CN103937810A - Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof - Google Patents
Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof Download PDFInfo
- Publication number
- CN103937810A CN103937810A CN201310027038.3A CN201310027038A CN103937810A CN 103937810 A CN103937810 A CN 103937810A CN 201310027038 A CN201310027038 A CN 201310027038A CN 103937810 A CN103937810 A CN 103937810A
- Authority
- CN
- China
- Prior art keywords
- sequence
- black nightshade
- gene
- metallothionein gene
- super enriching
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the field of gene clone in molecular biology, and specifically relates to a hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and a cloning method thereof. The hyperaccumulator solanum nigrum metallothionein gene sequence is type 3 metallothionein gene, and the gene sequence is shown by a nucleotide sequence in SEQ ID NO. 1. The successive cloning and sequencing of the hyperaccumulator solanum nigrum type 3 metallothionein gene helps to establish a base for further analyzing the biological stress resistant capability under the influence of MT-L3, and screening and applying other functions of MT-L3.
Description
Technical field
The invention belongs to gene clone field in molecular biology, specifically a kind of super enriching plant black nightshade metallothionein gene (MT-L3) sequence and cloning process thereof.
Background technology
Metallothionein(MT) (Metallothionein, MTs) be a class lower molecular weight, high Cys content, there is the polypeptide of melts combine ability, in the horse nephridial tissue of accumulating cadmium, find, and the albumen with animal MTs homology separating in plant is called as plant metallothionein(MT) (Metallothionein Like, MT-L).From Soybean Root, found in 1977 by Casterline and Barnett the earliest.According to the position of Cys and arrangement mode, plant metallothionein(MT) is divided into three classes.MT-L1 has 6 Cys-X-Cys unit, and C end and N end structure territory respectively contain 3, the transcribed spacer that does not contain Cys being formed by approximately 40 amino-acid residues between 2 structural domains, and transcribed spacer amino-acid residue is more is the common trait of most plant MT; MT-L2 and MT-L1 are similar, but first and second Cys occur with Cys-Cys form, and be usually located at third and fourth of polypeptide chain, N end has the sequence MSCCGGNCGCG of a high conservative more, there are 3 Cys-X-Cys unit in C end structure territory, the maximum difference of MT-L1 and MT-L2 is that the former Cys concentrates the N end and the C end that are distributed in peptide chain, and centre is not connected containing the transcribed spacer of Cys by one section, and the latter's Cys is dispersed in whole peptide chain; MT-L3 is non-genomic coded product, be taking gsh as the anabolic polymer of substrates enzymes, have 4 Cys at N end, before 3 arrange mainly with Cys-Gly-Asn-Cys-Asp-Cys mode, the 4th Cys comprises in Gln-Cys-X-Lys-Lys-Gly unit conventionally, and there are 6 Cys in C end structure territory.MT-L4 comprises 3 structural domains that are rich in Cys, eachly comprises 5-6 Cys residue, is the transcribed spacer of 10-15 amino-acid residue composition between structural domain, and most Cys exist with the form of Cys-X-Cys.MT-L by Cys residue-SH can form with the heavy metal ion such as Cd, Zn chelating the complex compound of nontoxic or low toxicity, there is redox reaction in free radical, the ROS that can also bring out generation with the stress conditions such as heavy metal, thereby reduces oxidative damage.Member's great majority of plant MT-L gene family are dispersed in whole genome in the mode of single copy or two copies.Plant MT-L genetic expression has tissue and organ specificity and etap specificity, most study is the impact of metal ion on plant MT-L genetic expression at present, the tolerance that studies have reported that plant MT-L gene and heavy metal Cd has certain dependency, but it is still not fully aware of that metal ion affects the mechanism of MT-L genetic expression, particularly in heavy metal super-enriched plant MT-L gene to play the part of role be how the study hotspot in this field at present actually.
It is the plant with the super enrichment characteristics of Cd by known black nightshade in ZL200410021546.1 patent (Solanum nigrum L.), show by analysis: black nightshade Cd content in soil is under 20-110mg/kg condition, in its plant leaf or stem, Cd content range is 110-496mg/kg, exceed the critical content standard that this Cd super enriching plant of 100mg/kg should reach, and there is the further feature of super enriching plant; Green plant test shows: be 25.0 and when 50.0mg/kg in Cd pollution level, in this axis and leaf, Cd content exceedes the critical content standard that this Cd super enriching plant of 100mg/kg should reach; Plot experiment and zone of pollution sampling test also show: this plant also shows the essential characteristic of Cd super enriching plant.Therefore, can determine that this patent plant used is Cd super enriching plant.In addition, research shows: black nightshade is shorter breeding time, conventionally only has about 80 days, takes florescence harvesting approach can gather in the crops for two seasons in 1 year in areas of Shenyang, at least can grow a season in Jilin and Heilongjiangdistrict.Its plant height is generally 80-150cm, and biomass is larger, and Root Distribution is wide, and plant type compactness is suitable as the rehabilitation plant of heavy metal Cd contaminated soil very much.Therefore, research super enriching plant black nightshade metallothionein gene is for disclosing and utilizing its removing toxic substances system of defense function significant.
Summary of the invention
The object of the present invention is to provide a kind of super enriching plant black nightshade metallothionein(MT) (MT-L3) gene order and cloning process thereof.
The technical solution used in the present invention is for achieving the above object:
A kind of super enriching plant black nightshade metallothionein gene sequence, super enriching plant black nightshade metallothionein gene sequence is 3 shaped metal metallothionein genes, its gene order is in SEQ ID NO.1 shown in nucleotide sequence.
Super enriching plant black nightshade 3 shaped metal metallothionein gene sequence encoding albumen, super enriching plant black nightshade 3 shaped metal metallothionein gene sequence encoding albumen are in SEQ ID NO.2 shown in aminoacid sequence.
The cloning process of super enriching plant black nightshade 3 shaped metal metallothionein gene sequences first extracts total RNA from fresh and alive black nightshade blade; Then utilize ThermoScript II AMV and reverse transcription primer to synthesize the first chain cDNA; Then, taking the first chain cDNA of synthesizing as template, utilize degenerate primer MT-L3-F(5 '-ATGTCGGACAAGTGYRGYARTTG-3 ') and MT-L3-R(5 '-TTAATGAGCACAAGTGCAGTTAAC-3 ') carry out pcr amplification; PCR product cloning, to pMD-18T carrier, is got to positive colony through the final super enriching plant black nightshade 3 shaped metal metallothionein gene sequence SEQ ID NO.1 that obtain that check order.
Tool of the present invention has the following advantages:
1. adopt the successful Cloning and sequencing of the present invention to super enriching plant black nightshade 3 shaped metal metallothionein genes, determine first its whole encoding sequences, thereby also understand fully the aminoacid sequence that it is coded, this sequence can be cloned this gene again in order to design primer, and the aminoacid sequence that also can derive according to this sequence or this sequence carries out recombinant expressed or transgenosis to this gene.
2. the successful Cloning and sequencing of super enriching plant black nightshade 3 shaped metal metallothionein genes, for further analyzing the lower biological anti-adversity ability of MT-L3 impact, for screening and the application of other function of MT-L3 are laid a good foundation;
3. utilize the expression of gained MT-L3 gene pairs different concns pollutent of the present invention to be used as heavy metal super-enriched plant screening implement methodological guidance is provided.
Brief description of the drawings
The electrophorogram of the super enriching plant black nightshade 3 shaped metal metallothionein gene PCR that Fig. 1 provides for the embodiment of the present invention 2.
The design sketch that the Cd Stress treatment that Fig. 2 provides for the embodiment of the present invention 3 can significantly induce MT-L3 to express.
Embodiment
The present invention, by the 3 shaped metal metallothionein gene sequences of black nightshade in GeneBank are compared, utilizes the homology region design degenerated primer of all black nightshade 3 shaped metal metallothionein gene sequences of Primer Express Software v2.0 software analysis of ABI company; Its cloning process comprises: (1) is by analyzing homology region design degenerated primer MT-L3-F and the MT-L3-R of black nightshade 3 shaped metal metallothionein genes; (2) from fresh and alive super enriching plant black nightshade blade, extract total RNA; (3) utilize ThermoScript II AMV and reverse transcription primer (random primer) to synthesize the first chain cDNA; (4) taking the first chain cDNA of synthesizing as template, utilize degenerate primer MT-L3-F and MT-L3-R to carry out pcr amplification, amplified fragments size is about 200bp; In addition, described degenerate primer can also be SEQ ID NO.1 nucleotide sequence fragment in sequence table; (5) Clone and sequence finally obtains super enriching plant black nightshade 3 shaped metal metallothionein gene nucleotide sequence SEQ ID NO.1.
