CN103924000B - LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant - Google Patents
LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant Download PDFInfo
- Publication number
- CN103924000B CN103924000B CN201410176842.2A CN201410176842A CN103924000B CN 103924000 B CN103924000 B CN 103924000B CN 201410176842 A CN201410176842 A CN 201410176842A CN 103924000 B CN103924000 B CN 103924000B
- Authority
- CN
- China
- Prior art keywords
- primer
- cry3a
- gene
- dna
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP detecting primer group, a kit and a detecting method for a cry3A gene in transgenic plant. The primer group consists of 5 specific primers with nucleotide sequences as shown in SEQ ID NO:1-5. The detecting kit comprises detecting primer liquor, loop primer liquor, DNA polymerase with strand displacement activity, 10*reaction buffer liquor, dNTPs liquor, positive DNA contrast and negative DNA contrast. The kit further contains a color developing agent. The detecting method adopts the specific primers and the DNA polymerase with the strand displacement activity to carry out amplification onto a sample DNA template at 63 DEG C-65 DEG C, and adopts a method of adding the color developing agent to observe color changes or to directly observe turbidity change of precipitates in a reaction tube, and the like, to judge whether the sample contains the cry3A gene component or not. The LAMP detecting primer group, kit and detecting method disclosed by the invention do not need a special apparatus, have the characteristics of being quick and efficient, simple and convenient to operate, strong in specificity, high in sensitivity, and the like, and are suitable for site detection.
Description
Technical field
The invention belongs to technical field of molecular biology, relate to the detection method of transgenic plant and products thereof, be specifically related to one and utilize in loop-mediated isothermal amplification technique (LAMP) rapid detection transgenic plant
cry3Athe primer sets of gene, test kit and detection method.
Background technology
Within 2013, global genetically modified crops cultivated area is up to 1.752 hundred million hectares, increases more than 100 doubly than the commercialization initial stage in 1996.The genetically modified crops of current commercial growth mainly contain soybean, corn, cotton, rape, and major traits is pest-resistant, antiweed.The goal gene applied in insect-resistant transgenic plants has
cry1Ab,
cry1Ac,
cry1A.105,
cry1F, cry2Ab,
cry3A,
cry3Bb, vip3A, cry9Cdeng, wherein
cry3Agene is present in transgenic corns MIR604, got permission at nearly 20 countries and regions commercial growth such as the U.S., European Union, Australia, Russia, Korea S, South Africa or as food and feed, China also ratified transgenic corns MIR604 import as processing raw material in 2008.
For strengthening the security control of genetically modified organism and products thereof, genetically modified organism mark system has been worked out in countries and regions, more than 50, the whole world.China has issued and implemented a series of supporting management ways such as " agriculture GMO bio-safety management rules " and safety evaluation, identity management, import security, processing examination & approval in succession in calendar year 2001, full industrial chain supervision is carried out to genetically modified organism, requires to implement mandatory identity management system to 5 class, 17 kinds of products such as transgenic corns, soybean, rape, cotton, tomatoes.
Detection GMOs technology is that the important technology of GMO bio-safety management supports.Current detection GMOs technology is mainly divided into two large classes: a class is detected object with foreign DNA, as PCR, gene chip etc., another kind of with the protein of exogenous gene expression for detected object, as ELISA, immunity test strip etc.In the above-mentioned methods, PCR method is most widely used, but the transgenic detection method of PCR-based technology needs the special instrument such as PCR instrument, gel imaging system equipment, and amplification and product detection time, longer (about 3 ~ 4 h), be difficult to realize field quick detection, therefore, need in real work a kind of more convenient, accurate and be applicable to the detection GMOs new technology of execute-in-place.
LAMP technology is that the basic characteristics of this technology are: 1. constant-temperature amplification: whole amplified reaction carries out at constant temperature (60 ~ 65 DEG C), does not need special instruments and equipment by a kind of new gene amplification of Japanese Eiken Chemical exploitation in 2000; 2. rapidly and efficiently: whole amplification and product detect and can complete in 1 h; 3. high specific: 6 zone design 4 for target sequence detect primer, and specific amplification is high; 4. highly sensitive: limit of detection can be low to moderate 10 copies or lower; 5. identify easy: amplified production has multiple authentication method, the turbidity change precipitated in turbidimeter observing response pipe as visual inspection or utilize, add dyestuff and observe colour-change etc.
LAMP method has rapidly and efficiently, easy and simple to handle, high specificity, sensitivity high, does not need specific apparatus, is applicable to field quick detection, has broad application prospects in transgenic plant detection field.LAMP method is not yet utilized to detect in transgenic plant at present
cry3Athe detection method of gene and test kit.
Summary of the invention
One object of the present invention is in open a kind of transgenic plant
cry3Athe LAMP detection primer group of gene.
Another object of the present invention is in open a kind of transgenic plant
cry3Athe LAMP detection kit of gene.
Another object of the present invention is that open one detects in transgenic plant based on above-mentioned primer sets and test kit
cry3Athe LAMP detection method of gene.
The technical solution adopted in the present invention is as follows:
According to
cry3Athe nucleotide sequence of gene, design
cry3Athe LAMP detection primer group of gene, its nucleotide sequence is as SEQ ID NO:1 ~ 5; Determine the technical parameter of LAMP detection method, and the specificity of detection method, sensitivity are verified.
In transgenic plant
cry3Athe LAMP detection primer group of gene, comprises outer primer 1, outer primer 2, inner primer 1, inner primer 2, ring primer, and its nucleotide sequence is as follows respectively:
Outer primer 1:AAGCCCCACCTGTTCGA(SEQ ID NO:1);
Outer primer 2:GGCTCGCTGCTCTTGTTG(SEQ ID NO:2);
Inner primer 1:AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC(SEQ ID NO:3);
Inner primer 2:GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA(SEQ ID NO:4);
Ring primer: GGGCTGGAAACGCGTGT(SEQ ID NO:5).
In transgenic plant
cry3Athe LAMP detection kit of gene, comprises following component:
(1) detect primer solution: the detection primer solution prepared by 2 outer primers and 2 inner primers, the concentration of outer primer 1, outer primer 2, inner primer 1 and inner primer 2 is followed successively by 4 ~ 6 μm of ol/L, 4 ~ 6 μm of ol/L, 32 ~ 48 μm of ol/L and 32 ~ 48 μm ol/L;
(2) ring primer solution: ring primer concentration is 16 ~ 24 μm of ol/L;
(3) there is the archaeal dna polymerase of strand-displacement activity: concentration is 7 ~ 9 U/ μ L;
(4) 10 × reaction buffers: 200 mmol/L Tris-HCl (pH 8.8), 100 mmol/L KCl, 100 mmol/L (NH
4)
2sO
4, 40 ~ 100 mmol/L MgSO
4, 6 ~ 14 mol/L trimethyl-glycines;
(5) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10 mmol/L by concentration mix;
(6) positive DNA control sample, turns
cry3Athe genomic dna of gene plant, or contain
cry3Athe e. coli plasmid dna of gene order;
(7) negative DNA control sample: do not contain
cry3Athe DNA of gene order.
Preferably, containing 5 μm of ol/L outer primers, 1,5 μm of ol/L outer primers, 2,40 μm of ol/L inner primers, 1,40 μm of ol/L inner primers 2 in described detection primer solution.
Preferably, containing 20 μm of ol/L ring primers in described ring primer solution.
Preferably, the described archaeal dna polymerase with strand-displacement activity is Bst archaeal dna polymerase, and concentration is 8 U/ μ L.
Preferably, MgSO in 10 described × reaction buffer
4, beet paper mill wastewater is respectively 80 mmol/L and 8 mol/L.
Of the present invention
cry3Acan also contain developer in the LAMP detection kit of gene, described developer is SYBR GREEN I fluorescence dye.
Above-described test kit is utilized to detect
cry3Athe method of gene, comprises the steps:
(1) genomic dna of testing sample is extracted: CTAB method or plant genome DNA extract the genomic dna that test kit extracts testing sample routinely;
(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ L PCR reaction tubess, add template DNA 2 ~ 5 μ L, detect primer solution 1.5 μ L, ring primer solution 1 μ L, Bst archaeal dna polymerase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L, with sterilizing deionized water polishing to 25 μ L;
(3) the LAMP detection reaction system of control sample is prepared: when preparation positive control, negative control reaction system, except template DNA being changed respectively into positive DNA control sample, negative DNA control sample, other components are consistent with step (2);
(4) LAMP amplified reaction is run: hatch 30 ~ 60min for 63 ~ 65 DEG C, hatch 5min termination reaction for 80 DEG C;
(5) qualification of LAMP amplification: the turbidity change precipitated in turbidimeter observing response pipe by visual inspection or utilize judges amplification, or get 2 ~ 5 μ L amplified productions and carry out agarose gel electrophoresis and detect amplification.
In test kit containing developer, in the LAMP amplified production that step (4) obtains afterwards, add 1 ~ 2 μ L developer, judge amplification by visual inspection colour developing result.
Prove by experiment, provided by the invention
cry3AlAMP detection primer group, the test kit of gene and detection method has rapidly and efficiently, easy and simple to handle, high specificity, sensitivity advantages of higher.
Accompanying drawing explanation
Fig. 1 is the LAMP detected result figure of embodiment 1, and 1 is positive control sample, and 2 is negative control sample, and 3,4 is testing sample;
Fig. 2 is the LAMP detected result figure of embodiment 2, and 1 is positive control sample, and 2 is negative control sample, and 3,4 is testing sample;
Fig. 3 is the result figure carrying out specific detection in embodiment 3,1 ~ 15 is followed successively by transgenic corns MON89034, MON810, Bt11, Bt176, transgene cotton MON531, MON15985, transgenic paddy rice KF-6, TT51-1, genetically modified corn MON 863, MON88017, MIR604, TC1507,59122, non-transgenic corn negative control, blank;
Fig. 4 and Fig. 5 is the result figure carrying out sensitivity technique in embodiment 4,1 ~ 7 be followed successively by transgenic corns MIR604 massfraction be respectively 100%, 10%, 1%, 0.1%, 0.05%, 0..02%, 0.01% test sample, 8 is non-transgenic corn sample, and M is DNA molecular amount Marker.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.
Embodiment 1 is not containing test kit and the detection method thereof of developer:
By following formula preparation
cry3Athe LAMP detection kit of gene:
(1) primer solution is detected: synthesis outer primer 1, outer primer 2, inner primer 1 and inner primer 2, primer dry powder sterilizing deionized water is made into the mother liquor that concentration is 100 μm of ol/L respectively, then get 7.5 μ L outer primer 1,7.5 μ L outer primer 2,60 μ L inner primer 1,60 μ L inner primer 2,15 μ L sterilizing deionized waters, fully mixing is made into 150 μ L's
cry3Athe LAMP detection primer solution of gene, wherein primer sequence is respectively:
Outer primer 1:AAGCCCCACCTGTTCGA(SEQ ID NO:1);
Outer primer 2:GGCTCGCTGCTCTTGTTG(SEQ ID NO:2);
Inner primer 1:AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC(SEQ ID NO:3);
Inner primer 2:GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA(SEQ ID NO:4);
(2) ring primer solution: synthesis ring primer, is made into primer dry powder sterilizing deionized water the mother liquor that concentration is 100 μm of ol/L, then gets 20 μ L ring primers, 80 μ L sterilizing deionized waters, and fully mixing is made into 100 μ L's
cry3Athe LAMP ring primer solution of gene, wherein primer sequence is:
Ring primer: GGGCTGGAAACGCGTGT(SEQ ID NO:5);
(3) Bst archaeal dna polymerase, concentration is 8 U/ μ L;
(4) 10 × reaction buffers: 200 mmol/L Tris-HCl (pH 8.8), 100 mmol/L KCl, 100 mmol/L (NH
4)
2sO
4, 80 mmol/L MgSO
4, 8 mol/L trimethyl-glycines;
(5) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10 mmol/L by concentration mix;
(6) positive DNA control sample, turns
cry3Athe genomic dna of gene plant, or contain
cry3Athe e. coli plasmid dna of gene order;
(7) negative DNA control sample: do not contain
cry3Athe DNA of gene order.
By the following method testing sample is detected with above-mentioned test kit:
(1) extract the genomic dna of testing sample: adopt the plant DNA extraction kit method that Beijing Tian Gen company produces, extract the genomic dna of testing sample;
(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ L PCR reaction tubess, add template DNA 2 μ L, detect primer solution 1.5 μ L, ring primer solution 1 μ L, Bst archaeal dna polymerase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L, with sterilizing deionized water polishing to 25 μ L;
(3) the LAMP detection reaction system of control sample is prepared: when preparation positive control, negative control reaction system, except template DNA being changed respectively into positive DNA control sample, negative DNA control sample, other components are consistent with step (2);
(4) reaction tubes is placed in turbidimeter, runs LAMP amplified reaction: hatch 40min for 63 DEG C, hatch 5min termination reaction for 80 DEG C;
(5) qualification of LAMP amplification: utilize the turbidity of precipitation in real-time turbidimeter (Japanese Rong Yan company) observing response pipe change (being reflected as real-time amplification curve) to judge amplification.
In the present embodiment, positive control has precipitation to produce (occurring typical amplification curve), and negative control produces (without typical amplification curve) without precipitation; There is precipitation in the reaction tubes of testing sample 1, shows to contain
cry3Agene element; There is not precipitation in the reaction tubes of testing sample 2, shows not contain
cry3Agene element.
Embodiment 2 contains test kit and the detection method thereof of developer
By following formula preparation
cry3Athe LAMP detection kit of gene:
(1) primer solution is detected: synthesis outer primer 1, outer primer 2, inner primer 1 and inner primer 2, primer dry powder sterilizing deionized water is made into the mother liquor that concentration is 100 μm of ol/L respectively, then get 7.5 μ L outer primer 1,7.5 μ L outer primer 2,60 μ L inner primer 1,60 μ L inner primer 2,15 μ L sterilizing deionized waters, fully mixing is made into 150 μ L's
cry3Athe LAMP detection primer solution of gene, wherein primer sequence is respectively:
Outer primer 1:AAGCCCCACCTGTTCGA(SEQ ID NO:1);
Outer primer 2:GGCTCGCTGCTCTTGTTG(SEQ ID NO:2);
Inner primer 1:AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC(SEQ ID NO:3);
Inner primer 2:GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA(SEQ ID NO:4);
(2) ring primer solution: synthesis ring primer, is made into primer dry powder sterilizing deionized water the mother liquor that concentration is 100 μm of ol/L, then gets 20 μ L ring primers, 80 μ L sterilizing deionized waters, and fully mixing is made into 100 μ L's
cry3Athe LAMP ring primer solution of gene, wherein primer sequence is:
Ring primer: GGGCTGGAAACGCGTGT(SEQ ID NO:5);
(3) Bst archaeal dna polymerase, concentration is 8 U/ μ L;
(4) 10 × reaction buffers: 200 mmol/L Tris-HCl (pH 8.8), 100 mmol/L KCl, 100 mmol/L (NH
4)
2sO
4, 80 mmol/L MgSO
4, 8 mol/L trimethyl-glycines;
(5) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10 mmol/L by concentration mix;
(6) positive DNA control sample, turns
cry3Athe genomic dna of gene plant, or contain
cry3Athe e. coli plasmid dna of gene order;
(7) negative DNA control sample: do not contain
cry3Athe DNA of gene order;
(8) developer: 1000 × SYBR GREEN I fluorescence dye.
By the following method testing sample is detected with above-mentioned test kit:
(1) extract the genomic dna of testing sample: adopt the plant DNA extraction kit method that Beijing Tian Gen company produces, extract the genomic dna of testing sample;
(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ L PCR reaction tubess, add template DNA 2 μ L, detect primer solution 1.5 μ L, ring primer solution 1 μ L, Bst archaeal dna polymerase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L, with sterilizing deionized water polishing to 25 μ L;
(3) the LAMP detection reaction system of control sample is prepared: when preparation positive control, negative control reaction system, except template DNA being changed respectively into positive DNA control sample, negative DNA control sample, other components are consistent with step (2);
(4) reaction tubes is placed in thermostat water bath, runs LAMP amplified reaction: hatch 40min for 63 DEG C, hatch 5min termination reaction for 80 DEG C;
(5) qualification of LAMP amplification: the developer adding 2 μ L in LAMP amplified production, if mixing, reaction tubes shows green, is positive, if manifest orange, is negative.
In the present embodiment, positive control shows green, negative control manifests orange; The reaction tubes shows green of testing sample 1, shows to contain
cry3Agene element; The reaction tubes of testing sample 2 manifests orange, shows not contain
cry3Agene element.
The specificity experiments of embodiment 3 test kit and detection method
Test the specificity of the test kit described in embodiment 2 and detection method thereof, test sample comprises: transgenic corns MIR604(
cry3A), MON89034(
cry1A.105,
cry2Ab), MON810(
cry1Ab), Bt11(
cry1Ab), Bt176(
cry1Ab), MON863(
cry3Bb), MON88017(
cry3Bb), TC1507(
cry1F), 59122(
cry34Ab,
cry35Ab), transgene cotton MON531(
cry1Ac), MON15985(
cry1Ac,
cry2Ab), transgenic paddy rice KF-6(
cry1Ab), TT51-1(
cry1Ab/Ac) etc. 13 kinds of anti-pest GM crop, and non-transgenic corn.
In the present embodiment, only contain
cry3Athe transgenic corns MIR604 example reaction pipe shows green of gene, shows test kit of the present invention and detection method pair
cry3Agene has good specificity.
The sensitivity experiment of embodiment 4 test kit and detection method
Test the sensitivity of the test kit described in embodiment 2 and detection method thereof, test sample is contained by transgenic corns MIR604(
cry3Agene) to be mixed with by certain mass ratio with non-transgenic corn and to form, the massfraction of the MIR604 corns in 8 parts of test samples is respectively 100%, 10%, 1%, 0.1%, 0.05%, 0.02%, 0.01%, 0.
In the present embodiment, MIR604 corn massfraction is respectively equal shows green in the test sample reaction tubes of 100%, 10%, 1%, 0.1%, 0.05%, 0.02%, 0.01%, and negative control manifests orange, show that the detection sensitivity of test kit of the present invention and detection method thereof can reach 0.01%.
With outer primer 1 of the present invention and outer primer 2, qualitative PCR detection is carried out to above-mentioned test sample.
PCR detection reaction system is: 1 × PCR damping fluid (Dalian precious biotech firm), the precious biotech firm in 0.2 mmol/L dNTPs(Dalian), 0.2 μm of ol/L outer primer, 1,0.2 μm of ol/L outer primer 2,1 U Taq archaeal dna polymerase (the precious biotech firm in Dalian), 2 μ L template DNAs, with sterilizing deionized water polishing to 25 μ L.PCR response procedures is: 94 DEG C of denaturation 5 min; 95 DEG C of sex change 30 s, 60 DEG C of annealing 30 s, 72 DEG C of extension 30 s, 35 circulations; 72 DEG C extend 7 min.After PCR terminates, get 5 μ L amplified productions and carry out 2% agarose gel electrophoresis detection.
In the present embodiment, there is typical electrophoretic band in the pcr amplification product that MIR604 corn massfraction is respectively the test sample of 100%, 10%, 1%, 0.1%, 0.05%, and 0.02%, 0.01%, negative control all without typical electrophoretic band, show that the detection sensitivity of PCR method is 0.05%.
The comparative result display of two kinds of methods, the detection sensitivity of test kit of the present invention and detection method thereof can reach 0.01%, and the detection sensitivity of PCR method is 0.05%; Through comparison, the sensitivity of test kit of the present invention and detection method, apparently higher than PCR method, can detect the sample of more low levels.
Should be noted that; above-described embodiment is specific embodiments of the invention; but embodiments of the present invention are not restricted to the described embodiments; all distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
<110> Jilin Academy of Agricultural Science
The LAMP detection primer group of cry3A gene, test kit and detection method in <120> transgenic plant
<130>
<160> 5
<210> 1
<211> 17
<212> DNA
<213> artificial sequence
<220>
The LAMP of <223> cry3A gene detects outer primer 1
<400> 1
aagccccacc tgttcga 17
<210> 2
<211> 18
<212> DNA
<213> artificial sequence
<220>
The LAMP of <223> cry3A gene detects outer primer 2
<400> 2
ggctcgctgc tcttgttg 18
<210> 3
<211> 41
<212> DNA
<213> artificial sequence
<220>
The LAMP of <223> cry3A gene detects inner primer 1
<400> 3
agttgaagct gtcgttgccg tacctgcacc gcatccagtt c 41
<210> 4
<211> 38
<212> DNA
<213> artificial sequence
<220>
The LAMP of <223> cry3A gene detects inner primer 2
<400> 4
ggagcggcaa ctacgtgagc agaaggggct ggtgatga 38
<210> 5
<211> 17
<212> DNA
<213> artificial sequence
<220>
The LAMP detection ring primer of <223> cry3A gene
<400> 5
gggctggaaa cgcgtgt 17
Claims (7)
1. in transgenic plant
cry3Athe LAMP detection primer group of gene, comprises outer primer 1, outer primer 2, inner primer 1, inner primer 2 and ring primer, and its nucleotide sequence is as follows respectively:
Outer primer 1:AAGCCCCACCTGTTCGA(SEQ ID NO:1);
Outer primer 2:GGCTCGCTGCTCTTGTTG(SEQ ID NO:2);
Inner primer 1:AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC(SEQ ID NO:3);
Inner primer 2:GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA(SEQ ID NO:4);
Ring primer: GGGCTGGAAACGCGTGT(SEQ ID NO:5).
2. in transgenic plant
cry3Athe LAMP detection kit of gene, comprises following component:
(1) detect primer solution: the detection primer solution prepared by 2 outer primers according to claim 1 and 2 inner primers, the concentration of outer primer 1, outer primer 2, inner primer 1 and inner primer 2 is followed successively by 4 ~ 6 μm of ol/L, 4 ~ 6 μm of ol/L, 32 ~ 48 μm of ol/L and 32 ~ 48 μm ol/L;
(2) ring primer solution: formulated by ring primer according to claim 1, the concentration of ring primer is 16 ~ 24 μm of ol/L;
(3) there is the archaeal dna polymerase of strand-displacement activity: concentration is 7 ~ 9 U/ μ L;
(4) 10 × reaction buffers: 200 mmol/L Tris-HCl, pH 8.8,100 mmol/L KCl, 100 mmol/L (NH
4)
2sO
4, 40 ~ 100 mmol/L MgSO
4, 6 ~ 14 mol/L trimethyl-glycines;
(5) dNTPs solution, dATP, dCTP, dGTP, dTTP tetra-kinds of deoxyribonucleotide solution equal-volumes being respectively 10 mmol/L by concentration mix;
(6) positive DNA control sample, turns
cry3Athe genomic dna of gene plant, or contain
cry3Athe e. coli plasmid dna of gene order;
(7) negative DNA control sample: do not contain
cry3Athe DNA of gene order;
(8) developer: 1000 × SYBR GREEN I fluorescence dye.
3. according to claim 2
cry3Athe LAMP detection kit of gene, is characterized in that: containing 5 μm of ol/L outer primers, 1,5 μm of ol/L outer primers, 2,40 μm of ol/L inner primers, 1,40 μm of ol/L inner primers 2 in described detection primer solution.
4. according to claim 2
cry3Athe LAMP detection kit of gene, is characterized in that: containing 20 μm of ol/L ring primers in described ring primer solution.
5. according to claim 2
cry3Athe LAMP detection kit of gene, is characterized in that: the described archaeal dna polymerase with strand-displacement activity is Bst archaeal dna polymerase, and concentration is 8 U/ μ L.
6. according to claim 2
cry3Athe LAMP detection kit of gene, is characterized in that: MgSO in 10 described × reaction buffer
4, beet paper mill wastewater is respectively 80 mmol/L, 8 mol/L.
7. utilize the test kit described in any one of claim 2 ~ 6 to detect
cry3Athe method of gene, comprises the following steps:
(1) genomic dna of testing sample is extracted;
(2) the LAMP detection reaction system of testing sample is prepared: in 200 μ L PCR reaction tubess, add template DNA 2 ~ 5 μ L, detect primer solution 1.5 μ L, ring primer solution 1 μ L, Bst archaeal dna polymerase 1 μ L, 10 × reaction buffer 2.5 μ L, dNTPs solution 3 μ L, with sterilizing deionized water polishing to 25 μ L;
(3) the LAMP detection reaction system of control sample is prepared: when preparation positive control, negative control reaction system, except template DNA being changed respectively into positive DNA control sample, negative DNA control sample, other components are consistent with step (2);
(4) LAMP amplified reaction is run: hatch 30 ~ 60min for 63 ~ 65 DEG C, hatch 5min termination reaction for 80 DEG C;
(5) qualification of LAMP amplification: the turbidity change precipitated in turbidimeter observing response pipe by visual inspection or utilize judges amplification; Or get 2 ~ 5 μ L amplified productions carry out agarose gel electrophoresis detect amplification; Or in reaction tubes, add 1 ~ 2 μ L developer, judge amplification by visual inspection colour developing result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410176842.2A CN103924000B (en) | 2014-04-29 | 2014-04-29 | LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410176842.2A CN103924000B (en) | 2014-04-29 | 2014-04-29 | LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103924000A CN103924000A (en) | 2014-07-16 |
| CN103924000B true CN103924000B (en) | 2015-06-17 |
Family
ID=51142390
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410176842.2A Expired - Fee Related CN103924000B (en) | 2014-04-29 | 2014-04-29 | LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103924000B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483235A (en) * | 2015-12-26 | 2016-04-13 | 吉林省农业科学院 | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1F of transgenic plants |
| CN105483237A (en) * | 2015-12-26 | 2016-04-13 | 吉林省农业科学院 | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene aad1 of transgenic plants |
| CN105483236A (en) * | 2015-12-26 | 2016-04-13 | 吉林省农业科学院 | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1C of transgenic plants |
| CN105483238A (en) * | 2015-12-26 | 2016-04-13 | 吉林省农业科学院 | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene vip3A of transgenic plants |
| CN105483240A (en) * | 2015-12-26 | 2016-04-13 | 吉林省农业科学院 | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry34Ab of transgenic plants |
| CN105506081A (en) * | 2015-12-26 | 2016-04-20 | 吉林省农业科学院 | LAMP (loop-mediated isothermal amplification) detection primer set of cry35Ab gene in transgenic plant, kit and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1470648A (en) * | 2002-07-26 | 2004-01-28 | 深圳市匹基生物工程股份有限公司 | Primer sequence for Cry3A gene containing transgenic crop nucleic acid amplification |
| CN103088161A (en) * | 2013-01-14 | 2013-05-08 | 宁波检验检疫科学技术研究院 | Detection method of tomato ringspot virus by means of RT-LAMP (Revere Transcription-Loop-Mediated Isothermal Amplification) |
-
2014
- 2014-04-29 CN CN201410176842.2A patent/CN103924000B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1470648A (en) * | 2002-07-26 | 2004-01-28 | 深圳市匹基生物工程股份有限公司 | Primer sequence for Cry3A gene containing transgenic crop nucleic acid amplification |
| CN103088161A (en) * | 2013-01-14 | 2013-05-08 | 宁波检验检疫科学技术研究院 | Detection method of tomato ringspot virus by means of RT-LAMP (Revere Transcription-Loop-Mediated Isothermal Amplification) |
Non-Patent Citations (2)
| Title |
|---|
| Combining engineered(Bt-cry3A) and natural resisitance mechanisms in potato for control of Colorado potato beetle;Joseph J.Coombs等;《J.AMER.SOC.HORT.SCI》;20021231;第127卷(第1期);62-68 * |
| Development and Application of Loop-Mediated IsothermalAmplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops;Feiwu Li等;《Int. J. Mol. Sci.》;20140827;第15卷;15109-15121 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103924000A (en) | 2014-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103924000B (en) | LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant | |
| CN103103270B (en) | Specific PCR (polymerase chain reaction) molecular marker for detecting alleles controlling salt tolerance of rice | |
| CN103773867B (en) | The LAMP detection primer group of cry2Ab gene, test kit and detection method in genetically modified crops | |
| CN102134602B (en) | Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof | |
| Fukuta et al. | Development of loop-mediated isothermal amplification (LAMP)-based SNP markers for shelf-life in melon (Cucumis melo L.) | |
| CN105063207B (en) | Genetically engineered soybean MON87705 LAMP detection primer group, kit and detection method | |
| CN102827939A (en) | Loop-mediated isothermal amplification (LAMP) primer of genetically modified maize BT11 strain, reagent kit and application of LAMP primer | |
| KR101375952B1 (en) | SNP primer for discrimination of Chunpoong cultivar of Panax ginseng C.A. Meyer and method for discriminating the Chunpoong cultivar using the same | |
| KR20160096755A (en) | Molecular marker for selecting tomato leaf mold resistant and selection method using the same molecular marker | |
| CN103421893A (en) | LAMP detection reagent for transgenosis carica papaya GMYK strain | |
| CN103866042B (en) | LAMP detects the primer sets of corn MIR162, test kit and method | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN105420359A (en) | LAMP primer group for Lectin detection and gene isothermal amplification method | |
| CN105039555B (en) | Genetically engineered soybean MON87701 LAMP detection primer group, kit and detection method | |
| CN105039556B (en) | Genetically engineered soybean MON87769 LAMP detection primer group, kit and detection method | |
| CN104651490A (en) | Method for rapidly detecting bacterial canker of tomatoes and special primer for method | |
| CN105002291A (en) | LAMP detection primer set, kit and detection method of transgenic soybeans MON87708 | |
| KR20200063566A (en) | Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same | |
| Kim et al. | Detection system of stacked genetically modified maize using multiplex PCR | |
| CN111485031A (en) | Rice molecular marker DOF8 and application thereof, and method for identifying japonica rice and indica rice by using rice molecular marker DOF8 | |
| CN105483235A (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1F of transgenic plants | |
| CN107058559A (en) | The molecular detecting method and kit of a kind of plant pathogenic fungi | |
| CN105483238A (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene vip3A of transgenic plants | |
| CN105483236A (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1C of transgenic plants | |
| CN105506081A (en) | LAMP (loop-mediated isothermal amplification) detection primer set of cry35Ab gene in transgenic plant, kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150617 Termination date: 20200429 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |