CN103952486B - A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application - Google Patents
A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application Download PDFInfo
- Publication number
- CN103952486B CN103952486B CN201410168692.0A CN201410168692A CN103952486B CN 103952486 B CN103952486 B CN 103952486B CN 201410168692 A CN201410168692 A CN 201410168692A CN 103952486 B CN103952486 B CN 103952486B
- Authority
- CN
- China
- Prior art keywords
- cdx
- pcr
- bsemii
- vdr gene
- endonuclease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Abstract
The present invention is applicable to biological technical field, provide a kind of method analyzing VDR gene polymorphism sites Cdx-2 and application, the method comprises the following steps: design is for expanding the PCR primer of VDR gene C dx-2 pleomorphism site fragment, and by the base formation Specific PCR primers that PCR primer nearly 3 ' of suddenling change is held, the G allele base of the mutating alkali yl of described Specific PCR primers and Cdx-2 pleomorphism site is formed can by the restriction enzyme site of BseMII restriction endonuclease identification；The DNA fragmentation using above-mentioned Specific PCR primers amplification Cdx-2 pleomorphism site obtains pcr amplification product；Use BseMII restriction endonuclease that above-mentioned amplified production is carried out endonuclease reaction and obtain digestion products；Described digestion products is carried out electrophoresis analytical electrophoresis result。The new method analyzing VDR gene polymorphism sites Cdx-2 provided by the invention, simple to operate and accuracy height。
Description
Technical field
The invention belongs to biological technical field, particularly relate to a kind of method analyzing VDR gene polymorphism sites Cdx-2 and application。
Background technology
Vitamin D receptor (vitaminDreceptor, VDR) is mediation activated vitamin D 1,25 (OH)2D plays the biomacromolecule of biological effect, is arranged in cell membrane or nucleus。1,25 (OH)2D hormone signal molecule is combined formation hormone-receptor complex target cell with VDR, and this complex acts on the specific dna sequence on target gene, and the expression of structural gene is produced adjustment effect。Therefore, 1,25 (OH)2D is maintaining body calcium-phosphorus metabolism, regulates important effect is that by VDR mediation realization of the aspect such as cell proliferation, differentiation。
There is numerous mononucleotide polymorphism site (SingleNucleotidePolymorphisms, SNPs) on VDR gene, they are distributed widely in the regions such as gene promoter, exon and intron。This some of which SNPs affects VDR gene expression or protein activity levels possibly through various mechanism, thus having influence on body health situation。
Rs11568820 [U.S. Bioinformatics Institute (NationalCenterforBiotechnologyInformation, NCBI) SNPs numbering] it is in a SNP on VDR gene promoter, and it is in tail type with source capsule transcription factor-2 (CaudalTypeHomeoboxTranscriptionFactor2, CDX-2, for a kind of small intestinal specific cognate box transcription factor) with the region that VDR promoter is combined, therefore generally also cry Cdx-2 site。This site allele in most cases is G, is A under a few cases。The A allele in the upper Cdx-2 site of VDR can promote that CDX-2 regulates the activity of VDR promoter and improves VDR genetic transcription, promotes small intestinal calcium absorption。AA genotype can reduce the onset risk of osteoporosis, osteoporotic fracture, primordial dwarf disease, and systematic analysis finds that this site AA genotype is relevant with tumor risk increase。Therefore, the genotype in detection Cdx-2 site, the biological medical action that research VDR is relevant is had important value。
In numerous experimental techniques analyzing SNP, polymerase chain reaction (PolymeraseChainReaction, PCR) Restrictive fragment length polymorphism (RestrictionFragmentLengthPolymorphism, RFLP) after is analyzed (PCR-RFLP) and is usually technology the simplest, effective。But in the whole restricted enzyme known at present, only have Bst4CI (or it is with otch restricted enzyme HpyCH4III, Tsp4CI, TaaI) and be capable of identify that the nucleotide sequence (ACN^GT) at place, VDR gene C dx-2 site, this kind of restriction endonuclease is relatively infrequently, and lacks the desirable primer of this purpose fragment of pcr amplification。Meanwhile, also there is not yet to be replaced by primer base and introduce other restriction enzyme site and realize the report analyzed。Therefore, researcher before this detects the genotype in this site by methods such as order-checking, probe hybridization or high-resolution melting curve method (HighResolutionMelting, HRM) analyses。
1. sequencing。This technology is analysis of nucleotide (or base) kind and the direct-vision method put in order, it is necessary to PCR instrument and sequenator etc.。Contained the nucleic acid fragment in VDR gene C dx-2 site by PCR reaction amplification, then by the complete nucleotide kind being arranged in order in this fragment of sequenator interpretation, from sequencer address, directly judge the allele base in Cdx-2 site in this DNA fragmentation。Because of the difference of the principle that checks order, different sequencing equipments can be had optional。As all there is the brand sequenator of oneself in Illumina, ABI, LifeTechnology, Roche etc. company。These sequencing equipments are generally containing supporting detectable, such as the nucleotide sequence detector of ABI3100/3700 series, use in combinations with ABIPRISMSNaPShotMultiplex test kit。Sequencing equipment price is relatively expensive, and mostly more than 1,000,000 yuan, matched reagent is also comparatively closed。This kind of method substantially analysis process is: the primer amplified PCR containing the fragment of SNPs order reacts pcr amplification again that PCR primer purification product is masterplate (as with special reagent box ABISNaPshot) purified pcr product order-checking software analysis。
2. probe technique method。Mainly use TaqMan probe, design a pair specific primer for the VDR genetic fragment containing Cdx-2 site, meanwhile, design two kinds of specific probes being respectively provided with different fluorescent dyes。TaqMan probe is at probe 5 '-end mark fluorescent dyestuff, 3 '-end mark fluorescent quencher, it is suppressed that the fluorescence signal of same probe 5 '-end fluorescent dye；But after probe fracture or decomposing, the fluorophor being positioned at probe two ends separates with quencher, and the fluorescence signal that the former sends can be detected, thus reflecting and whether having the genes of interest fragment being combined with this probe specificity in certain reaction system。The realization of this method, need to set the specific temperature control response procedures of operation on real-time fluorescence quantitative PCR instrument。At target DNA fragment degeneration-annealing stage, the probe mated completely can be specifically binding in the Cdx-2 allele fragment of complementation；In the stage of amplification purpose fragment, specific binding probe can be replicated the polymerase of extended DNA masterplate and scale off from 5 '-end, occurs probe to decompose, ruptures, by detecting the specific fluorescent signal that this probe is with, it is judged that a certain genotype corresponding to probe。In like manner, if another fluorescent dye is detected, illustrate that DNA fragmentation to be measured is another genotype corresponding to this fluorescent probe。
3. high-resolution melting curve method (HighResolutionMelting, HRM)。The method depends on high accuracy PCR instrument (such as equipment such as LightScanner, Roche480II) and saturable dye (such as LCGreen)。Genes of interest fragment is in containing PCR reaction systems such as specific primers after degeneration-annealing-extension, and saturable dye sends the fluorescence signal of specific wavelength after being inserted in the target DNA double-strand of amplification；And melting the stage of reaction, double-stranded DNA can be untied and becomes strand and discharge saturable dye, and the process reducing and disappearing occurs in fluorescence signal。The fluorescence signal strong and weak change procedure in whole process is detected record by instrument, generates melting curve。Owing to the G/C content in target DNA fragment different genotype and base complement there are differences, the peak temperature of this melting curve and peak shape can difference to some extent, its resolving accuracy can reach the differentiation to single base difference, can differentiate the C/G genotype of Cdx-2。
The methods such as order-checking, probe hybridization or high-resolution solubility curve analysis all rely on instrument and the reagent of costliness and higher experimental implementation technology。
Summary of the invention
It is an object of the invention to provide a kind of method analyzing VDR gene polymorphism sites Cdx-2 and application, aim to solve the problem that owing to designing, for the amplification of the Cdx-2 pleomorphism site of VDR, the mode that primer difficulty is very big, cause passing through conventional PCR-RFLP, carry out the VDR gene polymorphism sites Cdx-2 problem analyzed simply, exactly。
The present invention is achieved in that a kind of method analyzing VDR gene polymorphism sites Cdx-2, comprises the following steps:
Design is for expanding the PCR primer of VDR gene C dx-2 pleomorphism site fragment, and by the base formation Specific PCR primers that PCR primer nearly 3 ' of suddenling change is held, the G allele base of the mutating alkali yl of described Specific PCR primers and Cdx-2 pleomorphism site is formed can by the restriction enzyme site of BseMII restriction endonuclease identification；
The DNA fragmentation using above-mentioned Specific PCR primers amplification Cdx-2 pleomorphism site obtains pcr amplification product；
Use BseMII restriction endonuclease that above-mentioned amplified production is carried out endonuclease reaction and obtain digestion products；
Described digestion products is carried out electrophoresis analytical electrophoresis result。
And, the application in obesity epidemic research field of a kind of method analyzing VDR gene polymorphism sites Cdx-2。
The method analyzing VDR gene polymorphism sites Cdx-2 provided by the invention, by being used for expanding nearly 3 ' end one base of artificial mutation of PCR primer of VDR gene C dx-2 pleomorphism site fragment, so that the G allele base formation of this mutating alkali yl and Cdx-2 pleomorphism site can by the restriction enzyme site of BseMII restriction endonuclease identification, the restriction enzyme site to amplified production making the BseMII restriction endonuclease property of can select that carries out endonuclease reaction, thus reaching to analyze the genotypic purpose of described VDR gene polymorphism sites Cdx-2。The method is not only simple and convenient, with low cost, and accuracy is high。
Accompanying drawing explanation
Fig. 1 is the pcr amplification product schematic diagram that the embodiment of the present invention provides；
Fig. 2 is the RFLP electrophoretic analysis result figure in the VDR gene C dx-2 site that the embodiment of the present invention provides；
Fig. 3 is the genotypic sequencing result figure in three kinds of VDR gene C dx-2 site that the embodiment of the present invention provides。
Detailed description of the invention
In order to make the technical problem to be solved in the present invention, technical scheme and beneficial effect clearly understand, below in conjunction with drawings and Examples, the present invention is further elaborated。Should be appreciated that specific embodiment described herein is only in order to explain the present invention, is not intended to limit the present invention。
Embodiments provide a kind of method analyzing VDR gene polymorphism sites Cdx-2, comprise the following steps:
S01. design is for expanding the PCR primer of VDR gene C dx-2 pleomorphism site fragment, and by the base formation Specific PCR primers that PCR primer nearly 3 ' of suddenling change is held, the G allele base of the mutating alkali yl of described Specific PCR primers and Cdx-2 pleomorphism site is formed can by the restriction enzyme site of BseMII restriction endonuclease identification；
S02. the DNA fragmentation using above-mentioned Specific PCR primers amplification Cdx-2 pleomorphism site obtains pcr amplification product；
S03. use BseMII restriction endonuclease that above-mentioned amplified production is carried out endonuclease reaction and obtain digestion products；
S04. described digestion products is carried out electrophoresis analytical electrophoresis result。
Specifically, in above-mentioned steps S01, inventor is downloaded by NCBI website and obtains VDR gene order (GeneID:7421, NCBIReferenceSequence:NG_008731.1), and it is as follows to check in rs11568820 sequence from snp database, corresponding SEDIDNO:3, SEDIDNO:4, be specially rs11568820 [Homosapiens]:
ATATTCCTGAGTAAACTAGGTCACA [A/G] TAAAAACTTATTTCTTATTATGGGT, wherein [A/G] in above-mentioned sequence represents two kinds of different genotype A or G of Cdx-2 pleomorphism site respectively。
Inventor utilizes the restriction endonuclease sites function of search of the biological software such as PrimerPremier and NEBcutter, intercept these SNP both sides and be about the bases longs of 400bp 800bp altogether, find restriction enzyme site, only find the restriction endonuclease of this identification ACN^GT sequence of Bst4CI (HpyCH4III, Tsp4CI, TaaI) to can be used for identifying Cdx-2 loci gene type。But the upstream 312bp place closest in the both sides, Cdx-2 site of VDR and 51bp place, downstream are also respectively arranged with a Bst4CI recognition site, for convenience of described herein below, respectively this 2 place Bst4CI recognition site of Cdx-2 site upstream and downstream is expressed as Bst4CI-312 and Bst4CI+51。Therefore, forward primer can being designed in theory between Bst4CI-312 Cdx-2 site, designing downstream primer between Cdx-2 Bst4CI+51, thus amplifying the Cdx-2 site containing only a Bst4CI restriction endonuclease identification。But the nucleotide sequence analysis between Cdx-2 Bst4CI+51 is found: owing to the G/C content of this narrow zone is very low, it is only 21.5%, want to design desirable primer in the region of this 50bp very difficult, and difficulty and the cost that experiment condition is groped can be increased therewith。Therefore, Bst4CI restriction endonuclease identifies that the genotypic route of VDRCdx-2 cannot realize。
In addition, inventor also attempts being about the bases longs of 50bp 100bp altogether by intercepting both sides, VDRCdx-2 site, utilize SiteFind this location proximate of online software search can form the restricted enzyme differentiating this site through nearly 3 '-distal process 1-2 the base of change of primer, still without Suitable results。
Through inventor, Cdx-2 polymorphic position point sequence is studied discovery repeatedly, when design is used for the PCR primer expanding VDR gene C dx-2 pleomorphism site fragment, sequence near Cdx-2 pleomorphism site can be passed through the nearly 3 ' distal process of PCR primer and become 1 base formation Specific PCR primers, specifically, one base A of the nearly 3 ' ends of PCR primer sports base T, the G allele base of the mutating alkali yl of the Specific PCR primers after sudden change and Cdx-2 pleomorphism site constitutes and can not contain in candidate's restriction endonuclease storehouse of the online software of SiteFind, the restriction enzyme site of BseMII (BspCNI) the restriction endonuclease identification that those skilled in the art not will recognize that, described BseMII (BspCNI) endonuclease recognition sequence is 5-CTCAG (N)10↓-3 or 3-GAGTC (N)8↑-5。After the restriction endonuclease storehouse interpolation BseMII of SiteFind software, it has been found that after 1 base of suddenling change near Cdx-2 pleomorphism site, amplified production will contain the energy restriction enzyme site by energy BseMII restriction endonuclease identification。
As the presently preferred embodiments, Cdx-2 genotype is identified for building BseMII recognition sequence near VDRCdx-2 pleomorphism site, the sequence of described Specific PCR primers is such as shown in SEDIDNO:1, SEDIDNO:2, its forward primer Cdx-2F represents, downstream primer Cdx-2B represents, the sequence of described Cdx-2F, Cdx-2B is:
Cdx-2F:TTATATATATTCCTGAGTAAACTAGGTCTCA；
Cdx-2B:GCGTGGAGTTAGAAAGACAGAAG。
Wherein nearly 3 ' the 3rd the base T of end of Cdx-2F are mutating alkali yl, above-mentioned primer Cdx-2F, Cdx-2B analyze through primer evaluation software, and the Tm value of primer is 58 DEG C by this, and tool appraisal result is better, for PrimerPremier5.0 evaluation result, its Rating value has reached 84。The scoring of the Tm value (being advisable for 55-65 DEG C) that described primer Cdx-2F, Cdx-2B are suitable for, good primer, is suitable for the amplification of described Cdx-2 pleomorphism site DNA fragmentation；And if PCR primer by BseMII enzyme action, can obtain the discernmible suitable endonuclease bamhi length of horizontal gel electrophoresis: 282bp and 42bp。
In above-mentioned steps S02, use the DNA fragmentation of above-mentioned Specific PCR primers amplification Cdx-2 pleomorphism site, it is possible to obtain the pcr amplification product containing BseMII endonuclease recognized site；Owing to the nearly 3 ' ends of specific PCR forward primer and Cdx-2 pleomorphism site contain the base T of artificially replacement at a distance of the position of two bases, so that when Cdx-2 pleomorphism site genotype is G, containing in pcr amplification product can by the site 5 '-CTCAG (N) of BseMII restriction endonuclease identification10-3 ', therefore pcr amplification product by BseMII endonuclease digestion, can respectively obtain the endonuclease bamhi of different length；And when Cdx-2 pleomorphism site genotype is A, now, the pcr amplification product sequence corresponding with BseMII endonuclease recognized site is 5 '-CTCAA (N)10-3 ', therefore, it still can not by BseMII endonuclease digestion, and the length of the PCR primer after enzyme action remains in that constant。As specific embodiment, when the sequence of Specific PCR primers is:
Cdx-2F:TTATATATATTCCTGAGTAAACTAGGTCTCA；
During Cdx-2B:GCGTGGAGTTAGAAAGACAGAAG, described pcr amplification product is as shown in Figure 1, wherein, the genotypic pcr amplification product sequence of Cdx-2 pleomorphism site A is such as shown in SEDIDNO:5, and the genotypic pcr amplification product sequence of Cdx-2 pleomorphism site G is such as shown in SEDIDNO:6。When Cdx-2 pleomorphism site genotype is G, the endonuclease bamhi that length is 282bp and 42bp will be obtained after enzyme action；And when Cdx-2 pleomorphism site genotype is A, now, the pcr amplification product sequence corresponding with BseMII endonuclease recognized site is 5-CTCAA (N)10-3 ', therefore, it still can not by BseMII endonuclease digestion, and the length of the PCR primer after enzyme action remains in that constant, for 324bp。
The above-mentioned DNA fragmentation for expanding Cdx-2 pleomorphism site directly can extract from biological sample and obtain, it is of course also possible to acquired by other approach obtaining this DNA fragmentation。
As the presently preferred embodiments, in described step S02, the PCR amplification system of the DNA fragmentation of described use Specific PCR primers amplification Cdx-2 pleomorphism site is:
PCR response procedures is:
First stage denaturation: 92-95 DEG C/3min；
Second stage: 92-95 DEG C/25-30s, 55-60 DEG C/15-20s, 68-72 DEG C/15-20s；
40-45 circulation altogether。
72 DEG C/5min；
12 DEG C/more than 5min。
As it is preferred that embodiment, PCR amplification system is:
PCR response procedures is:
First stage denaturation: 95 DEG C/3min；
Second stage: 95 DEG C/30s, 55 DEG C/20s, 72 DEG C/20s；Totally 40 circulations,
72 DEG C/5min；12 DEG C/more than 5min。
The PCR primer of above-mentioned preferred PCR amplification system amplification, its electrophoretic band is clear, special, without the assorted band of non-targeted size, also without the assorted band of primer dimer near enzyme action expection small fragment, and largely reduces the workload of instrument and equipment。
The pcr amplification product that the embodiment of the present invention obtains, can be purified further and process the pcr amplification product that acquisition purity is higher。Described purification process can use PCR primer purification kit or the target DNA fragment of similar reagents purification pcr amplification。
In above-mentioned steps S03, use BseMII restriction endonuclease that above-mentioned amplified production is carried out endonuclease reaction and obtain digestion products, genotype according to Cdx-2 pleomorphism site, when Cdx-2 genotype is G, owing to having BseMII endonuclease digestion site, therefore, VDR gene is cut off by BseMII restriction endonuclease, forms two DNA fragmentations；When Cdx-2 genotype is A, owing to not having BseMII endonuclease digestion site in pcr amplification product, therefore, the pcr amplification product through endonuclease reaction process remains complete pcr amplification product length。As specific embodiment, described BseMII (BspCNI) restriction endonuclease can adopt the BseMII that article No. is ER1401 (BspCNI) restriction endonuclease that ThermoScientific company provides or the BseMII that article No. is R0624 (BspCNI) restriction endonuclease that NEB company provides。
As the presently preferred embodiments, in the described step using BseMII restriction endonuclease that above-mentioned amplified production carries out endonuclease reaction, the reaction system of described endonuclease reaction is as follows:
Reaction condition is: overnight incubation under 52-57 DEG C of condition。
As it is preferred that embodiment, described endonuclease reaction system is:
Reaction condition is: overnight incubation under 55 DEG C of conditions。
This preferred endonuclease reaction system can obtain good enzyme action effect, after digestion products electrophoresis, and can the clear each fragment of identification。
In above-mentioned steps S04, the above-mentioned product through endonuclease reaction is carried out electrophoresis。As the presently preferred embodiments, the condition of described electrophoresis be use 2% agarose gel, with TBE for electrophoretic buffer, when 120V voltage stabilizing, electrophoresis 40min。Above-mentioned preferred deposition condition can more effective separation judge the difference of different length endonuclease bamhi。
By above-mentioned electrophoresis result photographic recording nucleic acid electrophoresis band number under imaging system。To can not be complete PCR primer length by the DNA of BseMII enzyme action, i.e. 324bp, the PCR primer can broken by this enzyme action will form two DNA fragmentations of 282bp and 42bp。Same swimming lane only has the DNA band of 1 324bp, represents that this sample Cdx-2 genotype is AA homozygote；Have 282, these 2 bands of 42bp are then for GG homozygote；Have 324,282,3 DNA bands such as 42bp are then for AG heterozygote。Restriction enzyme digestion and electrophoresis result is as in figure 2 it is shown, 1 be wherein homozygote sample that genotype is GG；2 is homozygote sample that genotype is AA；3 is heterozygote sample that genotype is AG；M is DNA molecular amount label (DL2000)。
After above-mentioned steps processes, and the genotype of VDR gene C dx-2 pleomorphism site can be obtained。In order to be verified the reliability of this result further, it can be carried out sequence verification。The 3 kinds of genotype PCR primer mentioned in above-mentioned Fig. 2 send order-checking company to detect, respectively obtain that corresponding GG as shown in Figure 3 is homozygous, AA is homozygous, 3 kinds of sequencing results of GA heterozygous, in Fig. 3, ★ identifies Cdx-2 site, and ☆ identifies design of primers and introduces the base position of sudden change。As can be seen here, the embodiment of the present invention analyzes result genotypic for VDR gene polymorphism sites Cdx-2 accurately and reliably
The method analyzing VDR gene polymorphism sites Cdx-2 that the embodiment of the present invention provides, have only to the conventional inexpensive equipment such as regular-PCR instrument, horizontal cataphoresis apparatus and gel imaging system and can realize the analysis to a large amount of samples, greatly reducing testing cost and analyze difficulty, it is not only simple to operate, with low cost；The more important thing is that the embodiment of the present invention is passed through to search out unconventional BseMII restriction endonuclease, and the nearly 3 ' ends of artificial mutation PCR primer, but a non-final base forms Specific PCR primers, making the mutating alkali yl of described Specific PCR primers build formation with the G allele base of Cdx-2 pleomorphism site can by the restriction enzyme site of BseMII restriction endonuclease identification, it is achieved thereby that by polymerase chain reaction (PolymeraseChainReaction, PCR) Restrictive fragment length polymorphism (RestrictionFragmentLengthPolymorphism after, RFLP) the genotypic new method of Cdx-2 pleomorphism site is analyzed, and the accuracy of the method is high, great many of experiments can be carried out simultaneously。Meanwhile, the method introducing BseMII restriction enzyme site not only can realize PCR-RFLP analysis Cdx-2 loci gene type, and it can get rid of the possibility introducing other endonuclease recognized site, further increases the accuracy of result。Certainly, under the premise not changing BseMII restriction enzyme site, adopt other forward primer also can reach PCR-RFLP and analyze the purpose of Cdx-2 loci gene type。
Correspondingly, the embodiment of the present invention additionally provides the application in obesity epidemic research field of a kind of method analyzing VDR gene polymorphism sites Cdx-2。
Utilize the method analyzing VDR gene polymorphism sites Cdx-2 that the embodiment of the present invention provides, include in from certain city's population epidemiology research and analyze 99 obesities and 82 normal type man's genotypic differences of VDR gene C dx-2。The Hardy-Weinberg (Hardy-Weinberg balance) of this loci gene type distribution verifies sample and has good representativeness。VDR gene C dx-2 loci gene type is shown in shown in table 1 below at the comparative result of fat (n=99) with normal type (n=82) man with allelotype frequency。
Table 1
As seen from the above table, the G gene frequency of overweight people Cdx-2 has the trend (P=0.093) higher than regular severe one, and prompting G allele increases relevant with man's risk of obesity。
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, all any amendment, equivalent replacement and improvement etc. made within the spirit and principles in the present invention, should be included within protection scope of the present invention。
Claims (6)
1. the method analyzing VDR gene polymorphism sites Cdx-2 of non-diseases treatment and diagnostic purpose, comprises the following steps:
Design is for expanding the PCR primer of VDR gene C dx-2 pleomorphism site fragment, and by the base formation Specific PCR primers that PCR primer nearly 3 ' of suddenling change is held, the G allele base of the mutating alkali yl of described Specific PCR primers and Cdx-2 pleomorphism site is formed can by the restriction enzyme site of BseMII restriction endonuclease identification；
The DNA fragmentation using above-mentioned Specific PCR primers amplification Cdx-2 pleomorphism site obtains pcr amplification product；
Use BseMII restriction endonuclease that above-mentioned amplified production is carried out endonuclease reaction and obtain digestion products；
Described digestion products is carried out electrophoresis analytical electrophoresis result,
Wherein, the forward primer Cdx-2F of described Specific PCR primers represents, downstream primer Cdx-2B represents, the sequence of described Cdx-2F, Cdx-2B respectively as shown in SEDIDNO:1, SEDIDNO:2, particularly as follows:
Cdx-2F:TTATATATATTCCTGAGTAAACTAGGTCTCA；
Cdx-2B:GCGTGGAGTTAGAAAGACAGAAG,
Wherein nearly 3 ' the 3rd the base T of end of Cdx-2F are mutating alkali yl。
2. non-diseases treats the method analyzing VDR gene polymorphism sites Cdx-2 with diagnostic purpose as claimed in claim 1, it is characterized in that, the DNA fragmentation of described use Specific PCR primers amplification Cdx-2 pleomorphism site obtains in the step of pcr amplification product, and PCR amplification system is:
PCR response procedures is:
First stage denaturation: 92-95 DEG C/3min；
Second stage: 92-95 DEG C/25-30s, 55-60 DEG C/15-20s, 68-72 DEG C/15-20s；
40-45 circulation altogether,
72 DEG C/5min；
12 DEG C/more than 5min。
3. non-diseases treats the method analyzing VDR gene polymorphism sites Cdx-2 with diagnostic purpose as claimed in claim 1, it is characterized in that, the DNA fragmentation of described use Specific PCR primers amplification Cdx-2 pleomorphism site obtains in the step of pcr amplification product, and PCR amplification system is:
PCR response procedures is:
First stage denaturation: 95 DEG C/3min；
Second stage: 95 DEG C/30s, 55 DEG C/20s, 72 DEG C/20s；Totally 40 circulations
72 DEG C/5min；12 DEG C/more than 5min。
4. the method analyzing VDR gene polymorphism sites Cdx-2 of non-diseases treatment and diagnostic purpose as described in as arbitrary in claims 1 to 3, it is characterized in that, in the described step using BseMII restriction endonuclease that above-mentioned amplified production carries out endonuclease reaction, the reaction system of described endonuclease reaction is as follows:
Reaction condition is: overnight incubation under 52-57 DEG C of condition。
5. the method analyzing VDR gene polymorphism sites Cdx-2 of non-diseases treatment and diagnostic purpose as described in as arbitrary in claims 1 to 3, it is characterized in that, in the described step using BseMII restriction endonuclease that above-mentioned amplified production carries out endonuclease reaction, the reaction system of described endonuclease reaction is as follows:
Reaction condition is: overnight incubation under 55 DEG C of conditions。
6. the method analyzing VDR gene polymorphism sites Cdx-2 of non-diseases treatment and diagnostic purpose as described in as arbitrary in claims 1 to 3, it is characterized in that, the condition of described electrophoresis be use 2% agarose gel, with TBE for electrophoretic buffer, when 120V voltage stabilizing, electrophoresis 40min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410168692.0A CN103952486B (en) | 2014-04-23 | 2014-04-23 | A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410168692.0A CN103952486B (en) | 2014-04-23 | 2014-04-23 | A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103952486A CN103952486A (en) | 2014-07-30 |
| CN103952486B true CN103952486B (en) | 2016-06-22 |
Family
ID=51329833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410168692.0A Active CN103952486B (en) | 2014-04-23 | 2014-04-23 | A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103952486B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003042407A2 (en) * | 2001-11-16 | 2003-05-22 | Boehringer Ingelheim International Gmbh | Method for identifying therapeutic targets by use of genetic screens in drosophila melanogaster |
| CN101251510A (en) * | 2008-03-14 | 2008-08-27 | 毅新兴业（北京）科技有限公司 | Method for testing SNP combining restrictive zyme cutting method and mass spectrometry |
| CN101251511A (en) * | 2008-03-14 | 2008-08-27 | 毅新兴业（北京）科技有限公司 | Method for testing SNP using restriction enzymes double zyme cutting |
| CN101878315A (en) * | 2007-11-30 | 2010-11-03 | 基因特力株式会社 | Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene |
-
2014
- 2014-04-23 CN CN201410168692.0A patent/CN103952486B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003042407A2 (en) * | 2001-11-16 | 2003-05-22 | Boehringer Ingelheim International Gmbh | Method for identifying therapeutic targets by use of genetic screens in drosophila melanogaster |
| CN101878315A (en) * | 2007-11-30 | 2010-11-03 | 基因特力株式会社 | Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene |
| CN101251510A (en) * | 2008-03-14 | 2008-08-27 | 毅新兴业（北京）科技有限公司 | Method for testing SNP combining restrictive zyme cutting method and mass spectrometry |
| CN101251511A (en) * | 2008-03-14 | 2008-08-27 | 毅新兴业（北京）科技有限公司 | Method for testing SNP using restriction enzymes double zyme cutting |
Non-Patent Citations (3)
| Title |
|---|
| Cdx-2 Polymorphism in the Promoter Region of the Human Vitamin DReceptor Gene Determines Susceptibility to Fracture in the Elderly;YUE FANG et al;《JOURNAL OF BONE AND MINERAL RESEARCH》;20031231;第18卷(第9期);1632-1641 * |
| CDX2 VDR Polymorphism and Colorectal Cancer;Martha L.et al;《Cancer Epidemiol Biomarkers Prev》;20071231;第16卷(第12期);2752-2755 * |
| 老年人维生素D受体基因启动子Cdx-2 结合位点多态性研究;孙赞 等;《中国冶金工业医学杂志》;20081231;第25卷(第5期);529-530 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103952486A (en) | 2014-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chang et al. | A distinct Y-STR haplotype for Amelogenin negative males characterized by a large Yp11. 2 (DYS458-MSY1-AMEL-Y) deletion | |
| CN104805206B (en) | The kit and its detection method of detection TERT gene promoter mutation | |
| KR101157526B1 (en) | Snp for diagnosing adhd, microarray and kit comprising the same, and method of diagnosing adhd using thereof | |
| WO2018147438A1 (en) | Pcr primer set for hla gene, and sequencing method using same | |
| CN111518887A (en) | Primer group, kit and method for detecting HLA-B1502 allele | |
| CN110042171A (en) | Identify the method and related molecular marker of Yield Traits of Wheat | |
| WO2012171990A1 (en) | Discrimination of blood type variants | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| Aihara et al. | Optimizing high-resolution melting analysis for the detection of mutations of GPR30/GPER-1 in breast cancer | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN103952486B (en) | A kind of method analyzing VDR gene polymorphism sites Cdx-2 and application | |
| US20210180128A1 (en) | Method to confirm variants in ngs panel testing by snp genotyping | |
| EP3690039A1 (en) | Method for detecting single base substitution using ion exchange chromatography | |
| KR100920369B1 (en) | Primer set, method and kit for selecting ChiVMV-resistant pepper cultivar | |
| JP4454366B2 (en) | MDR1 gene mutation detection method and nucleic acid probe and kit therefor | |
| CN110029162B (en) | SNP marker for detecting susceptibility of systemic lupus erythematosus in non-coding gene region and application thereof | |
| CN105695613A (en) | Method for detecting polymorphism of human gastric cancer susceptible genes IL17A rs3748067 by aid of ApoI | |
| KR101669089B1 (en) | Oligonucleotides for detection test of polymorphism of egfr exon 19 and use thereof | |
| CN105695615A (en) | Method for identifying polymorphism of human breast cancer genes RAD51 rs7180135 by aid of BccI | |
| KR101854896B1 (en) | Single nucleotide polymorphism markers for identifying korean traditional dog breeds and uses thereof | |
| Sinthuwiwat et al. | High-resolution melting curve analysis for genotyping of common SNP in MTHFR gene using fixed-cell suspension | |
| KR20150056004A (en) | Discrimination method for product traceability and identification of chicken using Microsatellite DNA | |
| CN102191329A (en) | Kit for detecting genes related to severe depressions and preparation method thereof | |
| Liu et al. | Development of a POCT detection platform based on a locked nucleic acid-enhanced ARMS-RPA-GoldMag lateral flow assay | |
| JP5047448B2 (en) | CYP2C19 mutation detection method and nucleic acid probe therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |