CN103966211A - Protein originated from rice and application of coding gene of protein - Google Patents

Abstract

The invention discloses a protein originated from rice and application of a coding gene of the protein. The application comprises a method for breeding a transgenic plant capable of realizing precocious flowering. The method comprises a step of reducing expression of FRRP1 in a receptor plant so as to obtain a transgenic plant whose flowering time is earlier than that of the receptor plant, wherein FRRP1 is a protein shown in a) or b): a) a protein with an amino acid sequence represented by SEQ ID No. 2; and b) a protein derived from a) through substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence represented by SEQ ID No. 2 and related to flowering of plants. The protein and the gene provided by the invention can be used for creation of novel precocious varieties of rice.

Description

Derive from the application of protein and the encoding gene thereof of paddy rice

Technical field

The present invention relates to derive from the application of protein and the encoding gene thereof of paddy rice.

Background technology

The growing of plant is divided into nourishes and grows and two stages of reproductive growth, and wherein reproductive growth has determined the solid of most green plantss and breeding.And bloom, it is a most important ring in reproductive growth.In long-term evolutionary process, each kind of plant has the blooming cycle of oneself, and the specified time in a year is bloomed to its important meaning that successfully produces offspring.

For agriculture production, various crops can bloom in good time, solid the stable of grain yield that guaranteed of success.China is vast in territory, various farm crop on the adaptation of each Climate affected to a certain extent various places improved seeds to the tune kind of other regions, introduce a fine variety etc.The large scale application of some improved seeds is produced to obstacle.

Therefore, many researchers, agricultural breeding scholar etc. wish can the artificial reforming flowering of plant time, breaks regional limits, allows excellent kind of breeding better by agriculture production, be applied.By molecular breeding means, changing the flowering of plant time is a kind of more directly more directed method, has become focus and the focus of research now.

Paddy rice is one of important food crop of the mankind, and cultivating with edible history of it is all very long.Approximately there is the edible rice of population of half in the whole world now.Northern China wide geographic area Rice Cropping is longer breeding time, and heading is bloomed more late, and while causing gathering in the crops, temperature is too low and affect output.Therefore the breeding cycle of Study On Rice, excavates the gene relevant to flowering time for the new variety of cultivating high-quality precocity, has important biological significance and economic worth.

Summary of the invention

Technical problem to be solved by this invention is to provide the new purposes of the protein FRRP1 and the coding nucleic acid molecule that derive from paddy rice, described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein.

A kind of new purposes provided by the present invention is to utilize the method for the coding nucleic acid molecule cultivation transgenic plant of FRRP1.

The method of cultivation provided by the present invention transgenic plant is the method for cultivating the transgenic plant of Blooming, and it comprises and reduces in recipient plant FRRP1 or FRRP1 genetic expression obtains the transgenic plant that bloom early than described recipient plant; Described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein.

Wherein, SEQ ID No.2 is comprised of 844 amino-acid residues.

In aforesaid method, can disturb or gene silencing or antisense technology reduce the expression of FRRP1 in recipient plant or FRRP1 gene by RNA.

In a specific embodiment of the present invention, in described reduction recipient plant, FRRP1 expresses by the DNA fragmentation as shown in the formula shown in I imported and realizes in object plant:

SEQ _forward-X-SEQ _oppositely

（I）

Described SEQ _forwardbe selected from SEQ ID No.1 and comprise the 1641-2140 position Nucleotide of SEQ ID No.1;

Described SEQ _oppositelysequence and described SEQ _forwardsequence reverse complemental;

Described X is described SEQ _forwardwith described SEQ _oppositelybetween intervening sequence, in sequence, described X and described SEQ _forwardand described SEQ _oppositelyall not complementary.

In one embodiment of the invention, described SEQ _forwardnucleotide sequence be the 1641-2140 position Nucleotide of SEQ ID No.1.

In described reduction recipient plant, FRRP1 expresses by following recombinant expression vector pTCK303-FRRP1 is imported in described recipient plant and realized: by fragment between the Spe I of the 1641-2140 position Nucleotide replacement carrier pTCK303 of SEQ ID No.1 and Sac I site, recombinant vectors in the middle of the recombinant vectors obtaining is denoted as; Fragment between the KpnI of recombinant vectors and BamHI site in the middle of DNA replacement shown in the reverse complementary sequence of the 1641-2140 position Nucleotide of SEQ ID No.1 is described, the recombinant vectors pTCK303-FRRP1 obtaining.

In aforesaid method, described recipient plant can be monocotyledons or dicotyledons.Described monocotyledons can be paddy rice.

The application of above-mentioned FRRP1 in regulating plant flowering time, and the application of following at least one biomaterial in regulating plant flowering time all belongs to protection scope of the present invention:

1) coding FRRP1 nucleic acid molecule, described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein;

2) contain 1) expression cassette of described nucleic acid molecule;

3) contain 1) carrier of described nucleic acid molecule;

4) sequence and the 1) nucleic acid molecule of described nucleic acid molecule reverse complemental;

5) contain sequence and 1) expression cassette of the nucleic acid molecule of described nucleic acid molecule reverse complemental;

6) contain sequence and 1) carrier of the nucleic acid molecule of described nucleic acid molecule reverse complemental;

7) nucleotide sequence is the DNA molecular of the 1641-2140 position Nucleotide of SEQ ID No.1;

8) contain 4) expression cassette of described nucleic acid molecule;

9) contain 4) carrier of described nucleic acid molecule.

Wherein, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.

Above-mentioned 1) coding FRRP1 nucleic acid molecule specifically can be following 1) or 2) or 3) or 4) shown in gene:

1) the encode DNA molecular of described FRRP1;

2) its encoding sequence is the DNA molecular of SEQ ID No.1;

3) under stringent condition with 1) DNA molecule hybridize limiting and the DNA molecular of coding FRRP1;

4) with 1) DNA molecular that limits has more than 90% homology and the DNA molecular of coding FRRP1.

Above-mentioned stringent condition can be with 6 * SSC, the solution of 0.5%SDS, and at 65 ℃, hybridization, then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively washes film once.

Wherein, SEQ ID No.1 is comprised of 2535 Nucleotide, and its encoding sequence is 1-2535 position, the protein shown in coding SEQID No.2.

In above-mentioned biomaterial, contain 1) expression cassette of described nucleic acid molecule, refer to the DNA that can express FRRP1 in host cell, this DNA not only can comprise the promotor that starts FRRP1 genetic transcription, also can comprise and stop the terminator that FRRP1 transcribes.Further, described expression cassette also can comprise enhancer sequence.Described carrier can be cloning vector and also can be expression vector.

In above-mentioned biomaterial, 8) contain 4) expression cassette of the described nucleic acid molecule Ubi-1 that specifically can be above-mentioned recombinant vectors pTCK303-FRRP1 start and NOS terminator between DNA fragmentation (comprising that Ubi-1 starts and NOS terminator); 9) containing 4) carrier of described nucleic acid molecule specifically can be above-mentioned recombinant vectors pTCK303-FRRP1.

In above-mentioned application, described plant can be monocotyledons or dicotyledons; Described monocotyledons specifically can be paddy rice.

Described carrier can be by being used Ti-plasmids; plant virus carrying agent; directly delivered DNA; microinjection, the conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998; Method for Plant MolecularBiology VIII; Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, PlantMolecular Biology (2nd Edition).

Described transgenic plant are interpreted as and not only comprise the first-generation transgenic plant that described gene transformation recipient plant is obtained, also comprise its filial generation.For transgenic plant, can in these species, breed this gene, also available traditional breeding method enters this transgenosis other kind of same species, in commercial variety.Described transgenic plant comprise seed, callus, whole plant and cell.

Experiment showed, that transfer-gen plant that FRRP1 genetic expression reduces and transgenosis not contrasts Japanese fine plant and compare, remarkable the shifting to an earlier date that bloom, flowering time shifts to an earlier date 23-26 days.The precocious new variety initiative of the present invention to paddy rice, and Rice Production has great importance.

Accompanying drawing explanation

Fig. 1 is the electrophorogram of the paddy rice FRRP1 gene that arrives of pcr amplification.

Fig. 2 is that interference carrier pTCK303-FRRP1 builds schema.

Fig. 3 is the acquisition of Agrobacterium-mediated Transformation Rice Callus regeneration plant.

A: subculture callus; B: resistant calli screening; C: resistant calli breaks up in advance; D: resistant calli differentiation; E: resistant calli is divided into seedling; F: regrowth root induction; G: regrowth hardening; H: transgenic seedling is planted in greenhouse.

Fig. 4 is T ₁pCR for transgenic rice plant detects.

16 is 1kb DNA ladder; 1 is the PCR product (positive control) of plasmid pTCK303-FRRP1; 2 is unconverted paddy rice PCR product (negative control); 3-15 is for turning pTCK303-FRRP1 paddy rice PCR product.

Fig. 5 is T ₃pCR for transgenic rice plant detects.

1 is 1kb DNA ladder; 2: be unconverted paddy rice PCR product (negative control); 3: be the PCR product (positive control) of plasmid pTCK303-FRRP1; 4-9: for turning pTCK303-FRRP1 paddy rice PCR product.

Fig. 6 is T ₃the active detection of GUS for transgenic paddy rice young root.

A is transgenic paddy rice young root not; B-c is for turning pTCK303-FRRP1 paddy rice young root

Fig. 7 is that paddy rice FRRP1 gene is at T ₃in generation, turns the expression analysis in pTCK303-FRRP1 strain.

Fig. 8 is that transgenic paddy rice is cultivated the Phenotypic Observation result to 105 days.

A: experimental plot; B: individual plant.

Embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.

In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.

PTCK303(ZHEN WANG.et al.A Practical Vector for EfficientKnockdown of Gene Expression in Rice (Oryza sativa L.) .Plant Molecular BiologyReporter22:409-417 in following embodiment, December2004) and paddy rice Japan fine (hair is for army building etc. the screening of rice varieties Japan fine japonica rice group training substratum and turn the acquisition of rice blast fungus albumen exciton gene plant. the 05th phase of Journal of Agricultural Biotechnology .2008) public Ke Cong China Agricultural University obtains, in order to repeating related experiment of the present invention.

The expression of embodiment 1, the fine middle FRRP1 gene of reduction Japan obtains the transgenic paddy rice in advance of blooming

1, the acquisition of paddy rice FRRP1 albumen and encoding gene thereof

By TRIzol method, extract the total RNA of Japanese fine rice leaf, 2% agarose gel electrophoresis proves its integrity and pollutes without DNA, good with integrity, free of contamination RNA is template, with M-MLV enzyme (purchased from TaKaRa bio-engineering corporation), reverse transcription RNA is cDNA, by Invitrogen company synthetic primer to (P1:FRRP1-F:5 '-ATGGATGCCG CAGCTCTTCA-3 ' and FRRP1-R:5 '-TCAGATCTTCACCTCCCGAA-3 '), take rice cDNA as template, carry out pcr amplification, the pcr amplification product obtaining is carried out to agarose gel electrophoresis detection (Fig. 1), obtain the object band of 2535bp, reclaim object band, connect and reclaim product on pMD18-T simple vector, transform bacillus coli DH 5 alpha competent cell, extract plasmid sequence verification.Sequencing result shows, the nucleotide sequence of this PCR product is SEQ ID No.1.SEQ ID No.1 is the encoding sequence of FRRP1, the protein FRRP1 of encoding amino acid sequence as shown in SEQ ID No.2 in sequence table.

2, the structure of pTCK303-FRRP1 composing type interference carrier

PTCK303-FRRP1 reduces acceptor paddy rice---the interference carrier of the encoding gene expression of the FRRP1 shown in the SEQ ID No.2 in Japanese fine paddy rice.The construction process of pTCK303-FRRP1 is as follows:

1, FRRP1 gene fragment---the clone of FRRP1-F and FRRP1-R:

Primer pair P2:RNAi_F by the synthetic amplification FRRP1-F of Invitrogen company ₁1641-2140:5 '-at gAGCTCaAAAGCAGCAAATGAAGCGG-3 ' and RNAi_R ₁1641-2140:5 '-at aCTAGTcCTTCTCTGC ATCTGATACC-3 '; And the primer pair P3:RNAi_F of amplification FRRP1-R ₂1641-2140:5 '-at gGATCCaAAAGCAGCA AATGAAGCGG-3 ' and RNAi_R ₂1641-2140:5 '-at gGTACCcCTTCTCTGC ATCTGATACC-3 '.The GAGCTC that wherein underscore indicates is Sac I restriction enzyme site, and ACTAGT is Spe I restriction enzyme site; GGATCC is BamHI restriction enzyme site, and GGTACC is Kpn I restriction enzyme site.The fine rice cDNA of Japan of take is template, carries out pcr amplification respectively with P2 and P3.The fragment obtaining is inserted respectively to pMD18-T simple carrier (purchased from TaKaRa bio-engineering corporation), obtain carrier pMD18-T simple-FRRP1-F and pMD18-T simple-FRRP1-R, through sequence verification, the fragment FRRP1-F obtaining and FRRP1-R all have the 1641-2140 position nucleotide sequence of SEQ ID No.1.

2, the structure of interference carrier pTCK303-FRRP1: by Spe I and Sac I double digestion carrier pMD18-Tsimple-FRRP1-F, Kpn I and BamH I double digestion carrier pMD18-T simple-FRRP1-R, reclaim respectively target fragment FRRP1-F and FRRP1-F, fragment FRRP1-F is connected with the carrier pTCK303 cutting with Sac I enzyme through Spe I (Institute of Botany, Chinese Academy of Sciences plants health teacher and is so kind as to give), obtain intermediate carrier pTCK303-FRRP1-F, after checking intermediate carrier pTCK303-FRRP1-F is correct, again fragment FRRP1-R is connected with the intermediate carrier pTCK303-FRRP1-F cutting with BamH I enzyme through Kpn I, obtain final interference and carry pTCK303-FRRP1.Expression vector builds in detail as Figure of description Fig. 2.

3, pTCK303-FRRP1 composing type interference carrier agrobacterium-mediated transformation rice transformation

The preparation of Agrobacterium competent cell: picking agrobacterium tumefaciens EHA105(microbiotic suppresses the effect of Agrobacterium and the impact that yezoensis laver is grown, the aquatic sciences such as Wang Ping, 2009 28 (7), public Ke Cong China Agricultural University obtains) single colony inoculation is in 100ml YEP liquid nutrient medium, and 220rpm28 ℃ of shaking culture is to OD ₆₀₀=0.5; Proceed to aseptic centrifuge tube, the centrifugal 5min of 5000rpm, removes supernatant, adds the CaCl of the 0.15M of 10ml precooling ₂solution, suspension cell, places 20min on ice gently; 4 ℃, the centrifugal 5min of 5000rpm, removes supernatant, adds the CaCl of the 0.15M containing 10% glycerine of 4ml precooling ₂solution, suspends gently; Agrobacterium suspension is sub-packed in sterile eppendorf tubes, and every pipe 200 μ l quick-frozen 1min in liquid nitrogen is frozen in-70 ℃.

Expression vector transforms Agrobacterium EHA105: the expression vector pTCK303-FRRP1 that gets 1 μ g joins in 200 μ l EHA105 competent cells, mixes static 5min; Quick-frozen 1min in liquid nitrogen, 42 ℃ of water-bath 5min, add 1ml YEP liquid nutrient medium, 28 ℃ of 180rpm shaking culture 4h; The centrifugal 5min of 5000rpm, abandons supernatant, adds 0.1ml YEP liquid nutrient medium, Eddy diffusion cell; Coat on the YEP solid plate containing 50 μ g/ml Kan and 50 μ g/ml Rifampins, cultivate about 48h for 28 ℃.PCR identifies positive colony, identifies that the primer is to P2:RNAi_F ₁1641-2140:5 '-at GAGCTC AAAAGCAGCAAATGAAGCGG-3 ' and RNAi_R ₁1641-2140:5 '-at ACTAGT CCTTCTCTGC ATCTGATACC-3 '.Result shows that carrier pTCK303-FRRP1 successfully proceeds in agrobacterium tumefaciens EHA105.Obtain the restructuring Agrobacterium EHA105/pTCK303-FRRP1 that contains pTCK303-FRRP1.The restructuring Agrobacterium EHA105/pTCK303 that preparation contains pTCK303 according to the method described above simultaneously.

Rice transformation: EHA105/pTCK303-FRRP1 or EHA105/pTCK303 are inoculated in the YEP liquid nutrient medium of 10ml containing 100 μ g/mlKan and 50 μ g/ml Rifampins, and 28 ℃, 200rpm shaking culture is spent the night; Transform and with 1:50 proportional concentration, to be inoculated in 200ml the day before yesterday and to cultivate 36h containing in identical antibiotic YEP substratum, 5000rpm, the centrifugal collection of 5min bacterium, thalline is suspended in and is added with AS(Syringylethanone) in the AAM liquid nutrient medium of 100 μ M, shaking culture 24h on 28 ℃, the shaking table of 220r/min, adjusts concentration to OD ₆₀₀=1.5～2.0, be the agrobacterium suspension that common cultivation rice transformation is used, the fine callus of rice transformation Japan.Concrete grammar is: by succeeding transfer culture 5-7 days, the yellowish fine callus of paddy rice Japan of color and luster is put into the aseptic triangular flask of 100ml, add 20ml agrobacterium suspension, slightly shake rear standing 30min, after callus is placed on aseptic filter paper, in Bechtop, dry up 30min, the common cultivation that finally callus is placed in to interpolation 100 μ M AS (Syringylethanone) is cultivated and (on pH5.2 base, is secretly cultivated 3d for 25 ℃.

The screening of resistant calli: the callus after picking is cultivated is altogether in aseptic triangular flask, by sterile water wash to till there is no the thread thalline of visible in water, then proceed in the sterilized water containing 250mg/L Pyocianil and soak 60min, on aseptic filter paper, dry.Be transferred to and select substratum (NB+300mg/L Hydrolysates of Casein+500mg/L proline(Pro)+30g/L sucrose+12g/L agar+2mg/L2,4-D+100uM AS+250mg/L Pyocianil+30mg/L Totomycin; PH5.8-5.9) upper screening resistant calli.

Resistant calli subculture: callus was transferred on new selection substratum in every two weeks, subculture adds selection substratum ((NB+300mg/L Hydrolysates of Casein+500mg/L proline(Pro)+30g/L sucrose+12g/L agar+2mg/L2, the 4-D+100uM AS+250mg/L Pyocianil+50mg/L Totomycin of 50mg/L Hyg more for the second time; PH5.8-5.9)) upper, approximately needing three weeks is that visible warty resistant calli grows from shrivelled callus.Within every two weeks, subculture is in selecting on substratum (can not add Pyocianil).

Resistant calli differentiation: the part that can select kanamycin-resistant callus tissue after callus is grown up is transferred to division culture medium (NB+300mg/L Hydrolysates of Casein+500mg/L proline(Pro)+30g/L sucrose+12g/L agar+2mg/L2, the 4-D+10mg/LKT+0.4mg/LNAA pouring in tissue culture bottle; PH5.8-5.9) upper, can place the same clone's of 4-5 piece callus in every bottle, two weeks afterwards callus start to turn green, after three weeks, can put out new shoots, root also grows subsequently.

Take root: seedling is transferred to root media (1/2MS+30g/L sucrose+12g/L agar+30g/L hygromycin B; PH5.8-5.9) upper, every pipe 1 clone, after seedling takes root and grows up to, shifts out, and cleans after the substratum on root, moves to greenhouse pot culture, as Figure of description Fig. 3.

4, rice transformation offspring's screening

The triage techniques of Transgenic Rice (one) PCR detects: the transgenic paddy rice T1 of take is template for plant genomic dna, the positive contrast of plasmid pTCK303-FRRP1, the negative contrast of genomic dna of unconverted paddy rice, by Invitrogen company synthetic primer to P4(RNAi_F ₁1641-2140:5 '-at GAGCTC AAAAGCAGCAAATGAAGCGG-3 ', and RNAi_303F:5 '-at TGAAAATCTC GAAACAGCCGTGTCATAGTC-3 '), the object fragment of pcr amplification 978bp.In primer pair P4, primed RNA i_F ₁1641-2140 is in gene FRRP1500bp sequence, and primed RNA i_303F is in carrier pTCK303Intron sequence.

Reaction system (cumulative volume 50 μ l):

PCR response procedures is: the first round: 95 ℃ of sex change 5min; Second takes turns: 95 ℃ of sex change 50sec, and 54 ℃ of reaction annealing temperatures, 50sec, 72 ℃ are extended 60sec, 35 circulations; Third round: 72 ℃ are extended 10min.After reaction finishes, 1.0% agarose gel electrophoresis detected result.

Result shows: at 13 strain T ₁for there being 8 strains to amplify the object band of 978bp in transfer-gen plant, consistent with positive control (pTCK303-FRRP1 plasmid) stripe size, negative control (not transgenic paddy rice) does not amplify object band, as Figure of description Fig. 4.

In order to detect transgenosis whether can genetic stability to Rice Offspring, by T ₀seed (the T tying for transgenic positive plant ₁generation) plant the transgenosis Special test field in standard, have good isolation strip around.Results T ₁seed (the T tying for plant ₂generation), after detection by T ₂for positive plant, plant equally in above-mentioned transgenosis Special test field results T ₂seed (the T tying for plant ₃generation) plant equally in above-mentioned transgenosis Special test field, at T ₃for respectively extracting at random three individual plants in transgenic line Line1 (L1) and Line4 (L4), use CTAB method from 6 transgenosis T ₃in rice leaf for individual plant, extract genomic dna, respectively with primer pair (P4:RNAi_F ₁1641-2140:5 '-at GAGCTCAAAAGCAGCA AATGAAGCGG-3 ' and RNAi_303F:5 '-at TGAAAATCTCGAAACAGCCG TGTCATAGTC-3 ') the goal gene fragment of pcr amplification 978bp.Result shows: six T ₃the transgenosis individual plant in the generation object band that can increase, as Figure of description Fig. 5, illustrate transgenosis can genetic stability to T ₃generation.

The triage techniques of Transgenic Rice (two) GUS staining examine:

Being formulated as follows of GUS staining fluid:

The plant of needs dyeing is dipped into the 1-24h that dyes in 37 ℃ of dark in X-Gluc solution, until there is Bluepoint.Then with phosphoric acid buffer, rinse once, use afterwards 2%(v/v) formaldehyde, 0.5%(v/v) the fixing 50min of glutaraldehyde, 100mM phosphoric acid buffer room temperature, use again (v/v) each 5min of rinsing of series concentration ethanol (50%, 70%, 100%), finally be immersed in 75%(v/v) decolour in ethanol, until background color is sloughed.

By T ₃for transgenic line L1 and L4, and the tip of a root of non-transgenic contrast paddy rice (Japan is fine) dyes with GUS staining fluid, until there is blueness, then decolour with the ethanol of different concns gradient, observe and take pictures, as Figure of description Fig. 6.Result shows that contrasting paddy rice with non-transgenic compares, and the young root of two transgenic paddy rice strains can show blueness, illustrates that interference carrier pTCK303-FRRP1 has successfully proceeded to transgenic paddy rice, gus gene normal expression.

Real-time PCR detects:

(1) rice cDNA is synthetic

Good, the free of contamination RNA of the integrity of take is template, and with M-MLV enzyme (purchased from TaKaRa bio-engineering corporation), reverse transcription RNA is cDNA.

(2) transfer-gen plant fluorescence quantitative PCR detection

Using paddy rice housekeeping gene polyubiquitin as reference gene.

1) the primer

FRRP1 detects primer: FRRP1-qPCR-F:5 '-TGGAGCTAGA GCGTGAGAGA-3 ',

FRRP1-qPCR-R：5’-ATGGCGAGCA GAATAAGTGG-3’；

Ubiquitin detects primer: pUbi-F:5 '-CTGATGTCTACTTGTGTCT-3 ',

pUbi-R：5’-CAACTTATTCATAAAGCATACTG3’。

2) Real-time PCR reaction system (cumulative volume 20 μ L):

95 ℃ of 30s of denaturation; 95 ℃ of 10s of amplified reaction, 60 ℃ of 30s, gather fluorescence information, 40 circulations of increasing; 95 ℃ of 10s; Solubility curve 65-95 ℃, gathers fluorescence information.

3) Real-time PCR product detects

Get 10 μ L PCR products, use 1% agarose gel electrophoresis, electrophoresis 30min under 4V/cm condition, EB dyeing, gel image analysis system log (SYSLOG) result, reclaims product, the order-checking of Bing Song company.

4) data processing

All data are carried out data analysis processing by Bio-Rad CFX Manager.

By TRIzol method, extract the T that turns pTCK303-FRRP1 strain L1 and L4 ₃for plant and the total RNA of transgenosis Japan fine (WT) not, DNA is removed in the digestion of DNase I, and 2% agarose gel electrophoresis detects RNA sample molecule integrity and DNA pollution condition, with NanoDrop-1000 trace ultraviolet spectrophotometer, measures RNA concentration.Get the total RNA of plant that 2 μ g pollute without DNA and carry out reverse transcription, take reverse transcription product as template, with the primers F RRP1-qPCR-F of the primer pUbi-F of housekeeping gene polyubiquitin and the gene of pUbi-R and paddy rice FRRP1 and FRRP1-qPCR-R primer, carry out Real-time PCR FRRP1 gene is carried out to expression characteristic analysis, as Figure of description Fig. 7.With contrast not fine the comparing of transgenosis Japan, in transgenic line L1, the relative expression quantity of FRRP1 has declined 2.3 times, in transgenic line L4, the relative expression quantity of FRRP1 has declined 1 times, the expression of FRRP1 gene in transgenic line of result proof is disturbed.

In addition, according to the method described above, pTCK303 is imported to Japan fine, obtain T ₂in generation, turns the seed (T that the fine paddy rice of pTCK303 Japan is tied ₃in generation, turns pTCK303 strain), the transgenic paddy rice phenotype analytical of following step 5.

5, transgenic paddy rice phenotype analytical: on May 4th, 2012 is at aforementioned transgenosis Special test field plantation T ₃for transfer-gen plant (L1, L4 and turn pTCK303 empty carrier strain CK) and transgenosis adjoining tree (WT, transgenosis Japan is not fine) not.The 7-9 month is instituted an inquiry the flowering time that records paddy rice, and as Figure of description Fig. 8, wherein, the standard of blooming refers to 2 centimetres of paddy rice the first branch heading.After all heading has been bloomed, statistics flowering time.Adopt SPSS17.0 statistical software to analyze, between group, relatively adopt one-way analysis of variance, comparing difference significance.

The statistics of all strain flowering times shows that transfer-gen plant flowering time and the difference of transgenosis adjoining tree not reach extremely significantly (p≤0.01) (table 1), wherein, L4 strain flowering time not fine 26 days in advance than the Japan of transgenosis, L1 strain flowering time was than fine 23 days in advance of transgenosis Japan.T ₃generation turn the flowering time of pTCK303 strain with transgenosis adjoining tree (CK, transgenosis Japan is not fine) not without significant difference.

Table 1. strain flowering time

^*: compare difference extremely significantly (p≤0.01) with control group

Claims (10)

1. cultivate the method for the transgenic plant of Blooming, comprise that reducing FRRP1 expression in recipient plant obtains flowering time early than the transgenic plant of described recipient plant; Described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein.

2. the method for claim 1, is characterized in that: in described reduction recipient plant, to express be by the DNA fragmentation as shown in the formula shown in I is imported in object plant and realized to FRRP1:

SEQ _forward-X-SEQ _oppositely

（I）

Described SEQ _forwardbe selected from SEQ ID No.1 and comprise the 1641-2140 position Nucleotide of SEQ ID No.1;

Described SEQ _oppositelysequence and described SEQ _forwardsequence reverse complemental;

Described X is described SEQ _forwardwith described SEQ _oppositelybetween intervening sequence, in sequence, described X and described SEQ _forwardand described SEQ _oppositelyall not complementary.

3. method as claimed in claim 2, is characterized in that: described SEQ _forwardnucleotide sequence be the 1641-2140 position Nucleotide of SEQ IDNo.1.

4. as the method as described in arbitrary in claim 1-3, it is characterized in that: described recipient plant is monocotyledons or dicotyledons.

5. method as claimed in claim 4, is characterized in that: described monocotyledons is paddy rice.

The application of 6.FRRP1 in regulating plant flowering time; Described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein.

7. application as claimed in claim 6, is characterized in that: described plant is monocotyledons or dicotyledons.

8. application as claimed in claim 7, is characterized in that: described monocotyledons is paddy rice.

9. the application of following at least one biomaterial in regulating plant flowering time:

1) coding FRRP1 nucleic acid molecule, described FRRP1 be following a) or b) protein:

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to flowering of plant by a) derivative protein;

2) contain 1) expression cassette of described nucleic acid molecule;

3) contain 1) carrier of described nucleic acid molecule;

4) sequence and the 1) nucleic acid molecule of described nucleic acid molecule reverse complemental;

5) contain sequence and 1) expression cassette of the nucleic acid molecule of described nucleic acid molecule reverse complemental;

6) contain sequence and 1) carrier of the nucleic acid molecule of described nucleic acid molecule reverse complemental;

7) nucleotide sequence is the DNA molecular of the 1641-2140 position Nucleotide of SEQ ID No.1;

8) contain 4) expression cassette of described nucleic acid molecule;

9) contain 4) carrier of described nucleic acid molecule.

10. application as claimed in claim 9, is characterized in that: described plant is monocotyledons or dicotyledons; Described monocotyledons specifically can be paddy rice.