CN103923890A - Rice leaf color controlling gene LYL1 and application thereof - Google Patents

Rice leaf color controlling gene LYL1 and application thereof Download PDF

Info

Publication number
CN103923890A
CN103923890A CN201410187111.8A CN201410187111A CN103923890A CN 103923890 A CN103923890 A CN 103923890A CN 201410187111 A CN201410187111 A CN 201410187111A CN 103923890 A CN103923890 A CN 103923890A
Authority
CN
China
Prior art keywords
gene
lyl1
rice
cell
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410187111.8A
Other languages
Chinese (zh)
Inventor
周勇
梁国华
龚志云
袁媛
王曼
杨泽峰
朱金燕
裔传灯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN201410187111.8A priority Critical patent/CN103923890A/en
Publication of CN103923890A publication Critical patent/CN103923890A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/01—Oxidoreductases acting on the CH-CH group of donors (1.3) with NAD+ or NADP+ as acceptor (1.3.1)
    • C12Y103/01083—Geranylgeranyl diphosphate reductase (1.3.1.83)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a protein coded by a rice leaf color controlling gene LYL1. The protein has an amino acid sequence shown by SEQ ID No: 3. The invention also discloses the rice leaf color controlling gene LYL1. The gene has nucleotide sequences shown by SEQ ID No:1 and 2. The LYL1 can be used for coding a double-geranyl reductase; the rice leaf color is changed into yellow from normal green due to the mutation of the gene. The invention also discloses a vector, which is a plant expression vector containing the gene, like pCAMBIA1301-LYL1. The invention also discloses a host cell, which comprises the vector. The cell is, for example, escherichia coli, agrobacterium cell, or plant cell. The characters of the yellow leaf controlled by lyl1-1 mutant gene can be taken as a genetic marker to be used for variety identification and rice genetic breeding in agriculture production.

Description

Rice Leaf color control gene LYL1 and application thereof
Technical field
The invention belongs to plant genetic engineering field.Specifically, the present invention relates to gene and the application thereof that Rice Leaf look is grown.
Background technology
Paddy rice is one of most important food crop in the world, and the population over half for the whole world provides staple food, improves the output of paddy rice for ensureing that global grain security is significant.Blade is that plant carries out photosynthetic major organs, and 95% of rice yield comes from the photosynthesis of blade, and the photosynthetic normal development that efficiently depends on chlorophyllous synthetic and chloroplast(id).Leaf look is the general performance of various pigments in chloroplast(id), and normal rice leaf Determination of Chlorophyll is preponderated, and is usually expressed as green.
Leaf variegation is the mutant character of the higher and easy qualification of rice seed mutation frequency.Mutator gene often direct or remote effect synthesizes and degraded to chlorophyllous, changes chlorophyll content, so leaf look mutant is also referred to as chlorophyll mutation [1].According to incompletely statistics, the genes involved of the Rice Leaf look of report sudden change at present has exceeded 80, these mutant are broadly divided into for 5 types of albefaction, yellow, light green, striped, spots etc., or are divided into albefaction, yellow, light green, Bai Cui, green white, yellowish green, striped and greenish-yellow etc. 8 types [2].Wherein yellow leaf look mutant occurs at most, and major part is subject to recessive nuclear gene control [3].Leaf look mutant is the ideal material of Study On Rice light-use, also can be used as mark property and is applied in heterosis utilization.Therefore, the clone of Rice Leaf form and aspect correlation gene and functional analysis are significant to improving photosynthetic efficiency and output.
Although Rice Leaf look mutant is found a lot, up to the present, only has a few Rice Leaf look mutant gene identified [4-12], still have a large amount of Ye Sejiyin to have to be separated.
Reference:
He Bing, Liu Linglong, Zhang Wenwei, Wan Jianmin. Plant Leaf Color Mutants. Plant Physiology Communications .2006,42 (2): 1-9.
Awan?MA,Konzak?C,Rutger?J,Nilan?R.Mutagenic?effects?of?sodium?azide?in?rice.Crop?Science.1980,20(3):663-668.
Gong?H,Chen?L,Diao?L,Sheng?S,Lin?T,Yang?T,Zhang?R,Cao?S,Zhai?H,Dai?X.Genetic?analysis?of?chlorophyll-b?less?mutant?in?rice?and?its?related?characteristics.Sci.Agric.Sin.2001,34(4):686-689.
Lee?S,Kim?JH,Yoo?ES,Lee?CH,Hirochika?H,An?G.Differential?regulation?of?chlorophyll?a?oxygenase?genes?in?rice.Plant?Mol?Biol.2005,57(6):805-818.
Zhang?H,Li?J,Yoo?JH,Yoo?SC,Cho?SH,Koh?HJ,Seo?HS,Paek?NC.Rice?Chlorina-1and?Chlorina-9encode?ChlD?and?ChlI?subunits?of?Mg-chelatase,a?key?enzyme?for?chlorophyll?synthesis?and?chloroplast?development.Plant?Mol?Biol.2006,62(3):325-337.
Morita?R,Kusaba?M,Yamaguchi?H,Amano?E,Miyao?A,Hirochika?H,Nishimura?M.Characterization?of?Chlorophyllide?a?Oxygenase(CAO)in?rice.Breeding?Science.2008,55:361-364.
Wang?P,Gao?J,Wan?C,Zhang?F,Xu?Z,Huang?X,Sun?X,Deng?X.Divinyl?chlorophyll(ide)a?can?be?converted?to?monovinyl?chlorophyll(ide)a?by?a?divinyl?reductase?in?rice.Plant?Physiol.2010,153(3):994-1003.
Wu?Z,Zhang?X,He?B,Diao?L,Sheng?S,Wang?J,Guo?X,Su?N,Wang?L,Jiang?L,Wang?C,Zhai?H,Wan?J.A?chlorophyll-deficient?rice?mutant?with?impaired?chlorophyllide?esterification?in?chlorophyll?biosynthesis.Plant?Physiol.2007,145(1):29-40.
Chen?H,Cheng?Z,Ma?X,Wu?H,Liu?Y,Zhou?K,Chen?Y,Ma?W,Bi?J,Zhang?X,Guo?X,Wang?J,Lei?C,Wu?F,Lin?Q,Liu?L,Jiang?L.A?knockdown?mutation?of?YELLOW-GREEN?LEAF2blocks?chlorophyll?biosynthesis?in?rice.Plant?Cell?Rep.2013,32(12):1855-1867.
Dong?H,Fei?GL,Wu?CY,Wu?FQ,Sun?YY,Chen?MJ,Ren?YL,Zhou?KN,Cheng?ZJ,Wang?JL,Jiang?L,Zhang?X,Guo?XP,Lei?CL,Su?N,Wang?H,Wan?JM.A?rice?virescent-yellow?leaf?mutant?reveals?new?insights?into?the?role?and?assembly?of?plastid?caseinolytic?protease?in?higher?plants.Plant?Physiol.2013,162(4):1867-1880.
Sakuraba?Y,Rahman?ML,Cho?SH,Kim?YS,Koh?HJ,Yoo?SC,Paek?NC.The?rice?faded?green?leaf?locus?encodes?protochlorophyllide?oxidoreductase?B?and?is?essential?for?chlorophyll?synthesis?under?high?light?conditions.Plant?J.2013,74(1):122-133.
Li?J,Pandeya?D,Nath?K,Zulfugarov?IS,Yoo?SC,Zhang?H,Yoo?JH,Cho?SH,Koh?HJ,Kim?DS,Seo?HS,Kang?BC,Lee?CH,Paek?NC.ZEBRA-NECROSIS,a?thylakoid-bound?protein,is?critical?for?the?photoprotection?of?developing?chloroplasts?during?early?leaf?development.Plant?J.2010,62(4):713-725.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of new gene LYL1 cloning from Rice Leaf look mutant, the protein of this genes encoding, and utilize the method for this gene regulating Rice Leaf look.
In order to solve the problems of the technologies described above, the invention provides the new gene LYL1 cloning from Rice Leaf look mutant lyl1-1, the cDNA sequence shown in the gDNA sequence as shown in SEQ ID NO:1 and SEQ ID NO:2.
The present invention also provides a kind of protein of being encoded because of LYL1 by above-mentioned Rice Leaf color base, and this protein has the aminoacid sequence shown in SEQ ID No:3.This protein is two geranyl reductase enzyme proteins.
The present invention also provides the plasmid that contains said gene.
The present invention also provides the plant expression vector that contains said gene.
The present invention also provides a kind of host cell, and this host cell contains said gene sequence, and this cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
Another object of the present invention is to provide a kind of method of carrying out efficient Plant Transformation with LYL1 gene, specifically, the invention provides and there is the gene of sequence shown in SEQ ID No:1 and SEQ ID No:2 or the carrier of Gene Partial fragment, pCAMBIA1301-LYL1 as shown in Figure 4, this carrier can be expressed above-mentioned nucleotide sequence coded polypeptide or its homology analogue.
The present invention also provides a kind of method of adjusting and controlling rice leaf look, comprises that using is the gene transformation rice cell of the nucleotide sequence shown in SEQ ID No:1 and 2, then the rice cell after transforming is cultivated into plant.Conversion can adopt agrobacterium-mediated transformation or particle bombardment.
The concrete technological step of the present invention's research is as follows:
One, separation and the genetic analysis of Rice Leaf look mutant lyl1:
Rice Leaf look mutant of the present invention (light-induced yellow leaf1-1) is in japonica rice variety (japonica), to spend (purchased from Chinese Academy of Agricultural Sciences's Crop Germplasm Resources storehouse) warp No. 11 60after Co radiotreatment, the more stable mutant lyl1-1 of the phenotype obtaining by a large amount of screenings.This mutant shows obvious blade yellow phenotype, as shown in Figure 1.Lyl1-1 mutant and rice variety (indica) are raised to rice No. 6, and (authorization numbering: state examines rice 2001002) hybridizes, by F 1for selfing, plantation F 2for segregating population, in colony, green seedling and etiolated seedling are respectively 1377 strains and 439 strains, and segregation ratio meets 3:1 (X -2=0.66<X -2 0.05,1=3.84) what, show that we obtain is a cryptic mutant that meets Dominant gene genetic development.
Two, map based cloning Rice Leaf color control gene LYL1
(1), the Primary Location of LYL1 gene:
In order to separate LYL1 gene, model of the present invention a target group that large polymorphism is high, raise rice No. 6 (9311) hybridization and the F that forms by lyl1-1 mutant and rice variety 2colony, then by the method for map based cloning, and utilize STS, SSR equimolecular mark to carry out Primary Location to LYL1 site, on the 2nd karyomit(e) is long-armed, and between mark W243 and W226, sees Fig. 2 by its Primary Location.
(2), the Fine Mapping of LYL1 gene and physical positioning:
By the BAC sequential analysis between W243 and two marks of W226, develop new STS mark and carry out Fine Mapping, LYL1 is accurately positioned within the scope of 33-kb between mark W235 on BAC clone AP004114 and W246 (Fig. 3) the most at last.Infer candidate gene by the open reading frame (ORF) of analyzing this section,, candidate gene within the scope of this is carried out to sequential analysis, the sequence of finding after order-checking to only have LYL1 candidate gene in spend 11 with lyl1-1 mutant between there are differences, and other sequence of 5 in spend 11 and lyl1-1 mutant between equal indifference.
(3), the qualification of LYL1 gene and functional analysis:
The transgenic research having complementary functions.By gene constructed LYL1 to conventional plant expression vector and be transformed in paddy rice xantha mutant lyl1-1, result shows that the present invention has obtained the transgenic paddy rice (Fig. 5) that makes lyl1-1 mutant recover positive evergreen leaf phenotype, has proved that the present invention has correctly cloned LYL1 gene.Specify gDNA sequence (SEQ ID No:1) and the cDNA sequence (SEQ ID No:2) of LYL1 gene, amino acid sequence analysis shows two geranyl reductase enzyme (SEQ ID No:3) of LYL1 genes encoding.
The present invention utilizes Rice Leaf look mutant, has been separated to LYL1 gene by map based cloning, two geranyl reductase enzyme protein of this genes encoding.By the clone to LYL1 gene, further illustrate the genetic mechanism of Rice Leaf tone control, lay the first stone for creating the high light efficiency new germ plasm of paddy rice.
By plant gene engineering technology, LYL1 mutator gene is transferred in light sensitive nuclear sterility based material, can be obtained and contain lyl1 gene, there is the sterile line material of yellow leaf phenotype, for the production of hybrid seeds of paddy rice two-line hybrid rice.
Brief description of the drawings
Fig. 1 is the phenotypic map (left side is to spend 11 in wild-type, and right side is lyl1-1 mutant) of Rice Leaf look mutant lyl1-1;
Fig. 2 is the Primary Location figure of LYL1 gene on paddy rice the 2nd karyomit(e);
Fig. 3 is the Fine Mapping figure of LYL1 gene;
Fig. 4 is complementary carrier pCAMBIA1301-LYL1 plasmid map;
Fig. 5 is function complementation experiment T 0for the phenotypic map of transgenic paddy rice, (left side is acceptor lyl1-1 mutant, and right side is the complementary T of lyl1-1 0for transfer-gen plant).
Embodiment
In order to understand the present invention, further illustrate the present invention with embodiment below, but do not limit the present invention.
Embodiment 1:
1, rice material
Paddy rice (Oryza sativa L.) mutant lyl1-1 (light-induced yellow leaf1-1), its original wild-type material is japonica rice variety " in spend 11 " (purchased from Chinese Academy of Agricultural Sciences's Crop Germplasm Resources storehouse).In spend 11 warps 60after Co radiotreatment, more stable mutant lyl1-1 (Zhou, Y, the Gong of the phenotype obtaining by a large amount of screenings, ZY, Yang, ZF, Yuan, Y, Zhu, JY, Wang, M, Yuan, FH, Wu, SJ, Wang, ZD, Yi, CD, Xu, TH, Ryom, M, Gu, MH, Liang, GH.Mutation of the light-induced yellow leaf1gene, which encodes a geranylgeranyl reductase, affects chlorophyll biosynthesis and light sensitivity in rice, PLoS One, 2013,8 (9): e75299.).This mutant shows obvious blade yellow phenotype, as shown in Figure 1.
2, analysis and target group
The lyl1-1 mutant isozygotying and original wild-type rice variety are raised rice No. 6, and (authorization numbering: state examines rice 2001002) hybridizes F 1for selfing, obtain F 2for segregating population, and the recessiveness individuality of therefrom selecting 1203 strain blade yellows is as target group.The tender leaf of getting 1.0g left and right in every strain in seedling stage, is used for extracting total DNA.
3, utilize SSR and STS mark location LYL1 gene
Adopt improved CTAB method from rice leaf, to extract the genomic dna for the assignment of genes gene mapping.Get about 0.1g rice leaf (being the paddy rice tender leaf in step 2), after shredding with scissors, be placed in 2.0mL centrifuge tube, put into the steel ball of diameter 0.5mm, build centrifuge tube lid, centrifuge tube is placed in to liquid nitrogen freezing, utilize triturator (purchased from QIAGEN company) by blade grinds powder, add CTAB to extract DNA.The DNA obtaining is precipitated and dissolved in 200 μ L ultrapure waters, obtains DNA solution.Each PCR above-mentioned DNA solution of 1 μ L for reaction.First select the screening for the assignment of genes gene mapping and exchange individual plant of SSR and STS mark, then use the STS mark of new development for the Fine Mapping of gene.
The Primary Location of LYL1 gene: at lyl1-1 and the F that raises No. 6 combinations of rice 2in segregating population, respectively the DNA of 10 strain greenery plant in segregating population and 10 yellow leaf plant is mixed, build up greenery Chi Hehuangyechi, choose approximate each SSR and the STS primer on karyomit(e) that be uniformly distributed in, detect the polymorphism of PCR product according to above-mentioned reaction conditions, by LYL1 Primary Location between the long-armed W243 of the 2nd karyomit(e) and two marks of W226 (seeing Fig. 2).
The Fine Mapping of LYL1 gene: for Fine Mapping LYL1 gene, according to japonica rice Japan fine sequence (http://rgp.dna.afTrc.go.jp/) and long-grained nonglutinous rice 9311 sequences (http://www.ncbi.nlm.nih.gov/BLAST/Genome) delivered between W243 and W226, sequence between comparison japonica rice and long-grained nonglutinous rice, then at the both sides of difference section design primer, 5 pairs of primers (table 1) are at lyl1-1 genomic dna and raise between No. 6 genomic dnas of rice and detect polymorphism, these have the primer of polymorphism to be used to the Fine Mapping of LYL1 gene, LYL1 is positioned in No. BAC scope for the upper 33-Kb of AP004114 (cloning OJ1118G04) the most at last, the molecule marker on both sides is W235 and W246.
PCR reaction system and the reaction conditions of SSR and STS are:
The pcr amplification that carries out SSR and STS mark on Mastercycler Pro PCR instrument (purchased from Eppondorf company), PCR reaction system is: template DNA 1.0 μ L, the damping fluid 2.0 μ L of 10 × PCR, the MgCl of 25mM 22.0 μ L, the dNTP2.0 μ L of 2mM, the primer 2 .0 μ L of 0.3 μ M, Taq enzyme 0.5U, adds ddH 2o complements to 20 μ L.
Pcr amplification condition is: 95 DEG C of denaturation 3min; 94 DEG C of sex change 30s, 53 DEG C of annealing 30s, 72 DEG C are extended 1min, 34 circulations of increasing; 72 DEG C are extended 10min.
PCR product detects: PCR reaction product is electrophoresis in 3% sepharose, after ethidium bromide staining, utilizes Gel Doc XR gel imaging system (purchased from Bio-Rad company) Taking Pictures recording result.
The molecule marker primer sequence of table 1, Primary Location and Fine Mapping and object clip size thereof.
4, predictive genes and comparative analysis
According to the result of Fine Mapping, within the scope of 33-kb according to the prediction of Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/), find to have 6 candidate genes in this interval, in sequencing analysis (entrust Shanghai Sheng Gong Bioisystech Co., Ltd complete), spend 11 with lyl1-1 mutant at this interval genome sequence, find that the replacement of a base has occurred the 1st exon of two geranyl reductase enzyme encoding genes that being predicted to be in 34666-36806 interval encodes has 3 exons on BAC clone AP004114, become thymus pyrimidine (T) by cytosine(Cyt) (C-182), cause thus aminoacid sequence to spend the L-Ala (Ala-61) in 11 to become the α-amino-isovaleric acid (Val) in lyl1-1 mutant from middle, sequencing primer is in table 2.
The presentation of results LYL1 gene of Fine Mapping, in 33-kb, wherein has 6 candidate genes.The sequence of only having LYL1 candidate gene after order-checking in spend 11 and lyl1-1 mutant between there are differences, and other sequence of 5 in spend 11 and lyl1-1 mutant between equal indifferences.In sequence table SEQ ID NO:1, show the sequence of discrepant that candidate gene, i.e. the sequence of LYL1 gene.
According to the gene annotation information (NCBI) of BAC clone AP004114 sequence, predict two geranyl reductase enzyme of this genes encoding, be made up of 3 exons and 2 introns, cDNA coding region is 1,392-bp, 463 the amino acid whose protein of encoding.Two geranyl reductase enzyme protein encoding gene height homologies in LYL1 gene and bacterium, algae and higher plant.
There is single base mutation in mutator gene lyl1, other sequence information is identical with wild-type LYL1 gene on the 1st exon.
Table 2, the primer and the object clip size thereof that check order for candidate gene
Embodiment 2:
Plant Transformation
According to the sequence of the fine LYL1 gene of Japan (NCBI) design primer, with primer LYL1-1F and LYL1-1R (entrusting Shanghai Sheng Gong Bioisystech Co., Ltd synthetic), Xba I and Pst I joint are introduced respectively in two ends, High fidelity PCR amplification.
LYL1-1F：GGTGCCAACCTTGATTCAATTCTAAAGA(SEQ?ID?No:38)
LYL1-1R：TCAGGCTTTTAGGTATGACCCAAGGCAG(SEQ?ID?No:39)
PCR reaction system is: 2 μ l DNA solutions (normal leaf look in spend 11 DNA), 10 × PCR Buffer5.0 μ l, 25mM MgCl 25.0 μ l, 2mM dNTP5.0 μ l, 100 μ M primer 3.0 μ l, 5U/ μ l Taq archaeal dna polymerase 0.5 μ l, ddH 2o29.5 μ l, total system 50 μ l.Response procedures: 94 DEG C of denaturation 5min, 94 DEG C of 1min, 68 DEG C of 5min, 35 circulations of increasing, 72 DEG C are extended 10min.
4 of above-mentioned PCR reaction amplification acquisition, the sequence of 609 bases after 65 bases of Isosorbide-5-Nitrae and terminator codon TGA that 215bpDNA fragment comprises candidate gene initiator codon ATG upstream.After pcr amplification, access pZeroBack/blunt carrier (purchased from TIANGEN Biotech (Beijing) Co., Ltd.), after order-checking is confirmed, be cloned in binary vector pCAMBIA1301 (purchased from CAMBIA company), obtained the plasmid pCAMBIA1301-LYL1 (Fig. 4) for transforming.Plasmid proceeds in Agrobacterium (AgroBacterium tumefaciens) strain EHA105 (purchased from CAMBIA company) for rice transformation by the method for thermal shock.
Adopt the agriculture bacillus mediated genetic transforming method (can be with reference to Hiei etc., Plant J, 1994,6,271-282), utilize lyl1-1 mutant mature embryo evoked callus, cultivate after 2 weeks through inducing culture, select growth vigorous, color is pale yellow, more open embryo callus, as the acceptor transforming.The EHA105 bacterial strain that contains pCAMBIA1301-LYL1 plasmid is infected to rice callus, under dark, 25 DEG C of conditions, cultivate altogether after 3 days, callus is proceeded on the selection substratum containing 25mg/l Totomycin and 600mg/l cephamycin and cultivated.After 10 days, the fresh kanamycin-resistant callus tissue growing is proceeded to containing continuing on the selection substratum of 50mg/l Totomycin and 300mg/l cephamycin again and cultivate.After 10 days, select eugonic fresh resistant calli to transfer on the pre-division culture medium containing 50mg/l Totomycin and 300mg/l cephamycin and cultivate.After 10 days, then the resistant calli of pre-differentiation culture is transferred on the division culture medium containing 12.5mg/l Totomycin and 150mg/l cephamycin dark in 16h light/8h, under 28 DEG C of conditions, breaks up.About one month, obtain resistant transgenic plant.
Hygromycin resistance plant (because carrier is with hygromycin resistance, as long as the plant that therefore proceeds to this carrier is all with hygromycin resistance) is identified and continuous observation.Obtain altogether 5 T 0for transgenic plant, the green that its leaf look is all acted normally, illustrates that LYL1 gene has been integrated in lyl1-1 mutant gene group and can correction (Fig. 5).
By above-mentioned transgenic technology, result shows: the present invention has obtained the transgenic paddy rice (Fig. 5) that makes mutant recover normal phenotype.
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.

Claims (8)

1. a protein for Rice Leaf look regulatory gene LYL1 coding, is characterized in that: this protein has the aminoacid sequence shown in Seq ID No:3.
2. a gene for protein described in the claim 1 of encoding, is characterized in that: this gene has the nucleotide sequence shown in Seq ID No:1 and 2.
3. a plasmid that contains gene described in claim 2.
4. a plant expression vector that contains gene described in claim 2.
5. a host cell, is characterized in that: this host cell contains gene order claimed in claim 2.
6. host cell according to claim 5, is characterized in that: this cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
7. described in claim 2, gene is used for building transgenic paddy rice, the purposes of improvement Rice Leaf look.
8. a method that improves Rice Leaf look, is characterized in that: comprise with the gene transformation rice cell with the nucleotide sequence shown in Seq ID No:l and 2, then the rice cell after transforming is cultivated into plant.
CN201410187111.8A 2014-05-05 2014-05-05 Rice leaf color controlling gene LYL1 and application thereof Pending CN103923890A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410187111.8A CN103923890A (en) 2014-05-05 2014-05-05 Rice leaf color controlling gene LYL1 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410187111.8A CN103923890A (en) 2014-05-05 2014-05-05 Rice leaf color controlling gene LYL1 and application thereof

Publications (1)

Publication Number Publication Date
CN103923890A true CN103923890A (en) 2014-07-16

Family

ID=51142290

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410187111.8A Pending CN103923890A (en) 2014-05-05 2014-05-05 Rice leaf color controlling gene LYL1 and application thereof

Country Status (1)

Country Link
CN (1) CN103923890A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105861518A (en) * 2016-05-10 2016-08-17 上海师范大学 Rice seedling-stage yellow leaf gene and detection method and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
YONG ZHOU ET AL: "Mutation of the Light-Induced Yellow Leaf 1 Gene, Which Encodes a Geranylgeranyl Reductase, Affects Chlorophyll Biosynthesis and Light Sensitivity in Rice", 《PLOS ONE》 *
ZHOU,Y ET AL: "Oryza sativa Japonica Group cultivar Zhonghua 11 geranylgeranyl reductase (LYL1) mRNA,complete cds", 《GENBANK: KF305678.1》 *
ZHOU,Y ET AL: "Oryza sativa Japonica Group cultivar Zhonghua 11 geranylgeranyl reductase (LYL1) mRNA,complete cds", 《GENBANK: KF305678.1》, 23 October 2013 (2013-10-23) *
何冰等: "植物叶色突变体", 《植物生理学通讯》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105861518A (en) * 2016-05-10 2016-08-17 上海师范大学 Rice seedling-stage yellow leaf gene and detection method and application thereof
CN105861518B (en) * 2016-05-10 2019-06-14 上海师范大学 One rice seedling yellow leaf gene and its detection method and application

Similar Documents

Publication Publication Date Title
CN108239647B (en) Gene and molecular marker for controlling rape plant type and application
CN104946661B (en) Rice grain shape controlling gene GL7 and application thereof
CN105693837A (en) Rice spikelet development regulation protein, encoding genes MS1 thereof and application
WO2015007241A1 (en) Molecular marker
CN102268081B (en) Rice lateral root control gene OsIAAII and use thereof
CN102242135B (en) Rice serine hydroxymethyl transferase protein and function of coding gene thereof
CN102212122A (en) Mutant lethal gene for controlling development of rice chloroplasts and application thereof
CN111304219B (en) GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length
WO2023221826A1 (en) Gene kwe2 that regulates maize ear grain weight and yield, protein encoding same, indel1 marker, expression vector and use thereof in plant trait improvement
CN102477091B (en) Rice male sterile protein and coding gene and application thereof
CN108484741B (en) Protein for controlling grain weight of crop seeds and application thereof
CN116555303A (en) Rice Sanming dominant genic male sterile gene SDGMS and application thereof
CN109112137B (en) Gene SNG1 for controlling size and weight of rice grains and application thereof
CN106589085A (en) Protein OsFLO8 related to plant starch synthesis and coding gene and application thereof
CN106318923B (en) The protein and its gene of a kind of High Temperature Stress down regulation Development of Chloroplasts and application
CN103524608B (en) Rice spike neck node regulation gene SUI1 (shorted uppermost Internode 1) and application thereof
CN115466747B (en) Glycosyltransferase ZmKOB1 gene and application thereof in regulation and control of maize female ear set character or development
CN103923890A (en) Rice leaf color controlling gene LYL1 and application thereof
CN102321633B (en) Pleiotropic gene for controlling vegetative growth and development of floral organs of rice and application thereof
CN105175519A (en) Application of protein SRL2 in cultivation of leaf rolling rice
CN105001317A (en) TuVIPP1 protein and encoding gene and application of TuVIPP1 protein
CN113308448B (en) Rice leaf color regulation gene WSS1 and encoding protein and application thereof
CN112080481B (en) Spike-type related gene OsFRS5 and application and phenotype recovery method thereof
CN101450965A (en) Rice flower organ differentiation and growth control gene PS and use thereof
CN116536286B (en) Rice OsCTK1 protein and application of encoding gene thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20140716