Schistosoma japonicum Wnt5 gene, albumen and application
Technical field
The present invention relates to technical field of bioengineering, particularly relate to a kind of Schistosoma japonicum Wnt5 gene, albumen and purposes.
Background technology
Schistosomicide is caused by schistosomicide, widely distributed, endanger serious infecting both domestic animals and human parasitosis.Current praziquantel is still unique chemotherapeutics of this disease of control.Although result for the treatment of is satisfactory, there is the risk producing resistance in long-term single, medication repeatedly.Therefore the new medicine for schistosomicide is urgently developed.And new drug research will be made to make a breakthrough, fully understanding the bilharzial regulatory mechanism that grows is important foundation.
Wnt signal path is the conserved signal approach be prevalent in multi-celled eukaryotes, all has important regulating effect to early embryonic development and the stable of one-tenth internal milieu.The exception adjustment of this path can make embryo build up to be destroyed and cause embryo's deformity even dead, and adult Wnt abnormal signal activates the raw tumour of fecund.At present, with Wnt signal path member for target research anti-cancer agent is the study hotspot of biological medicine.This seminar takes the lead in having carried out the research of Wnt signal path on schistosomicide, wishing the adjustment of growing schistosomicide by understanding this signal path, screening important regulatory molecule as medicine target, advances the research and development of schistosomicide new drug.
Wnt5 is one of Wnt protein family member, and research shows that Wnt5 plays many-sided regulating and controlling effect in the fetal development of different plant species.Wnt5 albumen, at the gastrula Formation period of many animals, participates in regulating the convergence of cell to extend motion, and the migration of cell.If Wnt5 signal path is in the formation of zebra fish tail, the growth of the central nervous system of fruit bat, all plays vital effect in the processes such as the correct migration of mouse pancreas islet cells.But, there is no the research report of Schistosoma japonicum Wnt5 gene so far both at home and abroad.
Summary of the invention
The present invention will solve the technical problem causing owing to lacking understanding to the regulatory mechanism that grows of Schistosoma japonicum being difficult to make a breakthrough in new drug development, a kind of Schistosoma japonicum Wnt5 gene (being called for short SjWnt5 gene) and albumen are provided, this SjWnt5 gene participates in regulation and control and bilharzially to grow and Development of Reproductive System, controls schistosomicide to grow and the new drug of reproductive physiology has higher using value to exploitation.
In addition, the application that a kind of Schistosoma japonicum Wnt5 gene and protein are provided also is needed.
In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:
In one aspect of the invention, provide a kind of schistosoma japonicum gene, described gene is the Wnt5 gene of aminoacid sequence shown in coding SEQIDNO.1.
Preferably, the nucleotide sequence of described gene is as shown in SEQIDNO.2.
In another aspect of this invention, provide a kind of Japanese blood fluke protein, the Wnt5 protein that described protein is aminoacid sequence shown in SEQIDNO.1.
In another aspect of this invention, additionally provide a kind of recombinant vectors, comprise the nucleotide sequence of 67-271 amino acids sequence in coding SEQIDNO.1.
In another aspect of this invention, additionally provide a kind of host cell, comprise above-mentioned recombinant vectors.
In another aspect of this invention, additionally provide a kind of above-mentioned schistosoma japonicum gene prevent in preparation or treat the application in the medicine of schistosomicide.
Described medicine grows by blocking schistosomicide or blocks the effect that schistosomicide Development of Reproductive System plays prevention and cure of schistosomiasis.
In another aspect of this invention, additionally provide a kind of above-mentioned Japanese blood fluke protein prevent in preparation or treat the application in the medicine of schistosomicide.
Described medicine grows by blocking schistosomicide or blocks the effect that schistosomicide Development of Reproductive System plays prevention and cure of schistosomiasis.
Schistosoma japonicum Wnt5 gene of the present invention, real-time fluorescence quantitative PCR analytical results shows that SjWnt5mRNA expressed showed increased 13 days Organ Differentiation phases, thereafter within 18 days, the spouse that fills the span of a man's arms continues to increase the phase, within 23 days, reproductive organ tentatively builds up beginning, SjWnt5mRNA expresses and declines gradually in female worm, and constantly raises in male worm.The variation tendency of Schistosoma japonicum different developmental phases SjWnt5 expressing quantity and the change of SjWnt5mRNA expression level basically identical.In conjunction with the physilogical characteristics that schistosomicide grows, infer that the Wnt signal of SjWnt5 initiation is grown early stage Organ Differentiation to polypide and had regulating effect; To building up of female worm reproductive organ, and the further growth of sexual maturity male worm all may have regulating effect, and SjWnt5 gene of the present invention is that the new drug that exploitation blocking-up polypide grows provides new approaches.
Accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation.
Fig. 1 is that the transmembrane structure of the SjWnt5 of the embodiment of the present invention 1 predicts the outcome figure;
Fig. 2 is the multiple comparison chart of the embodiment of the present invention 1 different plant species Wnt5 aminoacid sequence;
Fig. 3 be the embodiment of the present invention 2 Schistosoma japonicum not the same period SjWnt5mRNA expression level histogram not and between sex;
Fig. 4 is the polypide SjWnt5mRNA expression level histogram of the embodiment of the present invention 2 Schistosoma japonicum 25 days unisexuality and polyinfection;
Fig. 5 is the abduction delivering figure of SDS-PAGE analysis pET28a-Wnt5a-(67aa-271aa) recombinant plasmid of the embodiment of the present invention 3;
Fig. 6 is the purified product figure after the embodiment of the present invention 3 electrophoresis detection recombinant protein prokaryotic expression;
Fig. 7 is the Westernblot analytical results figure of pET28a-Wnt5a-(67aa-271aa) recombinant protein of the embodiment of the present invention 3;
Fig. 8 is the SjWnt5 polyvalent antibody specific outcome figure that the embodiment of the present invention 4 is prepared with the natural polypide Identification of Fusion Protein of schistosomicide;
Fig. 9 is the different developmental phases SjWnt5 expressing quantity change histogram of the embodiment of the present invention 5.
Embodiment
In the following example, the experimental technique of unreceipted actual conditions, usual condition routinely, as " Molecular Cloning: A Laboratory guide " (J. Pehanorm Brooker, D.W. Russell work, Huang Peitang, Wang Jiaxi, Zhu Houchu, wait and translate. and the 3rd edition, Beijing: Science Press, 2002) method described in is carried out.
The present invention for template, obtains Schistosoma japonicum Wnt5 (SjWnt5) full length cDNA sequence by RACE technology with the virgin worm cDNA of 7d, and recycling bioinformatics software analyzes the structure of this gene and proteins encoded thereof.Result shows, this SjWnt5cDNA total length 1954bp (SEQIDNO.2), 182 ~ 1330bp are coding region, 382 amino acid (SEQIDNO.1) of encoding.Amino acid sequence analysis shows, and SjWnt5 albumen does not have signal peptide, is nonsecreting type Wnt albumen.Utilize fluorescence real-time quantitative PCR methods analyst SjWnt5 gene in the change of Schistosoma japonicum different developmental phases mRNA level in-site.With containing the 67aa-271aa sequence enriching epitope, build prokaryotic expression carrier, express SjWnt5 recombinant protein.With the prokaryotic expression product of purifying for antigen, immune animal prepares polyclonal antibody, with this polyclonal antibody for primary antibodie, analyzes the change of SjWnt5 at Schistosoma japonicum different developmental phases protein level by Westernblotting.Experimental result display SjWnt5mRNA expressed showed increased 13 days Organ Differentiation phases, and within thereafter 18 days, the spouse that fills the span of a man's arms continues to increase the phase, and within 23 days, reproductive organ tentatively builds up beginning, and SjWnt5mRNA expresses and declines gradually in female worm, and constantly raises in male worm.In the female worm of unisexuality infection in 25 days, expression level is higher than the female worm about 5 times of multiple infection, and the male worm of unisexuality infection in 25 days is lower than the male worm about 5 times of multiple infection.In conjunction with the physilogical characteristics of cercarial Development of Schistosoma Japonicum, infer that the Wnt signal of SjWnt5 initiation is grown early stage Organ Differentiation to polypide and had regulating effect; To building up of female worm reproductive organ, and the further growth of sexual maturity male worm all may have regulating effect, shows that this SjWnt5 gene pairs exploitation blocking-up schistosomicide grows and the new drug of Development of Reproductive System has very high using value.
The acquisition of embodiment 1 Schistosoma japonicum Wnt5 new gene full length cDNA sequence and bioinformatic analysis
1. the same period, other Schistosoma japonicum was not collected
Schistosoma japonicum (Anhui strain) miracidium infection new zealand rabbit, belly paster, infects 2,000 ~ 10,000 cercaria/only.Cut open after 7th day, 13 days, 18 days, 23 days, 35 days, 42 days, 52 days after infection respectively and kill, the PBS solution adding antithrombotics from hepatic vein perfusion goes out polypide, and PBS washs polypide and removes other impurity such as the tissue adhered to.The polypide of 23 days, 35 days, 42 days and 52 days is carried out male and female separately.Collect polypide frozen for subsequent use in liquid nitrogen.The cercaria belly paster of single oncomelania effusion infects BALB/c mouse and obtains the female worm of unisexuality or male worm, and the cercaria mixing postoperative infection BALB/c mouse of multiple oncomelania effusion simultaneously obtains the polypide of Male-female worm pairing, all cuts open to kill in metainfective 25th day and rushes worm.
2. the extraction of total serum IgE and the synthesis of cDNA
, sex polypide total serum IgE other by each phase of Trizol test kit specification sheets extracting collection, agarose gel electrophoresis analyzes the integrity of RNA sample, the concentration of UV spectrophotometer measuring RNA and purity assay.It is frozen for subsequent use that total serum IgE puts-80 DEG C of refrigerators.Get each phase of extracting not, the total serum IgE of sex, according to PrimeScriptTMRTreagentKit kits manuals, reverse transcription becomes cDNA, as the template of real-time quantitative PCR amplification.
3. the amplification of Schistosoma japonicum Wnt5 full-length gene order
With reference to the result of multiple comparisons of the Wnt5 albumen of other species, comprise people, mouse, Xenopus laevis, zebra fish, turbellarian worm, clonorchis sinensis and Schistosoma mansoni, select wherein conservative aminoacid sequence RFRHWNC and CKCHGVSG as the site of design primer.The Preference of Schistosoma japonicum codon is considered, design pair of primers SjWnt5F and SjWnt5R, the EST fragment of amplification Schistosoma japonicum Wnt5 when designing primer.With the cDNA of 7 days polypide RNA reverse transcription for template, carry out pcr amplification, amplified production carries out cloning and sequencing.Sequencing result carries out BLASTX analysis, and after determining that Insert Fragment is Wnt5 gene order, bamboo product RACE primer, carries out 3 ' and 5 ' and extend.After the order-checking of RACE product cloning, carry out electronic splicing with est sequence, the ORFfinder of splicing sequence NCBI finds encoder block.After determining to comprise complete encoder block in splicing sequence, then at two ends design primer (SjWnt5fulF and SjWnt5fulR) of splicing sequence, carry out the amplification of full length sequence.Concrete primer sequence sees the following form 1.
Table 1 is for the PCR primer sequence of increase SjWnt5EST, RACE and full length cDNA sequence
4.SjWnt5 bioinformatic analysis
New gene full length cDNA sequence is carried out similarity comparison at BLASTX database; The ORFfinder of NCBI is utilized to predict the encoder block of new gene; ProtParam software is utilized to analyze parameters such as new gene total number of atnino acid, composition, protein relative molecular weights; Clustalw2 software is utilized to carry out multiple ratio pair to different plant species Wnt5 albumen.The glycosylation site of NetAcet software to predicted protein is utilized to analyze; SignalP and TMHMM is utilized to carry out signal peptide and transmembrane structure prediction.
The bioinformatic analysis result of SjWnt5 Nucleotide and aminoacid sequence:
SjWnt5cDNA total length 1954bp (SEQIDNO.2), 182 ~ 1330bp are coding region, 382 amino acid (SEQIDNO.1) of encoding.Theoretical molecular is 43.63Ku, theoretical iso-electric point 9.25.The similarity system design display of aminoacid sequence, SjWnt5 and Wnt family protein has higher homology, wherein the highest with the homology of Wnt5a albumen.Amino acid sequence analysis shows, and SjWnt5 albumen does not have signal peptide, is nonsecreting type Wnt albumen.Have transmembrane structure (as shown in Figure 1) at N end, whole albumen is anchored on film by the transmembrane structure that N holds, and C end dissociative is outside born of the same parents.Similar to other Wnt protein family member, whole SJWnt5 albumen is dispersed in 24 can form the cysteine residues of disulfide linkage by commissure, wherein 50% carboxyl terminal being positioned at albumen; There are 2 potential glycosylation sites, lay respectively at aa115 ~ aa117 (NCS) and aa330 ~ aa332 (NST).The Wnt5 aminoacid sequence of different class animal and SjWnt5 is selected to carry out multiple ratio pair, comprise: people (Homosapiens, AAH74783.2), mouse (Musmusculus, NP_001243153.1), Africa xenopus (Xenopuslaevis, NP_001079345.1), zebra fish (Daniorerio, NP_571012.1), Hawaii squid (Euprymnascolopes, ABC96709.1), Schistosoma mansoni (Schistosomamansoni, XP_002575587.1), Mediterranean Sea turbellarian worm (Schmidteamediterranea, ACJ64864.1), clonorchis sinensis (Clonorchissinensis, the species such as GAA50814.1).Result as shown in Figure 2, belongs to the Schistosoma japonicum of platyhelminth, Schistosoma mansoni, clonorchis sinensis and Dugesia japonica, and its Wnt5 albumen is under the jurisdiction of same branch on phylogenetic tree.Other vertebrates is in a branch, and high vertebrates, the similarity of Wnt5 albumen is higher.
Embodiment 2SjWnt5 is in the component analysis of Schistosoma japonicum different developmental phases mrna expression
1. experimental technique
According to the design of primers principle design SjWnt5 primer of real-time quantitative PCR, upstream primer: 5 ' CTCAGAGTCCAGGTACAAGAGGTCG3 ' (SEQIDNO.11); Downstream primer: 5 ' GACACTCAACGCGACAACACCAATT3 ' (SEQIDNO.12).18SrRNA (the GenBank number of logging in AY157226.1) is selected to make internal reference, upstream primer: 5 ' CTTAGTTGGTGGAGCGATTTGTCTG3 ' (SEQIDNO.13); Downstream primer: 5 ' CGACCACACTACTCCATAAAGAAGC3 ' (SEQIDNO.14); Primer is synthesized by invitrogen company.
With reference to PrimeScript
tMrTreagentKit illustrates, RNA reverse transcription is become cDNA, take SYBRGreenI as fluorescence dye, carries out real-time quantitative PCR amplification with SYBRGreenPCRPremixExTaq.Reaction conditions is: 95 DEG C of 5min, then 95 DEG C of 15s, 60 DEG C of 5s, totally 40 circulations, and each sample all does three repetitions.To do after 10 times of serial dilutions, for template, to build the typical curve of SjWnt5 and 18SrRNA internal reference, guarantee the coefficient R of typical curve with the virgin worm cDNA of 7d
2> 0.99.Experimental result adopts two mark curve method to analyze, and obtains the copy number of the SjWnt5 of the not relative 18SrRNA reference gene not same period.
2. result
Fig. 3 display be SjWnt5 mRNA schistosomicide not the same period relative expression levels not and between sex.Polypide before 18 days is less, and male and female are separately more difficult, adopts male and female mixing polypide to analyze.23 days and subsequent adult, male and female are analyzed after separating respectively.The expression level of SjWnt5mRNA in worm's ovum and 7 days virgin worms is close, to adding nearly 2 times when 13 days, to adding about 2.5 times when 18 days.In 23 days and subsequent female male worm, SjWnt5mRNA expresses and presents contrary trend, and express in female worm and lower gradually, the female worm expression level of 52 days is minimum in all etap; And SjWnt5 expresses and raises gradually in male worm, the male worm expression level of 52 days is the highest.
Fig. 4 mrna expression level that is SjWnt5 in the polypide of 25 days unisexuality and polyinfection.In the polypide of polyinfection in 25 days, the expression amount of male worm SjWnt5mRNA is apparently higher than female worm.But the expression level of SjWnt5mRNA is close between the male and female polypide of unisexuality infection in 25 days.The expression amount of the female worm SjWnt5mRNA that unisexuality infects is higher than the female worm of polyinfection, and the expression amount of the male worm SjWnt5mRNA that unisexuality infects is starkly lower than the male worm of polyinfection.In Fig. 4, the female worm of polyinfection in 25ddf:25 days; The male worm of polyinfection in 25ddm:25 days; The female worm of unisexuality infection in 25dsf:25 days; The male worm of unisexuality infection in 25dsm:25 days.
The structure of embodiment 3 Schistosoma japonicum SjWnt5 gene recombination prokaryotic expression plasmid, the expression of recombinant protein, purifying and Westernblot detect
1. method
The epitope of application BepiPreb software prediction SjWnt5 albumen, select epitope than more rich section 67aa-271aa, design primer carries out pcr amplification.With Primer5.0 software design primer sequence, upstream primer: 5 ' GTGGATCCCCACTATGTTTACGTGTTCAAGGTT3 ' (SEQIDNO.15), introduce restriction enzyme site BamHI downstream primer: 5 ' GTCTCGAGATAACCTTGACGAAGATAACGACCA3 ' (SEQIDNO.16), introduce restriction enzyme site XhoI, expanding fragment length is 612bp in theory.
With the cDNA of schistosomicide total serum IgE reverse transcription in 23 days for template carries out pcr amplification, to spend the night with pET28a (+) plasmid 16 DEG C of same double digestion through BamHI with XhoI restriction enzymes double zyme cutting after PCR primer reclaims and be connected.To connect product conversion in bacillus coli DH 5 alpha competent cell, picking individual colonies shakes bacterium, carries out bacterium liquid PCR and identifies and the qualification of plasmid double digestion, obtain restructuring positive plasmid pET28a-SjWnt5 after order-checking qualification.
Recombinant plasmid is proceeded to BL21 (DE3) expression type competent cell, picking mono-clonal carries out abduction delivering.The bacterium liquid eggs of SDS-PAGE electrophoretic analysis after ultrasonication is white, judges that albumen is expressed with solubility or inclusion bodies.With cutting glue purification method purifying protein, getting the loadingbuffer that 700ul inclusion body adds 100ul and boiling whole loading after 5 minutes, with after the KCL dyeing of 0.25mol/l, target protein being cut.Get 1mlPBS grind the adhesive tape cut after centrifugal, get supernatant and carry out quantitatively.
The albumen of purifying is carried out SDS-PAGE gel electrophoresis, and electrotransfer is on cellulose nitrate (NC) film.Primary antibodie is made with 1: 50 dilution proportion schistosoma japonice ovum protein immunization rabbit anteserum; Do two with the goat anti-rabbit igg of the dilution proportion HRP mark of 1: 1000 to resist.By enhancement type HRP-DAB colouring reagents chromogenic assay result.
2. result
Go out to encode by pcr amplification the section of SjWnt5 protein 67 aa-271aa, and size is 612bp.Between BamHI and the XhoI restriction enzyme site inserting prokaryotic expression carrier pET28a after double digestion, be built into recombinant plasmid.By bacterium liquid PCR and the qualification of plasmid double digestion, and through sequence verification, goal gene size and reading frame accurate.The expection molecular weight of recombinant protein is 28.6kD.Recombinant plasmid is proceeded in expressive host bacterium BL21 (DE3), analyze recombinant plasmid through SDS-PAGE and induce the expression product after 4 hours.As shown in Figure 5, induced product has an obvious protein band at about 28kDa place, consistent with the predicted molecular weight of recombinant protein, and non-induced product is without this band, show recombinant protein successful expression (in Fig. 5, M: albumen Maker; 1: the cellular lysate thing not adding inductor; 2:pET28a-Wnt5a-(67aa-271aa) recombinant plasmid transformed bacterium induced product).SDS-PAGE analyzes and expresses bacterium cracking supernatant and precipitation, finds that this recombinant protein is mainly expressed with inclusion bodies.Prepare recombinant protein inclusion body, and carry out cutting glue purification, Figure 6 shows that purifying recombinant protein (in Fig. 6, M: albumen Maker; 1: recombinant protein pET28a-Wnt5a-(67aa-271aa)).The recombinant protein that Fig. 7 shows purifying by the rabbit anteserum identification of worm's ovum immunity, can show that this recombinant protein has good antigenicity, can be used for the preparation of immune BALB/c mouse for SjWnt5 how anti-(in Fig. 7, M: albumen Maker; 1: pET28a-Wnt5a-(67aa-271aa) albumen adding inductor).
The preparation of embodiment 4SjWnt5 protein polyclone antibody
Get 6 ~ 10 week age Balb/c male mice 10 and be divided into two groups at random, one group of 5 mouse, is respectively immune group and vehicle control group.Immune group be by purifying after recombinant protein and 206 adjuvants carry out head according to volume 46: 54 ratio mixing and emulsifying and exempt from, dorsal sc multi-point injection, injected dose be 50ug/ only.Vehicle control group carries out head with 206 adjuvants of equal volume and PBS mixing and emulsifying to exempt from, the same immune group of immunization method.Carried out booster immunization every 10 days, only, approach is same as head and exempts from immunizing dose 25ug/ later.Within one week after the 5th booster immunization, carry out plucking eyeball blood sampling, separation of serum.-80 DEG C of refrigerators are frozen for subsequent use.
Collect the BALB/c mouse serum after SjWnt5 purification of recombinant proteins the 5th booster immunization as primary antibodie, make antigen with 23 days polypide whole proteins, carry out Westernblot analysis.Result is as shown in Figure 8 a: the antiserum(antisera) of SjWnt5 albumen can identify in polypide native protein the single protein band being greater than 70kD, is about 2 times of SjWnt5 theoretical molecular.And the native protein of negative serum and polypide does not react (Fig. 8 b), illustrate that resist of the SjWnt5 albumen of preparation has good specificity more.In Fig. 8, the detection that how anti-a:SjWnt5 is; B: normal serum.
The expression of embodiment 5SjWnt5 albumen in different developmental phases Schistosoma japonicum body
According to zooblast (tissue) total protein extraction agent box (I type) (DBI) specification sheets, the frozen worm's ovum of extracting, 7 days, 13 days, 18 days, 23 days, 35 flying worm body proteins, wherein 23 days and 35 days female male worms are separately.The polypide albumen of extracting carries out SDS-PAGE gel electrophoresis, and electrotransfer is on cellulose nitrate (NC) film.Resist so that the SjWnt5 protein immunization of 1: 50 dilution proportion more and make primary antibodie, with the dilution proportion IRDye of 1: 15000 with the tubulin of 1: 1000 dilution respectively
tMthe goat anti-mouse igg (Rockland) of 800 marks is done two and is resisted.By Odyssey Infrared fluorescence scanning imaging system analysis colour developing result.
Schistosoma japonicum different developmental phases SjWnt5 protein expression the results are shown in Figure 9.Show in Fig. 9, using tubulin as internal reference, molecular weight is at 55ku place, and when gray-scale value is all certain, the gray-scale value of SjWnt5 protein expression has obvious difference.SjWnt5 albumen increases from worm's ovum to 18 days expression amounts.In 23 days and subsequent female male worm, SjWnt5 protein expression presents contrary trend, expresses and lower gradually in female worm, and the female worm expression level of 52 days is minimum in all etap; And SjWnt5 expresses and raises gradually in male worm, the male worm expression level of 42 days is the highest.It is substantially consistent that SjWnt5 protein expression trend and SjWnt5mRNA express trend in different developmental phases.
The above embodiment only have expressed embodiments of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Sequence table
<110> China Agriculture Academe Shanghai Veterinary Institute
<120> Schistosoma japonicum Wnt5 gene, albumen and application
<160>16
<170>PatentInversion3.3
<210>1
<211>382
<212>PRT
<213>Schistosomajaponicum
<400>1
MetAsnIleIleLysIleHisHisArgGlnHisLeuTyrGlnGlnTyr
151015
SerLeuAsnGlyLeuLeuValLeuIleLeuLeuIleTyrAlaLeuAsn
202530
IleAsnGlnThrAsnAlaPheGlyAsnMetGlyTyrTrpTrpAsnIle
354045
GlyLeuLeuSerTrpArgThrIleHisGlnSerProAlaPheLeuLeu
505560
AlaProLysProLeuCysLeuArgValGlnGlyLeuThrHisSerGln
65707580
AlaGlnLeuCysGlnArgTyrPheAspHisMetProValIleSerIle
859095
GlyAlaLysLeuGlyIleTyrGluCysGlnArgGlnPheArgPheArg
100105110
HisTrpAsnCysSerSerValAsnAspAlaSerAlaPheGlyProVal
115120125
ThrLeuThrGlySerArgGluAlaGlyPheAlaHisAlaIleSerAla
130135140
AlaGlyValValHisAlaLeuAlaArgSerCysLysGluAlaArgLeu
145150155160
TyrSerCysGlyCysSerLysAlaAspArgProAspGlnLeuHisArg
165170175
AspTrpIleTrpGlyGlyCysGlyAspAsnThrAlaTyrAlaTyrArg
180185190
PheAlaLysAlaPheIleAspValArgGluLysGluGlnSerTyrPro
195200205
ArgHisSerAsnGluLeuAlaArgMetLeuMetAsnLeuHisAsnAsn
210215220
ArgAlaGlyArgLeuAlaValTyrLysLeuAlaSerValAlaCysLys
225230235240
CysHisGlyValSerGlySerCysSerLeuArgThrCysTrpThrGln
245250255
LeuSerProPheThrArgIleGlyArgTyrLeuArgGlnGlyTyrAsp
260265270
GluAlaValLysValLysPheAsnArgArgGlyThrLysLeuArgArg
275280285
AlaSerArgGlnLeuArgArgValThrProAspHisIleThrTyrLeu
290295300
AspGluSerSerAsnTyrCysGluTyrAspProIleThrGlnSerPro
305310315320
GlyThrArgGlyArgGluCysLeuProAsnSerThrAspGlnAlaSer
325330335
CysAlaThrLeuCysCysAsnArgGlySerGlnSerGlnLeuArgGlu
340345350
ValHisGluLysCysHisCysGlnPheAsnTrpCysCysArgValGlu
355360365
CysGlnThrCysValLysThrGluGluTyrHisValCysAsn
370375380
<210>2
<211>1954
<212>DNA
<213>Schistosomajaponicum
<220>
<221>CDS
<222>(182)..(1330)
<400>2
atttattttaaattaaattattggctattgaattcattacaatttcttaacagctaaata60
catgattgtttattcaattcaaaatttgattaagattgtaaaataatgttaatttaaaca120
atgaattcaatattcaatagattataaaaagtgaatacatggaaatatcattaaattgac180
aatgaatatcattaaaattcatcatagacaacatttatatcaacaatat229
MetAsnIleIleLysIleHisHisArgGlnHisLeuTyrGlnGlnTyr
151015
tcattgaatggattacttgttttaattttattaatatatgcattgaat277
SerLeuAsnGlyLeuLeuValLeuIleLeuLeuIleTyrAlaLeuAsn
202530
attaatcaaacaaatgcatttggaaatatgggttattggtggaatata325
IleAsnGlnThrAsnAlaPheGlyAsnMetGlyTyrTrpTrpAsnIle
354045
ggtcttttatcatggcgaacaattcatcaaagtcctgcatttctttta373
GlyLeuLeuSerTrpArgThrIleHisGlnSerProAlaPheLeuLeu
505560
gcaccaaaaccactatgtttacgtgttcaaggtttgacacattcacaa421
AlaProLysProLeuCysLeuArgValGlnGlyLeuThrHisSerGln
65707580
gctcagttatgtcaacgatattttgatcatatgccagtgataagtatt469
AlaGlnLeuCysGlnArgTyrPheAspHisMetProValIleSerIle
859095
ggtgcaaaattaggcatttatgaatgtcaacgacaatttcgatttcgg517
GlyAlaLysLeuGlyIleTyrGluCysGlnArgGlnPheArgPheArg
100105110
cattggaattgcagttctgtcaatgatgcttcagcatttggtccagtt565
HisTrpAsnCysSerSerValAsnAspAlaSerAlaPheGlyProVal
115120125
actttaacaggcagtcgtgaggctggcttcgctcatgcaatatctgca613
ThrLeuThrGlySerArgGluAlaGlyPheAlaHisAlaIleSerAla
130135140
gctggtgttgtacatgccttagcaagaagttgtaaagaagctcgatta661
AlaGlyValValHisAlaLeuAlaArgSerCysLysGluAlaArgLeu
145150155160
tattcgtgtggatgtagtaaagctgatcggccagatcaactgcacgt709
TyrSerCysGlyCysSerLysAlaAspArgProAspGlnLeuHisArg
165170175
gattggatatggggtggttgtggagataataccgcttatgcatatagg757
AspTrpIleTrpGlyGlyCysGlyAspAsnThrAlaTyrAlaTyrArg
180185190
ttcgctaaagcatttattgatgttagagaaaaggagcaaagttatccc805
PheAlaLysAlaPheIleAspValArgGluLysGluGlnSerTyrPro
195200205
agacattctaatgaattggcgcgcatgttaatgaatttacataataat853
ArgHisSerAsnGluLeuAlaArgMetLeuMetAsnLeuHisAsnAsn
210215220
agagcaggtcgtttggctgtctacaagttagcttctgtagcatgtaaa901
ArgAlaGlyArgLeuAlaValTyrLysLeuAlaSerValAlaCysLys
225230235240
tgtcatggtgtttccggatcatgcagtttaagaacatgttggacacaa949
CysHisGlyValSerGlySerCysSerLeuArgThrCysTrpThrGln
245250255
ttatcaccattcacacgtattggtcgttatcttcgtcaaggttatgat997
LeuSerProPheThrArgIleGlyArgTyrLeuArgGlnGlyTyrAsp
260265270
gaagctgttaaagtgaaattcaacagacgtggaacaaaactacgccgt1045
GluAlaValLysValLysPheAsnArgArgGlyThrLysLeuArgArg
275280285
gccagtagacaattacgtcgtgtcacaccagatcatattacatattta1093
AlaSerArgGlnLeuArgArgValThrProAspHisIleThrTyrLeu
290295300
gacgaatcatcaaattattgtgaatatgatccaattactcagagtcca1141
AspGluSerSerAsnTyrCysGluTyrAspProIleThrGlnSerPro
305310315320
ggtacaagaggtcgtgaatgtctaccaaatagtacagatcaagcaagt1189
GlyThrArgGlyArgGluCysLeuProAsnSerThrAspGlnAlaSer
325330335
tgtgctacactttgttgtaatcgtggctcacaatcacaattacgtgag1237
CysAlaThrLeuCysCysAsnArgGlySerGlnSerGlnLeuArgGlu
340345350
gtacatgaaaaatgtcattgccaatttaattggtgttgtcgcgttgag1285
ValHisGluLysCysHisCysGlnPheAsnTrpCysCysArgValGlu
355360365
tgtcaaacatgtgttaaaacagaagagtatcatgtatgtaattga1330
CysGlnThrCysValLysThrGluGluTyrHisValCysAsn
370375380
ggtgaattacagttgattacataacatattattgcagcattttgtctaatgaagtataca1390
tatatatatatatatcttcataacttcattctttttttctgacttatctgatgttttctt1450
acgaatttctacctcattatcataagcaatttttatgttgacaaaagttttaccaatgaa1510
gaatgtcatacattatgtaatgaatttagtactggatcgttcagattgatgaagtaatta1570
tttaactgataacaattattcagtcgtatgtttaaatgtggcagcatgatttctacagtt1630
aactaaccaaagtttattatatcaccaacgtgatcgttcagactttcccccctccctccg1690
tcgtccttcaaagtttattaaaatacaatacaatacaattcagtgttctggcatcaatct1750
aatatatacatcattgaaatagataaaacaaataaacatgtactattcataatatctatc1810
gtttctcagtaatctataataacttttttcaagaaaaaataattaacccaaacgtaccca1870
tattacttgcagatactattaataaactatgatttttattatgatatttttaaaaaaaaa1930
aaaaaaaaaaaaaaaaaaaaaaaa1954
<210>3
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(21)
<223> primer
<400>3
cgatttagacattggaattgc21
<210>4
<211>24
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
<223> primer
<400>4
tccagaaacaccatgacatttaca24
<210>5
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>5
attgcatgagcgaagccagcctcac25
<210>6
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>6
tgctgaagcatcattgacagaactg25
<210>7
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>7
gattggatatggggtggttgtggag25
<210>8
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>8
agcaggtcgtttggctgtctacaag25
<210>9
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>9
ttcttaacagctaaatacatgattg25
<210>10
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>10
atcatagtttattaatagtatctgc25
<210>11
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>11
ctcagagtccaggtacaagaggtcg25
<210>12
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>12
gacactcaacgcgacaacaccaatt25
<210>13
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>13
cttagttggtggagcgatttgtctg25
<210>14
<211>25
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(25)
<223> primer
<400>14
cgaccacactactccataaagaagc25
<210>15
<211>33
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(33)
<223> primer
<400>15
gtggatccccactatgtttacgtgttcaaggtt33
<210>16
<211>33
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(33)
<223> primer
<400>16
gtctcgagataaccttgacgaagataacgacca33