The present invention is cloned into a kind of 3 shaped metal metallothionein genes first from super enriching plant black nightshade, this sequence cDNA total length 200bp, and wherein open reading frame is positioned at 1-198 position Nucleotide, 65 amino-acid residues of encoding.
Embodiment 1
Black nightshade MT-L3 gene is as shown in SEQ ID NO.1:
atgacggaca?agtgtagcaa?ttgcgattgc?gctgatgtca?gccaatgcgt?gaggaaggagagccaatatg?atgtcgtcat?cgtcgaaaag?agctacatcg?agacggtggt?gatgatggacgttggagcgg?aagaacatga?tggaaaatgc?aaatgcggca?gcagctgcgc?ctgtgttaactgcacttgtg?ctcattaaaa
(a) sequence signature:
● length: 200bp 1-198 position Nucleotide
● type: nucleotide sequence
● chain: strand
● topological framework: linearity
(b) molecule type: double-stranded DNA
(c) suppose: no
(d) antisense: no
(e) originate at first: black nightshade
The cloning process of embodiment 2 black nightshade MT-L3 genes
The method of cloning MT reconnaissance-L3 gene from black nightshade is:
(1) from fresh and alive super enriching plant black nightshade blade, extract total RNA;
(2), taking total RNA as template, utilize ThermoScript II AMV and random primer (Random Primers, Invitrogen, the U.S.) to synthesize the first chain cDNA;
(3) taking the first chain cDNA of synthesizing as template, utilize degenerate primer MT-L3-F and MT-L3-R to carry out pcr amplification, amplified fragments size is about 200bp(and sees Fig. 1);
(4) by PCR product cloning to pMD-18T carrier, get positive colony through the final super enriching plant black nightshade 3 shaped metal metallothionein gene sequences that obtain that check order.
Wherein said primer comprises:
MT-L3-F：5’-ATGTCGGACAAGTGYRGYARTTG-3’
MT-L3-R：5’-TTAATGAGCACAAGTGCAGTTAAC-3’
Concrete operations condition is as follows:
1.RNA extraction step
(1) total RNA extracts:
Take 1.5g leaf tissue and put into the stone roller alms bowl of crossing with Liquid nitrogen precooler, in liquid nitrogen, be ground to Powderedly, go to without in RNA enzyme, apyrogenic 1.5ml Eppendorf pipe, add 1ml Trizol, with QIAGEN Tissue Ruptor homogenate; Room temperature is placed 10 minutes, adds 200 μ l chloroforms, fully mixes centrifugal 5 minutes of 15000rpm; Get supernatant, add 600 μ l chloroforms to 1.5ml Eppendorf pipe, mix centrifugal 5 minutes of 15000rpm; Get supernatant, add 500ul Virahol to 1.5ml Eppendorf pipe, mix centrifugal 10 minutes of 15000rpm; Abandon supernatant, with 75% ethanol 1ml flushing of precooling, centrifugal 5 minutes of 13000rpm; Abandon supernatant, RNA is deposited in air drying 3 minutes; Dried RNA is dissolved in to DEPC and processes in water, to dissolving completely.Total RNA is done after suitably dilution, and ultraviolet spectrophotometer is surveyed OD
260/ OD
280ratio, and quantitatively.Quantitative equation: RNA concentration (μ g/ml)=OD
260value × 40 × extension rate (this experiment is 400 times)
2. reverse transcription reaction
(1) in 1.5ml centrifuge tube, add in the following order following component:
Note: the cumulative volume of total RNA and DEPC water is 8 μ l, wherein total RNA amount is 2 μ g;
(2) 65 DEG C of water-baths of above-mentioned reaction solution 5 minutes, room temperature leaves standstill 10 minutes, centrifugal 5 seconds of 10000rpm.
(3) in the following order to adding following component in above-mentioned centrifuge tube: reactant (after adding, cumulative volume is 20ul):
At 40 DEG C of water-baths, react after 1 hour, process 10 minutes for 90 DEG C, ice bath 5 minutes, 10000rpm was from 5 seconds.
3. by following component preparation PCR reaction system:
PCR reaction conditions: 1 circulation, 95 DEG C of sex change 2min; 40 circulations, 94 DEG C of sex change 10sec; 60 DEG C of annealing 10sec; 72 DEG C are extended 40sec; 1 circulation, 72 DEG C are extended 1min; 4 DEG C of insulations.
The clone of 4.PCR product
The PCR product obtaining carries out after separation detection on 1.2% agarose gel electrophoresis, uses sepharose DNA to reclaim test kit purified pcr product; To reclaim fragment is connected with pMD-18T carrier; To all connect product and be transformed into intestinal bacteria DH-5 α competent cell, spend the night at the flat board that contains penbritin (100 μ g/ml) and the chloro-3-indoles-D-of the bromo-4-of 5-galactoside (X-ga l0.2 μ g/ml), picking hickie, in LB liquid nutrient medium (5ml, containing 100 μ g/ml penbritins) incubated overnight.
5. plasmid purification and order-checking
Get incubated overnight bacterium liquid 1-2ml, centrifugal 1 minute of 10000rpm, collecting cell, with minim DNA purification kit plasmid purification, the operation of step by specification.Plasmid is sent with order-checking company and checked order.
Obtain the cDNA sequence of goal gene according to above-mentioned PCR product cloning, plasmid purification and order-checking step, cDNA total length 200bp, wherein open reading frame is positioned at 1-198 position Nucleotide, 65 amino-acid residues of encoding.The amino acid of MT-L3 has the sequence shown in SEQ ID NO.2.
SEQ?ID?NO.2
MTDKCSNCDC?ADVSQCVRKE?SQYDVVIVEK?SYIETVVMMD?VGAEEHDGKC?KCGSSCACVN?CTCAH
(a) sequence signature:
● length: 65aa
● type: aminoacid sequence
● chain: strand
● topological framework: linearity
(b) molecule type: protein
(c) suppose: no
(d) antisense: no
(e) originate at first: black nightshade
The cDNA homology sequence comparison of embodiment 2MT-L3
Super enriching plant black nightshade (Solanum nigrum L.) the cDNA sequence of 3 shaped metal sulfoproteins obtaining with the present invention and the protein sequence of coding thereof, in GenBank database, carry out Nucleotide and albumen homology comparison with BLAST software (http://www.ncbi.nim.nih.gov/), comparison result is:
According to being less than 0.005 by E-Value value after the comparison of BLAST software between two sequences, between two sequences, there is absolute homology, prove that sequence is same gene order.The E value of seeing the gene order of black nightshade and the MT-L3 gene of other species from comparison result is all less than 0.005, and homology is greater than 67%, so prove that the goal gene of cloning is the homologous sequence of MT-L3 gene.
Protein structure feature comprises: molecular weight is 7061.0 dalton (Da), and iso-electric point (pI) is 4.67.In amino acid composition, halfcystine (Cys) and α-amino-isovaleric acid (Val) proportion are higher, account for respectively 15.4% and 13.8%; Contain minute quantity die aromatischen Aminosaeuren, tyrosine (Tyr) accounts for 3.1%, and Histidine (His) accounts for 3.1%, without phenylalanine (Phe).Structure comprises that α spiral accounts for 9.2%, random curlingly accounts for 63.1%, and extended chain accounts for 27.7%.In the aminoacid sequence of being derived by nucleotide sequence, contain altogether 10 halfcystines (Cys is abbreviated as C), they and the amino acid being close to have formed the conservative property structure C-X of several metallothionein(MT)s
n-C, wherein 4 C-X-C structures, 2 C-X-X-C structures, 1 C-X-X-X-C structure, also has 1 C-X-X-X-X-X-C structure.Sequence shown in SEQ ID NO.2 has 4 Cys at N end, and there are 6 Cys in C end structure territory.Therefore, this aminoacid sequence is the 3 shaped metal sulfoproteins of black nightshade.
Embodiment 3 expression of super enriching plant black nightshade 3 shaped metal sulfoproteins under different concns Cd coerces
To have black nightshade seedling shown in above-mentioned sequence table SEQ ID NO.1 plants in adding different concns Cd(2.5mg/kg, 5mg/kg and 40mg/kg) and without adding in the soil of Cd to the ripening stage, get different treatment group (2.5mg/kg, 5mg/kg and 40mg/kg) and control group (processing without Cd) total RNA of black nightshade blade, method for extracting total RNA is referring to above-described embodiment, utilize quantitative real time PCR Instrument (ABIStep-One Plus Real Time PCR System, the U.S.) do differential expression analysis, quantification PCR primer is MT-L3-F and MT-L3-R.Result shows, Cd Stress treatment can significantly be induced the expression of MT-L3, respectively 2.4 times, 3.7 times and 31.3 times of (see figure 2)s of contrast, the ability that can tolerate and accumulate in a large number heavy metal Cd with black nightshade is closely related, and therefore this gene can be in the future for plant genetic engineering and heavy metal phytoremediation for soil.
Claims (3)
1. super enriching plant black nightshade metallothionein gene (MT-L3) sequence, is characterized in that: super enriching plant black nightshade metallothionein gene sequence is 3 shaped metal metallothionein genes, and its gene order is in SEQ ID NO.1 shown in nucleotide sequence.
2. super enriching plant black nightshade metallothionein gene claimed in claim 1 (MT-L3) sequence encoding albumen, is characterized in that: super enriching plant black nightshade 3 shaped metal metallothionein gene sequence encoding albumen are in SEQ ID NO.2 shown in aminoacid sequence.
3. a cloning process for super enriching plant black nightshade metallothionein gene claimed in claim 1 (MT-L3) sequence, is characterized in that: first from fresh and alive black nightshade blade, extract total RNA; Then utilize ThermoScript II AMV and reverse transcription primer to synthesize the first chain cDNA; Then, taking the first chain cDNA of synthesizing as template, utilize degenerate primer MT-L3-F(5 '-ATGTCGGACAAGTGYRGYARTTG-3 ') and MT-L3-R(5 '-TTAATGAGCACAAGTGCAGTTAAC-3 ') carry out pcr amplification; PCR product cloning, to pMD-18T carrier, is got to positive colony through the final super enriching plant black nightshade 3 shaped metal metallothionein gene sequence SEQ ID NO.1 that obtain that check order.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310027038.3A CN103937810B (en) | 2013-01-22 | 2013-01-22 | Super enriching plant black nightshade metallothionein gene（MT‑L3）Sequence and its cloning process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310027038.3A CN103937810B (en) | 2013-01-22 | 2013-01-22 | Super enriching plant black nightshade metallothionein gene（MT‑L3）Sequence and its cloning process |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937810A true CN103937810A (en) | 2014-07-23 |
| CN103937810B CN103937810B (en) | 2017-05-31 |
Family
ID=51185682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310027038.3A Expired - Fee Related CN103937810B (en) | 2013-01-22 | 2013-01-22 | Super enriching plant black nightshade metallothionein gene（MT‑L3）Sequence and its cloning process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937810B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117551656A (en) * | 2023-10-26 | 2024-02-13 | 六盘水师范学院 | AcMT3b gene and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010097746A1 (en) * | 2009-02-26 | 2010-09-02 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Metallothionein gene conferring abiotic stress tolerance in plants and uses thereof |
| CN102154315A (en) * | 2011-01-17 | 2011-08-17 | 鲁东大学 | Ipomoea batatas metallothionein gene (IbMT1) and application thereof in improving salt resistance and drought resistance of plants |
| CN102311959A (en) * | 2011-09-16 | 2012-01-11 | 昆明理工大学 | Yunnan red pear-1 metallothionein gene PyMT1 and prokaryotic expression vector and application thereof |
| WO2012115185A1 (en) * | 2011-02-23 | 2012-08-30 | 北海道公立大学法人札幌医科大学 | Composition for treatment, amelioration or prophylaxis of pain |
-
2013
- 2013-01-22 CN CN201310027038.3A patent/CN103937810B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010097746A1 (en) * | 2009-02-26 | 2010-09-02 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Metallothionein gene conferring abiotic stress tolerance in plants and uses thereof |
| CN102154315A (en) * | 2011-01-17 | 2011-08-17 | 鲁东大学 | Ipomoea batatas metallothionein gene (IbMT1) and application thereof in improving salt resistance and drought resistance of plants |
| WO2012115185A1 (en) * | 2011-02-23 | 2012-08-30 | 北海道公立大学法人札幌医科大学 | Composition for treatment, amelioration or prophylaxis of pain |
| CN102311959A (en) * | 2011-09-16 | 2012-01-11 | 昆明理工大学 | Yunnan red pear-1 metallothionein gene PyMT1 and prokaryotic expression vector and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| CAI,L.J.: "Genbank登录号：FJ546425.1", 《GENBANK》 * |
| PEDRO FERRAZ等: "Phytostabilization of nickel by the zinc and cadmium hyperaccumulator Solanum nigrum L. Are metallothione", 《PLANT PHYSIOLOGY AND BIOCHEMISTRY》 * |
| 范仲学 等: "龙葵金属硫蛋白基因的克隆及其功能分析", 《第六届中国植物逆境生理学与分子生物学学术研讨会论文摘要汇编》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117551656A (en) * | 2023-10-26 | 2024-02-13 | 六盘水师范学院 | AcMT3b gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937810B (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Recchia et al. | Arbuscular mycorrhizal symbiosis leads to differential regulation of drought-responsive genes in tissue-specific root cells of common bean | |
| Ran et al. | Fast evolution of the retroprocessed mitochondrial rps3 gene in Conifer II and further evidence for the phylogeny of gymnosperms | |
| CN108048415B (en) | Two myricetin flavonol synthetase MrFLSs proteins and application of coding genes thereof | |
| Liu et al. | Identification of candidate genes conferring tolerance to aluminum stress in Pinus massoniana inoculated with ectomycorrhizal fungus | |
| CN109081865B (en) | Phyllostachys pubescens PeVQ28 protein and coding gene and application thereof | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN109880829B (en) | Barley HvPAA1 gene and application thereof | |
| CN103937809A (en) | Hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and cloning method thereof | |
| CN104480120A (en) | Plant salt-tolerant related gene PpSIG2 as well as encoding protein and application thereof | |
| CN103937810A (en) | Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof | |
| CN101988065A (en) | Haliotis diversicolor calmodulin cDNA sequence | |
| CN111172318B (en) | Rpl32-trnL molecular marker for molecular identification of sinojackia pulp and application thereof | |
| CN114891814A (en) | Application of gene PlRAB6 in regulation and control of phytophthora litchi pathogenicity | |
| CN107287169A (en) | A kind of eggplant cytochrome P450 gene StCYP84A and its preparation method and application | |
| CN114292856A (en) | Gene PeCLH2 for regulating and controlling salt tolerance of populus euphratica and application thereof | |
| CN107446031A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application | |
| CN110156882B (en) | Loquat EjAP3 gene and its coded protein and application | |
| Yu et al. | Genome-wide identification and expression analysis of the zinc transporter protein zip family in potato (Solanum tuberosum). | |
| CN104894150A (en) | A saussurea involucrata cell phenylalanine ammonia lyase gene SiPAL, a coding product thereof and applications of the gene | |
| CN105671052B (en) | Efficiently quickly inhibit the method for Bermuda grass endogenous gene expression | |
| Barthet | Expression and Function of the Chloroplast-encoded Gene matK | |
| Özgen et al. | Analysis of ancient DNA from in vitro grown tissues of 1600-year-old seeds revealed the species as Anagyris foetida | |
| Vernie et al. | Conservation of symbiotic signalling across 450 million years of plant evolution | |
| CN108103071A (en) | Chinese herbaceous peony HpLEA genes and its application | |
| CN115125254B (en) | Kiwi fruit root development gene AcEXPA23 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170531 Termination date: 20180122 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |