CN103954767B - The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer - Google Patents
The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer Download PDFInfo
- Publication number
- CN103954767B CN103954767B CN201410131478.8A CN201410131478A CN103954767B CN 103954767 B CN103954767 B CN 103954767B CN 201410131478 A CN201410131478 A CN 201410131478A CN 103954767 B CN103954767 B CN 103954767B
- Authority
- CN
- China
- Prior art keywords
- trim59
- cell
- expression
- cancer
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57446—Specifically defined cancers of stomach or intestine
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7023—(Hyper)proliferation
- G01N2800/7028—Cancer
Abstract
The present invention relates to the novelty teabag of TRIM59 albumen, be specifically related to TRIM59 albumen and preparing application in curing gastric cancer medicine in the application prepared in stomach cancer diagnosis reagent and TRIM59 albumen as therapeutic targets as diagnosing gastric cancer mark.Present invention demonstrates that TRIM59 can as the diagnosis marker of cancer of the stomach and therapeutic targets, early diagnosis can be carried out to cancer of the stomach by the expression detecting TRIM59, thus TRIM59 being carried out as drug targets the cure rate that adjuvant clinical operative treatment improves Patients with Gastric Cancer by suppressing the expression of TRIM59, improving the quality of life of patient.
Description
Technical field
The present invention relates to a kind of diagnosing gastric cancer mark and therapeutic targets.
Background technology
Cancer of the stomach is the fourth-largest common types of cancer in world wide, and cause the deputy cancer types of human death, even more serious in Asia.Cancer of the stomach causes one of malignant tumour that China's death toll is maximum, and account for the significant proportion of world's cancer of the stomach generation case, and in the malignant tumour of stomach, it is also modal malignant tumour that gland cancer accounts for 95%, and even ranks first of all malignant tumours of the mankind.The cancer of the stomach incidence of China accounts for worldwide significant proportion.How asymptomatic early carcinoma of stomach is or only have light symptoms, and when symptom is obvious, pathology belongs to late period, constitutes great threat to the existence health of the mankind.
At present, the diagnosis of cancer of the stomach mainly relies on gastroscope, x-ray, several means such as ultrasonic, clinically mainly to lesion locations excision, result for the treatment of is reached by surgical resection art to the treatment of cancer of the stomach, find the effective ways of diagnosis of gastric cancer early, analyze the prognosis situation of patient according to the expression of mark, accordingly to target molecules, supplemental treatment is carried out at the enterprising hand-manipulating of needle in operating basis to patient and seem particularly important.
Early gastric caacer does not have manifest symptom, until when symptom is obviously diagnosed, generally reaches an advanced stage.And based on the cancer of the stomach anaphase of operation, though can mitigate the disease to a great extent, delay the deterioration of the state of an illness, not very good to the curative effect that the cancer of the stomach that invasion and attack are shifted occurs.
Though the operative effect of early carcinoma of stomach is better, nonoperative method also can be taked to cure some case, therefore except having regular physical checkups, also should try to explore other treatment method, or the comprehensive therapeutic plan based on operative treatment, to improve curative effect.Up to the present, a lot of biomarker all well can not be used as clinical diagnosis mark, only contributes to the prognosis and the chemotherapeutic efficacy that differentiate tumour.So also do not have good molecular diagnosis to identify auxiliary routine diagnosis inspection, and treat as therapeutic targets assisted surgery.
Find the protein marker of tumor tissue specificity high level expression, and using the target spot as diagnoses and treatment, be the active and effective supplementary means being recently considered to operative treatment.The generation development of tumour activates with some signal path specially, gene activation is relevant.The activation of some memebrane protein causes the activation of signal path, causes the activation of some gene further, maintains developing of tumour.Find (film) albumen of these differential expressions, in this, as the mark of diagnosing tumour.If there is the protein marker of concrete function, can closes/activate antibody (medicine) in conjunction with exploitation is specific, the activity of mark in directed interference/activated tumor tissue, reach more effective treatment tumour in conjunction with clinical operation treatment.
Summary of the invention
The object of the invention is to find a kind of new diagnosing gastric cancer mark and therapeutic targets and uses thereof.
In order to achieve the above object, the invention provides TRIM59 albumen and prepare the application in stomach cancer diagnosis reagent as diagnosing gastric cancer mark.
Present invention also offers TRIM59 albumen and prepare the application in curing gastric cancer medicine as therapeutic targets.
