CN103954767A - Novel application of TRIM59 protein for diagnosis and treatment for stomach cancer - Google Patents
Novel application of TRIM59 protein for diagnosis and treatment for stomach cancer Download PDFInfo
- Publication number
- CN103954767A CN103954767A CN201410131478.8A CN201410131478A CN103954767A CN 103954767 A CN103954767 A CN 103954767A CN 201410131478 A CN201410131478 A CN 201410131478A CN 103954767 A CN103954767 A CN 103954767A
- Authority
- CN
- China
- Prior art keywords
- trim59
- cell
- expression
- stomach cancer
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57446—Specifically defined cancers of stomach or intestine
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/70—Mechanisms involved in disease identification
- G01N2800/7023—(Hyper)proliferation
- G01N2800/7028—Cancer
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a novel application of TRIM59 protein, and more specifically relates to the TRIM59 protein for preparing a diagnostic reagent for stomach cancer by taking the TRIM59 protein as a stomach cancer diagnosis marker, and an application of the TRIM59 protein as a treatment target drone in preparation of medicines for treating stomach cancer. The application proves that TRIM59 can be used as the diagnosis marker and the treatment target drone for stomach cancer, diagnosis at early stage on the stomach cancer can be carried out by detecting the expression level of TRIM59, TRIM59 can be the medicine target drone for assisting the clinical operation treatment by inhibiting the expression of TRIM59, so that the cure rate for stomach cancer patient is increased, and the life quality of the patient is improved.
Description
Technical field
The present invention relates to a kind of diagnosing gastric cancer mark and treatment target.
Background technology
Cancer of the stomach is in world wide, to be the fourth-largest common cancer type, and causes the dead deputy type of cancer of the mankind, even more serious in Asia.Cancer of the stomach is to cause one of malignant tumour that China's death toll is maximum, and accounts for the significant proportion of world's cancer of the stomach generation case, and in the malignant tumour of stomach, it is also modal malignant tumour that gland cancer accounts for 95%, and even ranks first of all malignant tumours of the mankind.The cancer of the stomach incidence of China accounts for worldwide significant proportion.How asymptomatic early carcinoma of stomach is or only have light symptoms, and in the time that symptom is obvious, pathology has belonged to late period, and the mankind's existence health has been formed to great threat.
At present, the diagnosis of cancer of the stomach mainly relies on gastroscope, x-ray, several means such as ultrasonic, mainly that to lesion locations, excision reaches result for the treatment of by surgical resection art to the treatment of cancer of the stomach clinically, find the effective ways of diagnosis of gastric cancer early, analyze patient's prognosis situation according to the expression of mark, accordingly patient is carried out to supplemental treatment at the enterprising hand-manipulating of needle in operating basis to target molecules and seem particularly important.
Cancer of the stomach does not have manifest symptom in early days, until symptom while obviously being diagnosed, generally reaches an advanced stage.And taking operation as main cancer of the stomach anaphase, though it is not mitigate the disease to a great extent delays the deterioration of the state of an illness, very good to there is the curative effect of the cancer of the stomach that invasion and attack shift.
Though the operative effect of early carcinoma of stomach is better, also can take nonoperative method to cure to some case, therefore, except having regular physical checkups, also should try to explore other treatment method, or taking operative treatment as main comprehensive therapeutic plan, to improve curative effect.Up to the present, a lot of biomarkers all can not well be used as clinical diagnosis mark, only contribute to differentiate prognosis and the chemotherapeutic efficacy of tumour.Assist routine diagnosis inspection so also do not have good molecular diagnosis to identify, and as the treatment for the treatment of target assisted surgery.
Find the protein marker of tumor tissues specificity high level expression, and using the target spot as diagnoses and treatment, be the active and effective supplementary means that is recently considered to operative treatment.The generation development of tumour activates with some signal path specially, gene activation is relevant.The activation of some memebrane protein causes the activation of signal path, further causes the activation of some gene, maintains developing of tumour.Find (film) albumen of these differential expressions, the mark using this as diagnosing tumour.If there is the protein marker of concrete function, can be in conjunction with the specific sealing/activation antibody of exploitation (medicine), the activity of mark in directed interference/activation tumor tissues, reaches more effective treatment tumour in conjunction with clinical operation treatment.
Summary of the invention
The object of the invention is to find a kind of new diagnosing gastric cancer mark and treatment target and uses thereof.
In order to achieve the above object, the invention provides TRIM59 albumen as diagnosing gastric cancer mark in the application of preparing in stomach cancer diagnosis reagent.
The present invention also provides TRIM59 albumen as treating target in the application of preparing in curing gastric cancer medicine.
The present invention finds diagnosis marker and the treatment target-TRIM59 of new cancer of the stomach tumour.The expression that TRIM59 matches well in right normal gastric mucosa in stomach organization obviously raises, at gastric carcinoma cell lines with respect to immortalization gastric epithelial cell-GES-1 specificity high level expression TRIM59.TRIM59 is likely that one can be shuttled back and forth to nuclear albumen from cell membrane, and its expression has again very direct correlativity with patient's clinical symptoms, and also has correlativity closely with operation prognosis situation.TRIM59 is high expressed in sdenocarcinoma of stomach, and the high level expression of TRIM59 can promote that sdenocarcinoma of stomach develops, and the expression of TRIM59 is with the clinical scale of patient's tumour, and infiltration degree and prognosis existence situation have close relationship.Therefore TRIM59 can be used as clinical diagnosis mark, and can be used as drug targets molecule, by suppressing the activity of TRIM59, treats cancer of the stomach tumour in conjunction with clinical operation.
Compared with prior art, the invention has the beneficial effects as follows:
The present invention finds first, TRIM59 can be used as diagnosis marker and the treatment target of cancer of the stomach, can carry out early diagnosis to cancer of the stomach by the expression that detects TRIM59, assist thus clinical operation treatment to improve the cure rate of Patients with Gastric Cancer by suppressing the expression of TRIM59 using TRIM59 as drug targets, improve patient's quality of life.
Brief description of the drawings
Figure 1A is the expression figure that detects TRIM59 in organization chip by SABC;
Figure 1B is by the signal intensity quantitative analysis results figure in Image pro plus software analysis TRIM59 dyeing unit area;
Fig. 1 C is the expression intensity analysis result figure of TRIM59 in patient's clinical scale situation integrated tissue.
Fig. 1 D is patient's tumor-infiltrated degree and the expression correlation analysis result figure of TRIM59.
Fig. 1 E is the correlation analysis result figure of TRIM59 expression and patient's prognosis existence situation.
Fig. 1 F is by western blot, and RT-PCR experiment detects in 10 flesh tissue samples, the expression spirogram of TRIM59 protein level in paired sample (normal structure, tumor tissues).
Fig. 2 A is that RT-PCR detects in clone TRIM59 with respect to the expression figure of mRNA in GES-1;
Fig. 2 B is that western blot detects the expression spirogram of TRIM59 on protein level in clone.
Fig. 3 A is that transfection disturbs the stable cell lines of the slow virus foundation of TRIM59 expression to detect the increment situation result figure of cell by MTS method in AGS;
Fig. 3 B crosses the stable cell lines of expressing virus foundation by the increment situation result figure of MTS method detection cell to the clone MKN45 transfection TRIM59 of the low expression of TRIM59.
Fig. 4 A disturbs TRIM59AGS cell migration ability to weaken figure;
Fig. 4 B was expression TRIM59MKN45 cell migration ability enhancing figure;
Fig. 5 A disturbs TRIM59AGS Cell clonality to weaken figure;
Fig. 5 B was expression TRIM59MKN45 Cell clonality enhancing figure;
Fig. 6 A disturbs in TRIM59AGS cell body to become knurl ability to weaken figure;
Fig. 6 B becomes knurl ability enhancing figure in expression TRIM59MKN45 cell body;
Fig. 7 becomes a cadre to disturb after the slow virus of TRIM59 expression in ags cell wink, utilizes Anexin-V/PI dyeing, detects Apoptosis ratio result figure by flow cytometer.
In each figure, * represents p < 0.05 above, and * * represents p < 0.01, and * * * represents p < 0.001.
Embodiment
Illustrate the present invention below in conjunction with embodiment.
Embodiment 1: SABC
1, experiment material:
10 routine flesh tissue samples (pairing normal gastric mucosa, stomach organization), 178 organization chips (purchased from Xinchao Biotech Co., Ltd., Shanghai, HStm-Ade178Sur-01); Primary antibodie is rabbit against human T RIM59 antibody (Abcam, article No. ab69639), and follow-up dyeing adopts GTVision III SABC kit (Shanghai Gene Tech. Company Limited).
2, experimental technique:
Organization chip is arranged in many Different Individual tissue specimens on same microslide in regular array mode exactly, carries out the original position Histological research of same index by immunohistochemical method.Concrete steps are:
1, by 178 organization chips that are positioned in 4 DEG C of refrigerators, take out room temperature and place recovery room temperature, be placed in 56 DEG C of incubators and toast 20 minutes.Organization chip is dipped in dimethylbenzene three times to each 5 minutes.Taking-up is placed in 100% absolute ethyl alcohol twice, each 3 minutes; Insert successively 90%-70% alcohol at different levels each 3 minutes.With PBS flushing 3 times, each 3 minutes.
2, organization chip is fixed to 15 minutes with (4%) paraformaldehyde immobile liquid, wash 3 times each 5 minutes with PBS damping fluid.
3, antigen retrieval: with 0.01M citrate solution exposure antigenic determinant, concrete steps are: use the extremely boiling in 3 minutes of the high fire heating of micro-wave oven 0.01M citrate solution, after 4 minutes, put into organization chip low fiery microwave twice again, each 1 minute (timely supplementary reparation liquid prevents from repairing liquid boiling and overflows).Be cooled to room temperature, wash 5 minutes with PBS damping fluid.With containing PBS damping fluid (pH=7.4) rupture of membranes of 0.5%Triton 15 minutes, wash 3 times each 5 minutes with PBS damping fluid (pH=7.4).
4, sealing nonspecific proteins
1) 3%H
2o
2-methyl alcohol (30%H
2o
210ml+ methyl alcohol 90ml) soaking at room temperature 30 minutes, eliminate endogenous oxidoreducing enzyme.
2) tap water rinses 10 minutes, and PBS damping fluid soaks 3 times, each 3 minutes, sucks unnecessary liquid (not encountering tissue) with dust-free paper.
3) with PBS damping fluid (pH=7.4) preparation 10% lowlenthal serum.
4) on organization chip, drip 10% lowlenthal serum (with the preparation of PBS damping fluid), be positioned in wet box and seal heterogenetic antigen (200 microlitres/organization chip), room temperature 1 hour;
5, primary antibodie is hatched
Prepare 1% lowlenthal serum with PBS damping fluid, with proportionally 1: the 400 dilution rabbit against human T RIM59 antibody of 1% lowlenthal serum of PBS damping fluid preparation, get rid of 10% lowlenthal serum confining liquid on organization chip, dry around tissue with dust-free paper, (approximately 100 μ l), are placed in 4 DEG C, wet box and spend the night directly to add the anti-human TRIM59 antibody of rabbit having diluted.Within second day, from refrigerator, take out and need 37 DEG C of rewarmings 1 hour.
6, two anti-hatching
1) primary antibodie is washed off, organization chip is inserted to plastic slide frame, the then whole plastic casing of putting into, adds the immersion of PBS damping fluid and washes 15 minutes 3 times.
2) with dust-free paper, organization chip PBS damping fluid is around sucked, add two anti-(GTVisionTM III type polymkeric substance) in incubated at room 30 minutes.Hatch completely, organization chip is inserted in PBS damping fluid, rinse 3 times, each 3 minutes, take out organization chip, get rid of and dry tissue liquid (tissue is sure not to be dried) around, lie against and wet in box.
3) drip ready developer DAB working fluid 80 microlitres, incubated at room 10 minutes, tap water rinses color development stopping.
7, use haematoxylin redyeing nucleus, room temperature 30 seconds, rinses and redyes for 1 hour with tap water.
8, mounting: alcohol at different levels (70%-100%) dehydration, every grade 3 minutes.Take out organization chip and insert in dimethylbenzene three times, each 5 minutes.On organization chip, drip neutral resins with dropper, then covered, push gently with tweezers, and drive bubble away, in fuming cupboard, leave standstill and dry up, microscopic examination, the expression of TRIM59 in more paired tumor tissues and adjacent cancer beside organism, result as shown in Figure 1A, (left side is cancer beside organism, right side is tumor tissues) by the signal intensity quantitative test in Image pro plus software analysis TRIM59 dyeing unit area, by t assay p=0.0204, result is as shown in Figure 1B.From Figure 1A and Figure 1B, can find out, in stomach organization, the expression of TRIM59 is higher than the cancer beside organism of pairing.
Expression intensity to TRIM59 in patient's clinical scale situation integrated tissue is analyzed, result as shown in Figure 1 C, the expression of TRIM59 and the correlativity of clinical scale, p=0.0287.Tumor-infiltrated degree to patient and the expression correlativity of TRIM59 are analyzed, result is as shown in Fig. 1 D, p=0.0044, correlativity to TRIM59 expression and patient's prognosis existence situation is analyzed, p=0.0223, Fig. 1 C-Fig. 1 E explanation, the expression of TRIM59 and patient's clinical scale, tumor-infiltrated degree, patient's prognosis has certain correlativity.
By western blot, RT-PCR experiment detects in 10 flesh tissue samples, the expression of TRIM59 protein level in paired sample (normal structure, tumor tissues).Liquid nitrogen grinding tissue, is extracted and is organized RNA and RIPA (Thermo, 89901) by TRIzol (Invitrogen) respectively, add protease inhibitors and inhibitors of phosphatases (Thermo, 78410, thermo, 78420) extraction histone.Utilize PrimeScript RT reagent Kit with gDNA Eraser (Takara) to carry out the synthetic cDNA of reverse transcription, by SYBR Green PCR Master Mix kit (Takara RR420A) quantitative reagent, on ABI7900HT, do internal reference Δ Δ ct method with the expression of GAPDH and carry out qRT-PCR and detect the expression of gene; Utilize BCA (Thermo, 23227) to carry out quantitatively albumen, dye and signal intensity is compared to the expression of the expression analysis destination protein of GAPDH by WB.Experimental result is as shown in Fig. 1 F, and the expression of TRIM59 in cancerous tissue be higher than the expression in normal structure, and has correlativity closely with clinical symptoms.
Embodiment 2:Real-time PCR
Experiment material: fresh stomach organization sample, gastric carcinoma cell lines, MKN45, SGC7901,823, snu5, N87, AGS, the gastric epithelial cell of Snu1 and immortalization is GES-1.MKN45 (Bai Li bio tech ltd, Shanghai, MKN45), snu-5 (
cRL-5973
tM), snu-1 (
cRL-5971
tM); SGC7901,823, N87, (article No. is TChu46 respectively, TChu11, TChu130, TChu7 purchased from Chinese Academy of Sciences's cell bank for AGS; GES-1 is purchased from Fu Xiang bio tech ltd, Shanghai (GES-1).
Experimental procedure:
1, utilize the method for traditional Trizol-chloroform-isopropyl alcohol extracting RNA, by organizing freezing milling, the means such as lysis, the RNA in extracting tissue and cell.Use the synthetic cDNA of PrimeScript RT reagent Kit with gDNA Eraser (Takara) kit reverse transcription RNA, further by SYBR Green real-time quantitative RT-PCR technology (Takara RR420A), detect tissue, the expression of TRIM59 gene on cellular level.On ABI7900HT quantitative PCR, real-time quantitative detects PCR result.
2, the expression by Δ Δ ct method with the expression standardization TRIM59 gene of internal reference GAPDH.With the gastric epithelial cell GES-1 of normal immortalization in contrast, quantize the expression of TRIM59, result as shown in Figure 2 A.
Detect the expression of TRIM59 on protein level in clone by western blot, using GAPDH expression as internal reference, by Bio-Rad Quantity
version4.1 software carries out signal strength analysis, and relatively the expression of TRIM59 on protein level changes, and result as shown in Figure 2 B.
By western blot, RT-PCR discovery, along with the grade malignancy of cell raises, the mRNA of TRIM59, protein level has rising to a certain degree.
Embodiment 3 cell proliferation experiment
Experiment material:
Cell proliferation detecting kit CellTiter96AQueous (MTS) (Promega, G358A); Matrigel (BD, article No.: 356234).
Detect by the RT-PCR gene level in embodiment 2 and WB protein level, filter out the cell line AGS/MKN45cell of high/low expression, the clone AGS/MKN45 cell of choosing is disturbed respectively/crossed and express propagation, the migration of experiment detection TRIM59 to cell, clone the impact that formation and in-vivo tumour produce.
The method for building up of clone:
The source of AGS/MKN45 clone is with embodiment 2.
(1) shRNA is disturbed in design, disturb shRNA contrast scramble, cross and express TRIM59 and cross and express the contrast Vector slow virus plasmid of TRIM59, be respectively used to pack slow virus respectively transfection AGS/MKN45cell set up sh-TRIM59 clone (shRNA clone), scramble clone and MKN45 and cross TRIM59 clone, the Vector clone of expressing TRIM59.
Disturb slow virus to build: by two sections of sh-TRIM59 sequence (sh-TRIM59#1, sh-TRIM59#2), scramble control sequence clone be building up on Lentiviral pUCP, utilize HEK293T slow virus packaging system to be packaged into slow virus, find that through subsequent experimental checking the jamming effectiveness of sh-TRIM59#1 is the highest, so final choice sh-TRIM59#1 slow virus is used for transfection ags cell and sets up clone, sh-TRIM59 is all write by sh-TRIM59#1 in back.Disturb slow virus sh-TRIM59 synthetic by Shanghai thinking enlightening Bioisystech Co., Ltd.Sh-TRIM59 interference sequence and scramble control sequence are as follows:
Crossing expression slow virus builds: TRIM59cDNA clone is building up to Lentiviral pLV.Des2d.P/puro upper, utilizes HEK293T slow virus packaging system, be packaged into slow virus for follow-up cell experiment.We select empty carrier virus expression carrier plasmid to compare in addition, utilize equally HEK293T packaging system packaging virus for follow-up control experiment.
TRIM59cDNA sequence:
atgcacaattttgaggaagagttaacttgtcccatatgttatagtatttttgaagatcctcgtgtactgccatgctctcatacatttt?gtagaaattgtttggaaaacattcttcaggcatctggtaacttttatatatggagacctttacgaattccactcaagtgccctaatt?gcagaagtattactgaaattgctccaactggcattgaatctttacctgttaattttgcactaagggctattattgaaaagtaccag?caagaagaccatccagatattgtcacctgccctgaacattacaggcaaccattaaatgtttactgtctattagataaaaaattag?tttgtggtcattgccttaccataggtcaacatcatggtcatcctatagatgaccttcaaagtgcctatttgaaagaaaaggacac?tcctcaaaaactgcttgaacagttgactgacacacactggacagatcttacccatcttattgaaaagctgaaagaacaaaaat?ctcattctgagaaaatgatccaaggcgataaggaagctgttctccagtattttaaggagcttaatgatacattagaacagaaaa?aaaaaagtttcctaacggctctctgtgatgttggcaatctaattaatcaagaatatactccacaaattgaaagaatgaaggaaa?tacgagagcagcagcttgaattaatggcactgacaatatctttacaagaagagtctccacttaaatttcttgaaaaagttgatg?atgtacgccagcatgtacagatcttgaaacaaagaccacttcctgaggttcaacccgttgaaatttatcctcgagtaagcaaa?atattgaaagaagaatggagcagaacagaaattggacaaattaagaacgttctcattcccaaaatgaaaatttctccaaaaa?ggatgtcatgttcctggcctggtaaggatgaaaaggaagttgaatttttaaaaattttaaacattgttgtagttacattaatttcag?taatactgatgtcgatactctttttcaaccaacacatcataacctttttaagtgaaatcactttaatatggttttctgaagcctctcta?tctgtttaccaaagtttatctaacagtctgcataaggtaaagaatatactgtgtcacattttctatttgttgaaggaatttgtgtgga?aaatagtttcccatatg
Note: HEK293T tri-plasmid packaging systems: by object plasmid and virus packaging helper plasmid pCMV-dR8.74, pMD2.G (Addgene). mix according to the amounts of 3: 2: 1, utilize the low algebraically HEK293T of calcium phosphate precipitation transfection pre-service (transfection adds and contains final concentration 25uM chloroquine for last hour), transfection is changed and is contained 1%Penicillin/streptomycin (Gibco15140-122) for 24 hours, 1%Sodium Pyruvate (Gibco113600-70), 1%Sodium Butyrate ((100x solution, 0.5M, sigma, 19364) not containing the super nutrient solution (Lonza12-725F) of serum.By the time collecting cell supernatant after 48 hours, 0.45 μ m filter (Millipore) crosses and filters out cell fragment, and 4 degree 22000rpm high speed centrifugations separate supernatant PBS lytic virus precipitation for 2 hours, obtain virus liquid for follow-up cell transfecting.
Get PBS damping fluid (pH=7.4) for the preparation of Non-transfected clone.
(2) AGS/MKN45 is incubated to RPMI1640 (Gibco, c22400500Bt) in complete medium, (add 1%Penicillin/streptomycin, Gibco15140-122, 1%L-Glutamine, Gibco25030-081), in the time that reaching 80%, AGS/MKN45cell adherent rate changes fresh medium, according to MOI=1: 20 add respectively the interference shRNA obtaining in step 1, disturb the contrast scramble of shRNA, cross expression TRIM59, cross the contrast Vector slow virus of expressing TRIM59, the PBS (pH=7.4) that adds same volume according to the volume equivalent of adding viral interference is in Non-transfected experimental group, mixing shakes up, be finally that 8ug/ml adds auxiliary transfection reagent polybrene (millipore according to final concentration, TR-1003-G) mix and shake up.After transfection 72 hours, observation luciferase expression situation, now adds for the required microbiotic puromycin of expression vector (purchased from past biology, gene operation, ISY1130-025MG), and final concentration is 5ug/ml.
(3) low-density inoculating cell: 100, the cell obtaining in step (2) is inoculated in a hole of 6 orifice plates, still cultivate in the RPMI1640 complete medium that contains puromycin (5ug/ml), until cell grows clone, examine under a microscope the cell colony with fluorescence, on the lid of 6 orifice plates, use marking pen mark position, in super-clean bench, drip a small amount of (can cover cell colony) 0.25% pancreatin (Gibco according to mark, 25200-072), being placed in cell culture incubator digests, cell dissociation uses 200ul liquid-transfering gun sucking-off cell to cultivate separately afterwards, 1ug/mi microbiotic (puromycin) maintains three weeks always, afterwards microbiotic (puromycin) concentration reduce by half (2ug/ml) maintain two months, get thus sh-TRIM59 clone (the shRNA clone that AGS/MKN45 is corresponding, interference cell system), scramble clone, TRIM59 clone (overexpressing cell system), Vector clone, be used for carrying out follow-up vivo and vitro experiment.。
Experimental procedure:
1, body outer cell proliferation experiment:
Get interference/overexpressing cell system of AGS/MKN45 and correspondence establishment, with complete medium (Gibico, RPMI1640) be made into cell suspension, get 96 orifice plates, add respectively above-mentioned clone, every hole 3, 000 cell, volume 100 μ l, every kind of clone is parallel does 10 holes, average, until (about four hours) add 20 μ l MTS reactant liquors (as initial time 0hr after cell attachment, after this choose 24, 48, 72, 96hrs time point), hatch 3 hours at 37 DEG C, then in the upper absorbance that detects 490nm place of microplate reader (BioTek), result is as shown in Fig. 3 A and 3B.Because absorbance is directly proportional to cell number and vigor, so can linear reflection cell number size directly perceived.As shown in Figure 3A, be the expression of the TRIM59 in AGS by disturbing TRIM59 high expressing cell, can slow down the multiplication rate of AGS, as shown in Figure 3 B, in the MKN45 cell of the relatively low expression of TRIM59, cross the increment speed of expressing TRIM59 and can accelerate cell.
2, in body, become knurl experiment:
Be that cell is suspended in the minimal medium (Gibico that does not contain serum by AGS or MKN45 and corresponding interferences/overexpressing cell, RPMI1640) in, 50 microlitre minimal mediums are contained to 1,000, the suspending liquid of 000 tumour cell and isopyknic matrigel (BD, article No. 356234) mix, be then injected into the subcutaneous of mouse, injection rate IR is 100 microlitres/only.Within every ten days, measure the size of tumour, the method for calculating is V=a2*b (wherein V is volume, and a is the length of minor face, and b is the length of longest edge), weighs the body weight of nude mice.As shown in Figure 6A, be the expression of the TRIM59 in AGS by disturbing TRIM59 high expressing cell, can weaken in body and become knurl ability, as shown in Figure 6B, cross expression TRIM59 at TRIM59 in respect to the MKN45 cell of low expression and can improve and in body, become knurl ability.
Embodiment 4 tumor migration experiments
Experiment material:
The transwell cell (Coming, 3422) of 8 μ m, coated with matrigel according to explanation.
The method for building up of clone is with embodiment 3.
Experimental procedure:
Do before transwell experiment, first by each cell hunger 24 hours in serum free medium (Gibco, RPMI1640), then add tanswell cell.
With 1%BSA (sigma, A6003-25G) the matrigel half an hour above activation transwell cell, on transwell cell, add 100 μ l cell suspensions (adopt above-mentioned serum free medium preparation, contain 10,000, cell).Add the complete culture solution (Gibco, C11875500CP) of 10% serum of 500 microlitres below.In 37 DEG C of cell culture incubators, spend the night.Second day, fix 10 minutes with 4% paraformaldehyde immobile liquid, being placed in PBS damping fluid (pH=7.4) places 10 minutes, then use 0.1% crystal violet (Aladdin, C110702-25g) dyeing 10 minutes, PBS damping fluid (pH=7.4) cleans up, cell is above dabbed off to (not affecting confluent monolayer cells under cell) with cotton swab, cell is put in 24 orifice plates that are equipped with 500 microlitre PBS damping fluids (pH=7.4), under inverted microscope, observe, take pictures, result as shown in Figure 4 A and 4 B shown in FIG..As shown in Figure 4 A, be the expression of the TRIM59 in AGS by disturbing TRIM59 high expressing cell, can weaken migration, as shown in Figure 4 B, in the MKN45 cell of the relatively low expression of TRIM59, cross expression TRIM59 and can improve migration.
Embodiment 5 colony formations
Experiment material: 2XRPMI1640 basic culture solution (Ji Nuo, GNM31802), low melting-point agarose (Lonza, 50101), six orifice plates, 0.2 micron of filter.
The method for building up of clone is with embodiment 3.
Experimental procedure:
1, prepare 1.2% low melting-point agarose solution with distilled water, equal-volume ratio is mixed 2X1640 nutrient culture media, until temperature drops to 60 DEG C of left and right, filters in 6 orifice plates (1.5ml/well) through 0.2 micron of filter, be placed in room temperature cooled and solidified, obtain agar plate.
2, prepare 0.6% low melting-point agarose solution with distilled water, equal-volume ratio is mixed 2X RMPI1640 nutrient culture media, and 0.2 micron of filter filtration sterilization, sneaks into cell, and making cell concentration is 1500 or 2000/ml.
3, by the cell mixing in step 2 on 37 DEG C of agar plates that prepare in joining step 1, room temperature is placed half an hour, then puts into 4 DEG C of refrigerator half an hour, waits for that agar solidifies.
4,, after agar plate solidifies, six orifice plates are transferred in cell culture incubator.After one day, 1 milliliter of complete culture solution (Gibco, C11875500CP and 10% mycillin (hyclone)) containing 10% hyclone is added in every hole.
5, by the time cell clone grows to a certain size, and culture plate is taken out, and fixes with 4% paraformaldehyde, and PBS damping fluid (pH=7.4) soaks half an hour, and taking-up, by 0.05% violet staining 2 hours, is taken pictures.As shown in Figure 5A, be the expression of the TRIM59 in AGS by disturbing TRIM59 high expressing cell, can weaken clonality.As shown in Figure 5 B, in the MKN45 cell of the relatively low expression of TRIM59, cross expression TRIM59, can improve clonality.
Embodiment 6 cell apoptosis assays
Experiment material: BD pharmingen FITC anexin-V apoptosis Detection Kit (article No. 556547)
The method for building up of clone is with embodiment 3.
Experimental procedure:
1, get AGS-scramble, the AGS-shRNA clone of foundation, cell culture fluid sucking-off to centrifuge tube, with PBS damping fluid (pH=7.4) washing attached cell once, add (concentration 0.25%, pH=7.4) trypsin digestion cell.Incubated at room is blown and beaten can make attached cell blow and beat time extremely gently, absorbs pancreatin cell dissociation buffer.
2, add in step 1 cell culture fluid of collecting, slightly mix, transfer in centrifuge tube, under the condition that is 1000g at centrifugal force centrifugal 5 minutes, abandon supernatant, collecting cell, with PBS damping fluid (pH=7.4) re-suspended cell counting gently.Get 100,000 resuspended cells, under the condition that is 1000g at centrifugal force centrifugal 5 minutes, abandon supernatant, add 195 μ l Annexin V-FITC in conjunction with liquid (BD, article No. 556547) re-suspended cell gently, add 5 μ lAnnexinV-FITC (BD, article No. 556547), mix gently.
3, room temperature lucifuge is hatched 10 minutes, and under the condition that is 1000g at centrifugal force centrifugal 5 minutes, abandon supernatant, add 190 μ lAnnexinV-FITC in conjunction with liquid re-suspended cell gently.Add 10 μ l (1mg/ml) propidium iodide dyeing liquors, mix gently, ice bath lucifuge is placed.
4, carry out immediately flow cytometer and detect analysis, result as shown in Figure 7, disturbs the expression of TRIM59 in AGS to find in vitro, and the apoptosis number showed increased of cell, that is to say that the anti-apoptosis capacity of the express cell that disturbs TRIM59 weakens (Fig. 7).
Claims (2)
1.TRIM59 albumen as diagnosing gastric cancer mark in the application of preparing in stomach cancer diagnosis reagent.
2.TRIM59 albumen is as treating target in the application of preparing in curing gastric cancer medicine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410131478.8A CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410131478.8A CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103954767A true CN103954767A (en) | 2014-07-30 |
CN103954767B CN103954767B (en) | 2016-01-13 |
Family
ID=51332065
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410131478.8A Expired - Fee Related CN103954767B (en) | 2014-04-02 | 2014-04-02 | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103954767B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090233295A1 (en) * | 2008-01-29 | 2009-09-17 | Elias Georges | Trim59 directed diagnostics for neoplastic disease |
WO2011029193A1 (en) * | 2009-09-10 | 2011-03-17 | Lawson Health Research Institute | Method of treating cancer by inhibiting trim59 expression or activity |
WO2012167112A2 (en) * | 2011-06-01 | 2012-12-06 | Illumina, Inc. | Gastric cancer biomarkers |
-
2014
- 2014-04-02 CN CN201410131478.8A patent/CN103954767B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090233295A1 (en) * | 2008-01-29 | 2009-09-17 | Elias Georges | Trim59 directed diagnostics for neoplastic disease |
WO2011029193A1 (en) * | 2009-09-10 | 2011-03-17 | Lawson Health Research Institute | Method of treating cancer by inhibiting trim59 expression or activity |
WO2012167112A2 (en) * | 2011-06-01 | 2012-12-06 | Illumina, Inc. | Gastric cancer biomarkers |
Non-Patent Citations (2)
Title |
---|
VIDAKHATAMIANFAR: "TRIM59, a novel multiple cancer biomarker for immunohistochemical detection of tumorigenesis", 《BMJ OPEN》 * |
姜飞: "小鼠TRIM59蛋白多克隆抗体的制备、鉴定与初步应用", 《西北农林科技大学学报( 自然科学版)》 * |
Also Published As
Publication number | Publication date |
---|---|
CN103954767B (en) | 2016-01-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Han et al. | Fibronectin regulates anoikis resistance via cell aggregate formation | |
ES2239407T3 (en) | DETERMINATION OF AN ABNORMALITY IN CELLULAR GROWTH. | |
Zhang et al. | Daughter cells and erythroid cells budding from PGCCs and their clinicopathological significances in colorectal cancer | |
Fei et al. | Formation of polyploid giant cancer cells involves in the prognostic value of neoadjuvant chemoradiation in locally advanced rectal cancer | |
Kim et al. | A microchip filter device incorporating slit arrays and 3-D flow for detection of circulating tumor cells using CAV1-EpCAM conjugated microbeads | |
Pandey et al. | Amyloid precursor-like protein 2 (APLP2) affects the actin cytoskeleton and increases pancreatic cancer growth and metastasis | |
CN105368853A (en) | Marker related to auxiliary diagnosis of non-small cell lung cancer and application thereof | |
CN102305747A (en) | Biomarker reagent used for detecting breast cancer state | |
Zhang et al. | Overexpression of ROCK1 and ROCK2 inhibits human laryngeal squamous cell carcinoma | |
Duan | Silencing the autophagy-specific gene Beclin-1 contributes to attenuated hypoxia-induced vasculogenic mimicry formation in glioma | |
Gu et al. | [Retracted] Human Schlafen 5 Inhibits Proliferation and Promotes Apoptosis in Lung Adenocarcinoma via the PTEN/PI3K/AKT/mTOR Pathway | |
Liu et al. | Characteristics and clinical significance of polyploid giant cancer cells in laryngeal carcinoma | |
Zech et al. | Patient derived ex vivo tissue slice cultures demonstrate a profound DNA double-strand break repair defect in HPV-positive oropharyngeal head and neck cancer | |
Wang et al. | Filamin A (FLNA) regulates autophagy of bladder carcinoma cell and affects its proliferation, invasion and metastasis | |
Nakayama et al. | Pancreatic cancer cell-derived exosomes induce epithelial-mesenchymal transition in human pancreatic cancer cells themselves partially via transforming growth factor β1 | |
Lu et al. | Downregulation of PDGF-D inhibits proliferation and invasion in breast cancer MDA-MB-231 cells | |
CN108866064B (en) | Aptamer of targeted metastatic human breast cancer cells and application thereof | |
CN103969452B (en) | The classification diagnosis kit of BAY 43-9006 personalized treatment liver cancer | |
CN104198722A (en) | Novel tumor marker GSTA1 for lung caner as well as screening method and application thereof | |
Park et al. | Integrin β1 regulates the perineural invasion and radioresistance of oral squamous carcinoma cells by modulating cancer cell stemness | |
CN108113984A (en) | Purposes of the SHP2 inhibitor in anti-tumor drug is prepared | |
Palaniappan et al. | CAM-Delam: an in vivo approach to visualize and quantify the delamination and invasion capacity of human cancer cells | |
CN103954767B (en) | The novelty teabag that TRIM59 albumen is treated diagnosing gastric cancer | |
TW201226903A (en) | Methods and compositions for detection of lethal system and uses thereof | |
CN107083428A (en) | Applications of the PAK5 in cancer diagnosis prognosis treatment and drug screening |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160113 Termination date: 20200402 |
|
CF01 | Termination of patent right due to non-payment of annual fee |