Screen the method and application of Chinese cabbage recessive cytoblast sterile line fertility related molecular marker jointly using SNP and SSR technology | |
| CN103789419A (en) | Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160817 |