The present invention finds diagnosis marker and the therapeutic targets-TRIM59 of new gastric cancer tumor.The expression that TRIM59 matches well in right normal gastric mucosa in stomach organization obviously raises, at gastric carcinoma cell lines relative to immortalization gastric epithelial cell-GES-1 specificity high level expression TRIM59.TRIM59 is likely that one can be shuttled back and forth to nuclear albumen from cell membrane, and its expression follows the clinical symptoms of patient to have again very direct correlativity, and also has correlativity closely with operation prognosis situation.TRIM59 is high expressed in sdenocarcinoma of stomach, and the high level expression of TRIM59 can promote that sdenocarcinoma of stomach develops, and the expression of TRIM59 is with the clinical scale of patient's tumour, and infiltration degree and prognosis Survival have close relationship.Therefore TRIM59 can be used as clinical diagnosis mark, and as drug targets molecule, by suppressing the activity of TRIM59, can treat gastric cancer tumor in conjunction with clinical operation.
Compared with prior art, the invention has the beneficial effects as follows:
Late Cambrian of the present invention, TRIM59 can as the diagnosis marker of cancer of the stomach and therapeutic targets, early diagnosis can be carried out to cancer of the stomach by the expression detecting TRIM59, thus TRIM59 being carried out as drug targets the cure rate that adjuvant clinical operative treatment improves Patients with Gastric Cancer by suppressing the expression of TRIM59, improving the quality of life of patient.
Accompanying drawing explanation
Figure 1A is the expression figure being detected TRIM59 in organization chip by SABC;
Figure 1B is the signal intensity quantitative analysis results figure dyeed in unit area by Imageproplus software analysis TRIM59;
Fig. 1 C is the expression intensity analysis result figure of TRIM59 in the clinical scale situation integrated tissue of patient.
Fig. 1 D is the tumor-infiltrated degree of patient and the expression correlation analysis result figure of TRIM59.
Fig. 1 E is the correlation analysis result figure of TRIM59 expression and patient's prognosis Survival.
Fig. 1 F tests in detection 10 flesh tissue samples by westernblot, RT-PCR, the expression spirogram of TRIM59 protein level in paired sample (normal structure, tumor tissues).
Fig. 2 A is that RT-PCR to detect in clone TRIM59 relative to the expression figure of mRNA in GES-1;
Fig. 2 B is that westernblot detects the expression spirogram of TRIM59 on protein level in clone.
Fig. 3 A is the increment situation result figure of stable cell lines by MTS method detection cell of the slow virus foundation that transfection interference TRIM59 expresses in AGS;
Fig. 3 B is the increment situation result figure viral stable cell lines set up of the clone MKN45 transfection TRIM59 process LAN of the low expression of TRIM59 being detected to cell by MTS method.
Fig. 4 A is interference TRIM59AGS cell migration reduced capability figure;
Fig. 4 B is process LAN TRIM59MKN45 cell migration ability enhancing figure;
Fig. 5 A is that interference TRIM59AGS Cell clonality weakens figure;
Fig. 5 B is process LAN TRIM59MKN45 Cell clonality enhancing figure;
Fig. 6 A becomes knurl reduced capability figure in interference TRIM59AGS cell body;
Fig. 6 B becomes knurl ability enhancing figure in process LAN TRIM59MKN45 cell body;
Fig. 7 be become a cadre in ags cell wink disturb TRIM59 express slow virus after, utilize Anexin-V/PI to dye, by flow cytomery Apoptosis ratiometric result figure.
Above in each figure, * represents that p < 0.05, * * represents that p < 0.01, * * * represents p < 0.001.
Embodiment
The present invention is illustrated below in conjunction with embodiment.
Embodiment 1: SABC
1, experiment material:
10 routine flesh tissue samples (pairing normal gastric mucosa, stomach organization), 178 organization chips (purchased from Xinchao Biotech Co., Ltd., Shanghai, HStm-Ade178Sur-01); Primary antibodie is rabbit against human T RIM59 antibody (Abcam, article No. ab69639), and follow-up dyeing adopts GTVisionIII immunohistochemical kit (Shanghai Gene Tech. Company Limited).
2, experimental technique:
Many Different Individual tissue specimens are arranged on same microslide in regular array mode by organization chip exactly, carry out the original position Histological research of same index by immunohistochemical method.Concrete steps are:
1, will 178 organization chips in 4 DEG C of refrigerators be positioned over, and take out room temperature and place recovery room temperature, be placed in 56 DEG C of incubators bakings 20 minutes.Organization chip to be dipped in dimethylbenzene three times, each 5 minutes.Taking-up to be placed in 100% absolute ethyl alcohol twice, each 3 minutes; Insert 90%-70% alcohol at different levels successively each 3 minutes.3 times are rinsed, each 3 minutes with PBS.
2, organization chip (4%) paraformaldehyde immobile liquid is fixed 15 minutes, wash 3 times with PBS damping fluid, each 5 minutes.
3, antigen retrieval: expose antigenic determinant with 0.01M citrate solution, concrete steps are: use the extremely boiling in 3 minutes of micro-wave oven high fire heating 0.01M citrate solution, after 4 minutes, put into organization chip low fiery microwave twice again, each 1 minute (supplementing reparation liquid in time prevents the boiling of reparation liquid from overflowing).Be cooled to room temperature, wash 5 minutes with PBS damping fluid.With PBS damping fluid (pH=7.4) rupture of membranes 15 minutes containing 0.5%Triton, wash 3 times with PBS damping fluid (pH=7.4), each 5 minutes.
4, nonspecific proteins is closed
1) 3%H
2o
2-methyl alcohol (30%H
2o
210ml+ methyl alcohol 90ml) soaking at room temperature 30 minutes, eliminate Endogenous oxidative reductase.
2) tap water 10 minutes, PBS damping fluid soaks 3 times, each 3 minutes, sucks surplus liquid (not encountering tissue) with dust-free paper.
3) 10% lowlenthal serum is prepared with PBS damping fluid (pH=7.4).
4) on organization chip, drip 10% lowlenthal serum (using PBS buffer), be positioned in wet box and close heterogenetic antigen (200 microlitres/organization chip), room temperature 1 hour;
5, primary antibodie is hatched
With PBS buffer 1% lowlenthal serum, with 1% lowlenthal serum proportionally 1: the 400 dilution rabbit against human T RIM59 antibody of PBS buffer, get rid of 10% lowlenthal serum confining liquid on organization chip, dry around tissue with dust-free paper, directly add the TRIM59 antibody (about 100 μ l) that the rabbit of having diluted is anti-human, be placed in 4 DEG C, wet box and spend the night.Within second day, take out from refrigerator and need 37 DEG C of rewarmings 1 hour.
6, two anti-to hatch
1) primary antibodie is washed off, organization chip is inserted plastic slide frame, then wholely put into plastic casing, add PBS damping fluid and soak and wash 15 minutes 3 times.
2) with dust-free paper, the PBS damping fluid around organization chip is sucked, add two anti-(GTVisionTMIII type polymkeric substance) in incubated at room 30 minutes.Hatch complete, organization chip is inserted in PBS damping fluid, rinse 3 times, each 3 minutes, take out organization chip, get rid of and dry the liquid (tissue is sure not drying) around tissue, lying against in wet box.
3) ready developer DAB working fluid 80 microlitre is dripped, incubated at room 10 minutes, tap water color development stopping.
7, use haematoxylin redyeing nucleus, room temperature 30 seconds, within 1 hour, redye with tap water.
8, mounting: alcohol at different levels (70%-100%) dewater, every grade 3 minutes.Take out organization chip to insert in dimethylbenzene three times, each 5 minutes.Organization chip drips neutral resins with dropper, then covered, extrude gently with tweezers, and drive bubble away, leave standstill in fuming cupboard and dry up, microscopic examination, the expression of TRIM59 in more paired tumor tissues and adjacent cancer beside organism, result as shown in Figure 1A, (left side is cancer beside organism, right side is tumor tissues) by the signal intensity quantitative test in Imageproplus software analysis TRIM59 dyeing unit area, by t assay p=0.0204, result is as shown in Figure 1B.As can be seen from Figure 1A and Figure 1B, in stomach organization, the expression of TRIM59 is higher than the cancer beside organism of matching.
The expression intensity of TRIM59 in the clinical scale situation integrated tissue of patient is analyzed, result as shown in Figure 1 C, the expression of TRIM59 and the correlativity of clinical scale, p=0.0287.The tumor-infiltrated degree of patient and the expression correlativity of TRIM59 are analyzed, result as shown in figure ip, p=0.0044, the correlativity of TRIM59 expression and patient's prognosis Survival is analyzed, p=0.0223, Fig. 1 C-Fig. 1 E illustrates, the expression of TRIM59 and the clinical scale of patient, tumor-infiltrated degree, the prognosis of patient has certain correlativity.
Test in detection 10 flesh tissue samples by westernblot, RT-PCR, the expression of TRIM59 protein level in paired sample (normal structure, tumor tissues).Liquid nitrogen grinding tissue, extracts respectively by TRIzol (Invitrogen) and organizes RNA and RIPA (Thermo, 89901), add protease inhibitors and inhibitors of phosphatases (Thermo, 78410, thermo, 78420) extract histone.PrimeScriptRTreagentKitwithgDNAEraser (Takara) is utilized to carry out reverse transcription synthesis cDNA, by SYBRGreenPCRMasterMixkit (TakaraRR420A) quantitative reagent, ABI7900HT does internal reference Δ Δ ct method with the expression of GAPDH and carries out the expression that qRT-PCR detects gene; BCA (Thermo, 23227) is utilized to carry out quantitatively to albumen, by the expression of WB dyeing to the expression analysis destination protein of signal intensity comparison GAPDH.As shown in fig. 1f, the expression of TRIM59 in cancerous tissue higher than expression in the normal tissue, and has correlativity closely with clinical symptoms to experimental result.
Embodiment 2:Real-timePCR
Experiment material: fresh stomach organization sample, gastric carcinoma cell lines, MKN45, SGC7901, the gastric epithelial cell system GES-1 of 823, snu5, N87, AGS, Snu1 and immortalization.MKN45 (Bai Li bio tech ltd, Shanghai, MKN45), snu-5 (
cRL-5973
tM), snu-1 (
cRL-5971
tM); SGC7901, (article No. is TChu46, TChu11, TChu130, TChu7 respectively purchased from Chinese Academy of Sciences's cell bank for 823, N87, AGS; GES-1 is purchased from Fu Xiang bio tech ltd, Shanghai (GES-1).
Experimental procedure:
1, utilize the method for traditional Trizol-chloroform-isopropanol extracting RNA, by organizing freezing milling, the means such as lysis, the RNA in extracting tissue and cell.PrimeScriptRTreagentKitwithgDNAEraser (Takara) kit reverse transcription RNA is used to synthesize cDNA, further by SYBRGreen real-time quantitative RT-PCR technology (TakaraRR420A), detect tissue, the expression of TRIM59 gene on cellular level.Real_time quantitative detection PCR result on ABI7900HT quantitative PCR.
2, by Δ Δ ct method with the expression of the expression standardization TRIM59 gene of internal reference GAPDH.With the gastric epithelial cell GES-1 of normal immortalization in contrast, quantize the expression of TRIM59, result is as shown in Figure 2 A.
Detect the expression of TRIM59 on protein level in clone by westernblot, using GAPDH expression as internal reference, pass through Bio-RadQuantity
version4.1 software carries out signal strength analysis, and compare the expression change of TRIM59 on protein level, result as shown in Figure 2 B.
Found by westernblot, RT-PCR, along with the grade malignancy of cell raises, the mRNA of TRIM59, protein level has rising to a certain degree.
Embodiment 3 cell proliferation experiment
Experiment material:
Cell proliferation detecting kit CellTiter96AQueous (MTS) (Promega, G358A); Matrigel (BD, article No.: 356234).
Detected by the RT-PCR gene level in embodiment 2 and WB protein level, filter out the cell line AGS/MKN45cell of high/low expression, to the clone AGS/MKN45 cell chosen disturb respectively/process LAN experiment detects TRIM59 to the propagation of cell, migration, the impact that Clone formation and in-vivo tumour produce.
The method for building up of clone:
The source of AGS/MKN45 clone is with embodiment 2.
(1) design interference shRNA, interference contrast scramble, the process LAN TRIM59 of shRNA and the contrast Vector slow virus plasmid of process LAN TRIM59, be respectively used to packaging slow virus respectively transfection AGS/MKN45cell set up TRIM59 clone, the Vector clone of sh-TRIM59 clone (shRNA clone), scramble clone and MKN45 process LAN TRIM59.
Slow virus builds in interference: by two sections of sh-TRIM59 sequence (sh-TRIM59#1, sh-TRIM59#2), scramble control sequence clone is building up on Lentiviral pUCP, HEK293T slow virus packaging system is utilized to be packaged into slow virus, find that the jamming effectiveness of sh-TRIM59#1 is the highest through subsequent experimental checking, so final choice sh-TRIM59#1 slow virus is used for transfection ags cell to set up clone, sh-TRIM59#1 is all write sh-TRIM59 by back.Interference slow virus sh-TRIM59 is synthesized by Shanghai thinking enlightening Bioisystech Co., Ltd.Sh-TRIM59 interference sequence and scramble control sequence as follows:
Process LAN slow virus builds: be building up on Lentiviral pLV.Des2d.P/puro by TRIM59cDNA clone, utilize HEK293T slow virus packaging system, be packaged into slow virus and test for subsequent cell.We select empty carrier virus expression carrier plasmid to compare in addition, utilize HEK293T packaging system packaging virus for follow-up control experiment equally.
TRIM59cDNA sequence:
atgcacaattttgaggaagagttaacttgtcccatatgttatagtatttttgaagatcctcgtgtactgccatgctctcatacattttgtagaaattgtttggaaaacattcttcaggcatctggtaacttttatatatggagacctttacgaattccactcaagtgccctaattgcagaagtattactgaaattgctccaactggcattgaatctttacctgttaattttgcactaagggctattattgaaaagtaccagcaagaagaccatccagatattgtcacctgccctgaacattacaggcaaccattaaatgtttactgtctattagataaaaaattagtttgtggtcattgccttaccataggtcaacatcatggtcatcctatagatgaccttcaaagtgcctatttgaaagaaaaggacactcctcaaaaactgcttgaacagttgactgacacacactggacagatcttacccatcttattgaaaagctgaaagaacaaaaatctcattctgagaaaatgatccaaggcgataaggaagctgttctccagtattttaaggagcttaatgatacattagaacagaaaaaaaaaagtttcctaacggctctctgtgatgttggcaatctaattaatcaagaatatactccacaaattgaaagaatgaaggaaatacgagagcagcagcttgaattaatggcactgacaatatctttacaagaagagtctccacttaaatttcttgaaaaagttgatgatgtacgccagcatgtacagatcttgaaacaaagaccacttcctgaggttcaacccgttgaaatttatcctcgagtaagcaaaatattgaaagaagaatggagcagaacagaaattggacaaattaagaacgttctcattcccaaaatgaaaatttctccaaaaaggatgtcatgttcctggcctggtaaggatgaaaaggaagttgaatttttaaaaattttaaacattgttgtagttacattaatttcagtaatactgatgtcgatactctttttcaaccaacacatcataacctttttaagtgaaatcactttaatatggttttctgaagcctctctatctgtttaccaaagtttatctaacagtctgcataaggtaaagaatatactgtgtcacattttctatttgttgaaggaatttgtgtggaaaatagtttcccatatg
Note: HEK293T tri-plasmid packaging system: object plasmid and virus are packed helper plasmid pCMV-dR8.74, pMD2.G (Addgene). according to the amount mixing of 3: 2: 1, utilize calcium phosphate precipitation transfection pre-service (transfection adds containing final concentration 25uM chloroquine for last hour) low algebraically HEK293T, transfection is changed containing 1%Penicillin/streptomycin (Gibco15140-122) for 24 hours, 1%SodiumPyruvate (Gibco113600-70), 1%SodiumButyrate ((100xsolution, 0.5M, sigma, 19364) not containing the super nutrient solution (Lonza12-725F) of serum.By the time 48 h before harvest cell conditioned medium liquid, 0.45 μm of filter (Millipore) removed by filtration cell fragment, 4 degree of 22000rpm high speed centrifugations are separated supernatant PBS lytic virus precipitation for 2 hours, obtain virus liquid and are used for subsequent cell transfection.
Get PBS damping fluid (pH=7.4) for the preparation of Non-transfected clone.
(2) AGS/MKN45 is incubated at RPMI1640 (Gibco, c22400500Bt) (1%Penicillin/streptomycin is added in complete medium, Gibco15140-122, 1%L-Glutamine, Gibco25030-081), fresh medium is changed when AGS/MKN45cell adherent rate reaches 80%, the interference shRNA obtained in step 1 is added respectively according to MOI=1: 20, the contrast scramble of interference shRNA, process LAN TRIM59, the contrast Vector slow virus of process LAN TRIM59, the PBS (pH=7.4) of same volume is added in Non-transfected experimental group according to the volume equivalent of adding viral interference, mixing shakes up, last is that 8ug/ml adds Assisted Transfection reagent polybrene (millipore according to final concentration, TR-1003-G) mixing shakes up.Transfection is after 72 hours, observation luciferase expression situation, and now add for microbiotic puromycin (biological purchased from the past, geneoperation, ISY1130-025MG) needed for expression vector, final concentration is 5ug/ml.
(3) low-density inoculating cell: 100, the cell obtained in step (2) is inoculated in a hole of 6 orifice plates, still cultivate in the RPMI1640 complete medium containing puromycin (5ug/ml), until cell grows clone, examine under a microscope the cell colony with fluorescence, the lid of 6 orifice plates is used marking pen mark position, according to mark dropping a small amount of (can cell colony be covered) 0.25% pancreatin (Gibco in super-clean bench, 25200-072), be placed in cell culture incubator to digest, cell dissociation is cultivated separately with 200ul liquid-transfering gun sucking-off cell after coming, 1ug/mi microbiotic (puromycin) maintains three weeks always, afterwards microbiotic (puromycin) concentration reduce by half (2ug/ml) maintain two months, get sh-TRIM59 clone (the shRNA clone that AGS/MKN45 is corresponding thus, interference cell system), scramble clone, TRIM59 clone (overexpressing cell system), Vector clone, namely be used for carrying out follow-up vivo and vitro experiment.。
Experimental procedure:
1, body outer cell proliferation experiment:
Get the interference/overexpressing cell system of AGS/MKN45 and correspondence establishment, with complete medium (Gibico, RPMI1640) cell suspension is made into, get 96 orifice plates, add above-mentioned clone respectively, every hole 3, 000 cell, volume 100 μ l, often kind of clone is parallel does 10 holes, average, until (about four hours) add 20 μ lMTS reactant liquors (as initial time 0hr after cell attachment, after this 24 are chosen, 48, 72, 96hrs time point), 3 hours are hatched at 37 DEG C, then in the upper absorbance detecting 490nm place of microplate reader (BioTek), result as shown in figs.3 a and 3b.Because absorbance is directly proportional to cell number and vigor, so linearly can intuitively reflect cell number size.As shown in Figure 3A, by the expression of the TRIM59 in interference TRIM59 high-expression cell line AGS, can slow down the multiplication rate of AGS, as shown in Figure 3 B, in the MKN45 cell of the relatively low expression of TRIM59, process LAN TRIM59 can accelerate the proliferation rates of cell.
2, knurl experiment is become in body:
AGS or MKN45 and corresponding interference/overexpressing cell system cell are suspended in not containing the minimal medium (Gibico of serum, RPMI1640) in, 50 microlitre minimal mediums are contained 1,000, the suspending liquid of 000 tumour cell and isopyknic matrigel (BD, article No. 356234) mix, be then injected into the subcutaneous of mouse, injection rate IR is 100 microlitres/only.Within every ten days, measure the size of tumour, the method for calculating is V=a2*b (wherein V is volume, and a is the length of most minor face, and b is the length of longest edge), weighs the body weight of nude mice.As shown in Figure 6A, by the expression of the TRIM59 in interference TRIM59 high-expression cell line AGS, can weaken in body and become knurl ability, as shown in Figure 6B, in the MKN45 cell of TRIM59 relative to low expression, process LAN TRIM59 can improve in body and becomes knurl ability.
Embodiment 4 tumor migration is tested
Experiment material:
The transwell cell (Coming, 3422) of 8 μm, wraps quilt according to explanation matrigel.
The method for building up of clone is with embodiment 3.
Experimental procedure:
Before doing transwell experiment, first by each cell in the serum free medium (Gibco, RPMI1640) hungry 24 hours, then add tanswell cell.
With 1%BSA (sigma, A6003-25G) the matrigel half an hour above transwell cell is activated, 100 μ l cell suspensions (adopt the preparation of above-mentioned serum free medium, containing cell 10,000) are added on transwell cell.Add the complete culture solution (Gibco, C11875500CP) of 10% serum of 500 microlitres below.Spend the night in 37 DEG C of cell culture incubators.Second day, 10 minutes are fixed with 4% paraformaldehyde immobile liquid, be placed in PBS damping fluid (pH=7.4) to place 10 minutes, then crystal violet (the Aladdin of 0.1% is used, C110702-25g) dye 10 minutes, PBS damping fluid (pH=7.4) cleans up, cell is above dabbed off (do not affect cell under confluent monolayer cells) with cotton swab, cell is put in 24 orifice plates being equipped with 500 microlitre PBS damping fluids (pH=7.4), observe under inverted microscope, take pictures, result as shown in Figure 4 A and 4 B shown in FIG..As shown in Figure 4 A, by the expression of the TRIM59 in interference TRIM59 high-expression cell line AGS, can weaken migration, as shown in Figure 4 B, in the MKN45 cell of the relatively low expression of TRIM59, process LAN TRIM59 can improve migration.
Embodiment 5 colony formation
Experiment material: 2XRPMI1640 basic culture solution (Ji Nuo, GNM31802), low melting-point agarose (Lonza, 50101), six orifice plates, 0.2 micron membrane filter.
The method for building up of clone is with embodiment 3.
Experimental procedure:
1,1.2% low melting-point agarose solution is prepared with distilled water, equal-volume ratio mixing 2X1640 nutrient culture media, until temperature drops to about 60 DEG C, through 0.2 zut filter (1.5ml/well) in 6 orifice plates, be placed in room temperature cooled and solidified, obtain agar plate.
2, prepare 0.6% low melting-point agarose solution with distilled water, equal-volume ratio mixing 2XRMPI1640 nutrient culture media, 0.2 zut filter is degerming, is mixed into cell, makes cell concentration be 1500 or 2000/ml.
3, join on the agar plate for preparing in step 1 by the cell of mixing in step 2 at 37 DEG C, room temperature places half an hour, then puts into 4 DEG C of refrigerator half an hour, waits for agar solidification.
4, after agar plate solidifies, six orifice plates are transferred in cell culture incubator.One day afterwards every hole add 1 milliliter of complete culture solution (Gibco, C11875500CP and 10% mycillin (hyclone)) containing 10% hyclone.
5, by the time cell clone grows to a certain size, and taken out by culture plate, fix with 4% paraformaldehyde, PBS damping fluid (pH=7.4) soaks half an hour, taking-up, by 0.05% violet staining 2 hours, takes pictures.As shown in Figure 5A, by the expression of the TRIM59 in interference TRIM59 high-expression cell line AGS, clonality can be weakened.As shown in Figure 5 B, process LAN TRIM59 in the MKN45 cell of the relatively low expression of TRIM59, can improve clonality.
Embodiment 6 cell apoptosis assay
Experiment material: BDpharmingenFITCanexin-VapoptosisDetectionKit (article No. 556547)
The method for building up of clone is with embodiment 3.
Experimental procedure:
1, AGS-scramble, AGS-shRNA clone of foundation is got, cell culture fluid sucking-off in centrifuge tube, wash attached cell once with PBS damping fluid (pH=7.4), add (concentration 0.25%, pH=7.4) trypsin digestion cell.Incubated at room, to when piping and druming can make attached cell blow and beat gently, absorbs pancreatin cell dissociation buffer.
2, add the cell culture fluid collected in step 1, slightly mix, transfer in centrifuge tube, be under the condition of 1000g centrifugal 5 minutes at centrifugal force, abandon supernatant, collecting cell, with PBS damping fluid (pH=7.4) re-suspended cell counting gently.Get 100,000 resuspended cells, be under the condition of 1000g centrifugal 5 minutes at centrifugal force, abandon supernatant, add 195 μ lAnnexinV-FITC in conjunction with liquid (BD, article No. 556547) re-suspended cell gently, add 5 μ lAnnexinV-FITC (BD, article No. 556547), mix gently.
3, room temperature lucifuge hatches 10 minutes, is under the condition of 1000g centrifugal 5 minutes, abandons supernatant, add 190 μ lAnnexinV-FITC in conjunction with liquid re-suspended cell gently at centrifugal force.Add 10 μ l (1mg/ml) propidium iodide stain liquid, mix gently, ice bath lucifuge is placed.
4, carry out flow cytomery analysis immediately, as shown in Figure 7, disturb the expression of TRIM59 in AGS to find in vitro, the apoptosis number showed increased of cell, that is disturbs the anti-apoptotic reduced capability (Fig. 7) of the express cell of TRIM59 to result.
Claims (2)
1.TRIM59 albumen is preparing the application in stomach cancer diagnosis reagent as diagnosing gastric cancer mark, wherein, in cell sample or tissue samples, the expression of TRIM59 albumen raises prompting patient and suffers from cancer of the stomach, and the expression of TRIM59 albumen is higher, the clinical scale of prompting cancer of the stomach is higher, tumor-infiltrated degree is higher, and the prognosis of patient is poorer, and life cycle is shorter.
2.TRIM59 albumen is preparing the application in curing gastric cancer medicine as therapeutic targets.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410131478.8A CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410131478.8A CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103954767A CN103954767A (en) | 2014-07-30 |
CN103954767B true CN103954767B (en) | 2016-01-13 |
Family
ID=51332065
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410131478.8A Expired - Fee Related CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103954767B (en) |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090233295A1 (en) * | 2008-01-29 | 2009-09-17 | Elias Georges | Trim59 directed diagnostics for neoplastic disease |
WO2011029193A1 (en) * | 2009-09-10 | 2011-03-17 | Lawson Health Research Institute | Method of treating cancer by inhibiting trim59 expression or activity |
WO2012167112A2 (en) * | 2011-06-01 | 2012-12-06 | Illumina, Inc. | Gastric cancer biomarkers |
-
2014
- 2014-04-02 CN CN201410131478.8A patent/CN103954767B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
TRIM59, a novel multiple cancer biomarker for immunohistochemical detection of tumorigenesis;VidaKhatamianfar;《BMJ open》;20121231;第2卷;第1-10页 * |
小鼠TRIM59蛋白多克隆抗体的制备、鉴定与初步应用;姜飞;《西北农林科技大学学报( 自然科学版)》;20091231;第37卷(第12期);第11-17页 * |
Also Published As
Publication number | Publication date |
---|---|
CN103954767A (en) | 2014-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Han et al. | Fibronectin regulates anoikis resistance via cell aggregate formation | |
ES2239407T3 (en) | DETERMINATION OF AN ABNORMALITY IN CELLULAR GROWTH. | |
Xu et al. | VEGF induce vasculogenic mimicry of choroidal melanoma through the PI3k signal pathway | |
Wang et al. | Extracellular vesicles (EVs) from lung adenocarcinoma cells promote human umbilical vein endothelial cell (HUVEC) angiogenesis through yes kinase-associated protein (YAP) transport | |
CN105368853B (en) | One kind marker relevant to non-small cell lung cancer auxiliary diagnosis and its application | |
Wei et al. | Relationship of CD44+ CD24-/low breast cancer stem cells and axillary lymph node metastasis | |
Sun et al. | TOPK is highly expressed in circulating tumor cells, enabling metastasis of prostate cancer | |
Zhang et al. | Overexpression of ROCK1 and ROCK2 inhibits human laryngeal squamous cell carcinoma | |
Duan | Silencing the autophagy-specific gene Beclin-1 contributes to attenuated hypoxia-induced vasculogenic mimicry formation in glioma | |
IL226570A (en) | Method for the diagnosis of a carcinoma | |
Xu et al. | ANG promotes proliferation and invasion of the cell of lung squamous carcinoma by directly up-regulating HMGA2 | |
Wu et al. | Overexpression of KCNJ4 correlates with cancer progression and unfavorable prognosis in lung adenocarcinoma | |
Liu et al. | Characteristics and clinical significance of polyploid giant cancer cells in laryngeal carcinoma | |
Zech et al. | Patient derived ex vivo tissue slice cultures demonstrate a profound DNA double-strand break repair defect in HPV-positive oropharyngeal head and neck cancer | |
CN108866064B (en) | Aptamer of targeted metastatic human breast cancer cells and application thereof | |
Lu et al. | Downregulation of PDGF-D inhibits proliferation and invasion in breast cancer MDA-MB-231 cells | |
Tsuji et al. | Uterine cervical carcinomas associated with lobular endocervical glandular hyperplasia | |
Nakayama et al. | Pancreatic cancer cell-derived exosomes induce epithelial-mesenchymal transition in human pancreatic cancer cells themselves partially via transforming growth factor β1 | |
Wang et al. | Upregulation of ALDH1B1 promotes tumor progression in osteosarcoma | |
CN109999184A (en) | Application of the TAK1 albumen in preparation cancer of the esophagus prognosis evaluation reagent or kit | |
Zhang et al. | Correlation of Notch1 expression and activation to cisplatin-sensitivity of head and neck squamous cell carcinoma | |
CN103969452B (en) | The classification diagnosis kit of BAY 43-9006 personalized treatment liver cancer | |
CN108113984A (en) | Purposes of the SHP2 inhibitor in anti-tumor drug is prepared | |
CN104198722A (en) | Novel tumor marker GSTA1 for lung caner as well as screening method and application thereof | |
CN103954767B (en) | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160113 Termination date: 20200402 |