CN103923844B - A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof - Google Patents
A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof Download PDFInfo
- Publication number
- CN103923844B CN103923844B CN201410162801.8A CN201410162801A CN103923844B CN 103923844 B CN103923844 B CN 103923844B CN 201410162801 A CN201410162801 A CN 201410162801A CN 103923844 B CN103923844 B CN 103923844B
- Authority
- CN
- China
- Prior art keywords
- photovoltaicing leather
- leather bacteria
- large photovoltaicing
- bacteria
- spore
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Do you the invention discloses a kind of large photovoltaicing leather bacteria (Phlebiopsis? gigantea), does is its preserving number at CGMCC CGMCC? No.8653; Preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica; Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center; The preservation time: on December 18th, 2013.Large photovoltaicing leather bacteria of the present invention can be used for preventing and treating Chinese softwood tree root rot, can reach 55.83% to the antagonistic rate of Chinese softwood tree Pathogens Causing Root Rot Disease.
Description
Technical field
The invention belongs to microbial technology field, relate to bacterial classification and the application thereof of a kind of biological control China softwood tree root rot, particularly relate to a kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control.
Background technology
Softwood tree root rot is the important disease of one that generally distributes of area, north temperate zone, and the only local distribution in subtropical zone, endangers less.According to Plant diseases distribution map, this disease all has distribution in more than 40 country in the whole world such as the U.S., Canada, France, Germany, India, Japan.According to investigations, this disease is very common in China Northeast Forest Areas, also commonplace in In The Western Part of Sichuan and Alpine coniferous forests district, the northwestward, Yunnan Province, sometimes also can see in Yunnan hemlock, godlen oak woods.This disease often causes a large amount of forest in softwood tree young growth dead, and in adult wood or overmature forest, root white rot often causes butt rot, has a strong impact on the volume recovery of economy material; And often cause root dead due to root rot, cause the reduction of the increase in standing timber, its loss is economically larger.
The pathogenic bacteria of softwood tree root rot is heterobasidium bacterium Heterobasidion, the heterobasidium bacterium of softwood tree root rot can be caused to have 5 biological species, narrow sense heterobasidium bacterium H.annosum (Fr.) Bref.sensostricto for many years respectively, aperture heterobasidium bacterium H.parviporumNiemela & Korhonen, fir heterobasidium bacterium H.abietienumNiemela & Korhonen, different hole heterobasidium bacterium H.irregulareGarbelotto & Otrosina and west heterobasidium bacterium H.occidentaleOtrosina & Garbelotto.Although, this disease is not European and that north America region the is real bacterium of heterobasidium for many years Heterobasidionannosum the pathogenic bacteria of China, but aperture heterobasidium bacterium H.parviporum, but, cause the bacterium of heterobasidium for many years of serious plant disease to import into imported log in Europe and North America, spread and Ding Zhi China very risky, need to prevent trouble before it happens.This disease was found to now from 1800, a lot of country all conducts in-depth research the ecological impact of its prevention and controls and various prevention and controls.Up to the present, main prevention and controls has Silvicultural Measures control, chemical prevention and biological control.
Silvicultural Measures control is included in forest culture and management process, avoids afforesting on the soil being conducive to heterobasidium bacteria growing, as acid and nutritious and sandy soil; To avoid building pure forest to the seeds infected; When fostering standing forest, select to carry out in winter; Stump is dealt carefully with; To infect and murderous trees carry out buried and burn there is heterobasidium bacterium.But silvicultural control can not in the generation fundamentally suppressing softwood tree root rot.
Chemical prevention is the butt utilizing creosote, urea, borax and COPPER OXYCHLORIDE 37,5 etc. to process infection pathogen, but chemical prevention effectively can not control the infection of trees around, and chemical agent can affect to ecotope.
Biological control is based on following principle: a lot of saprophytic fungus of occurring in nature is rapider than heterobasidium bacteria growing under identical site conditions, can occupy more nutritive substance and ecological niche, therefore can suppress infecting and spreading of heterobasidium bacterium.Biological control effectively can suppress heterobasidium bacterium infecting forest, can by by heterobasidium microbial butt rot Altitude control minimum, and can control the propagation rate of pathogenic bacteria, can not impact ecotope, therefore biological control has more wide application prospect.
Large photovoltaicing leather bacteria (Phlebiopsisgigantea) is a kind of white rot fungi, extensively saprophyticly extremely set particularly in stump in softwood tree, nutrient competition relation is formed with heterobasidium bacterium, interfere heterobasidium bacterium mycelial growth simultaneously, there is the ability of antagonism heterobasidium bacterium, born of the same parents' outer fiber element enzyme that it produces can be degraded tree cell wall cellulosic structure, reaches the object of surely growing fast in stump, one of index of can be used as the screening of efficient biocontrol strain therefore born of the same parents' outer fiber element enzyme is lived.
Although external existing country utilizes large photovoltaicing leather bacteria to prevent and treat the microbial softwood tree root rot of heterobasidium, the biological control for the pathogenic bacterium aperture heterobasidium bacterium of China's softwood tree root rot have not been reported.
Summary of the invention
The object of the invention is for problems of the prior art, a kind of large photovoltaicing leather bacteria high efficient strain and the application thereof that prevent and treat Chinese softwood tree root rot are provided.
Bacterial strain of the present invention on December 18th, 2013 in (address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, Classification And Nomenclature is large photovoltaicing leather bacteria (Phlebiopsisgigantea), is: CGMCCNo.8653 at the preserving number of CGMCC.
Large photovoltaicing leather bacteria bacterial strain CGMCCNo.8653 of the present invention, can be separated by following two kinds of methods and obtain:
1, matrix partition method: get the wood tissue under the large photovoltaicing leather bacteria sporophore of collection, its upper and lower surface and surrounding cutter are cut away, expose middle texture of wood, surface sterilization sterilizing is carried out several times by mobile on spirit lamp flame for the texture of wood processed, then the long section (sheet) being aseptically cut into 2mm × 6mm is inoculated in malt extract medium (Fructus Hordei Germinatus leaching powder 20.0g/L, agar powder 18.0g/L, KH
2pO
43.0g/L, pH nature, 121 DEG C of autoclaving 30min) on, constant temperature culture under 28 DEG C of conditions, 3 – are the appearance of visible white mycelia after 5 days, and picking mycelia preserves after carrying out purifying, and each sporophore repeats 3 times.
2, spore gunite: the large photovoltaicing leather bacteria sporophore of getting collection, it is aseptically cut long 2 – 2.5cm, wide 0.5cm fritter, with scotch tape, the sporophore fritter cut is attached to substratum to cover (sporophore faces down), cultivate under being placed in room temperature, after 24 – 48h (sporophore drying need place the longer time), check whether that spore sprays and sprouts, if had, sporophore block need be removed preventing pollution, and the spore that picking has been sprouted is preserved after carrying out purifying, each sporophore repeats 3 times.If two kinds of methods are separated and mycelia after purifying is the same, then proof is separated successfully, otherwise is again separated.
The morphological feature of comprehensive large photovoltaicing leather bacteria, cultural characters, physio-biochemical characteristics and the Internal Transcribed Spacer (ITS) sequence results, be accredited as large photovoltaicing leather bacteria (Phlebiopsisgigantea).
The present invention provides the application of a kind of large photovoltaicing leather bacteria bacterial strain CGMCCNo.8653 in the Chinese softwood tree root rot of control on the other hand.
Wherein, described large photovoltaicing leather bacteria is implemented with the form of biological prevention and control agent.
Particularly, described biological prevention and control agent is prepared from as follows: after being mixed with sucrose solution by large photovoltaicing leather bacteria spore suspension, be sealed in polyethylene packet, obtain final product.
Particularly, described biological prevention and control agent is prepared from as follows: large photovoltaicing leather bacteria spore suspension is made wettable powder, is sealed in foil bag, obtains final product.
Wherein, described large photovoltaicing leather bacteria spore suspension is prepared from as follows:
Large photovoltaicing leather bacteria strains tested is activated on solid medium;
Getting appropriate activated spawn is inoculated on wort plate culture medium, cultivates 2-4 week under 28 ± 2 DEG C of conditions;
Produce after a large amount of spore until large photovoltaicing leather bacteria, with the spore on aseptic water washing wort plate culture medium, and demarcate 1.0 × 10 with blood counting chamber
4-1.5 × 10
4individual large photovoltaicing leather bacteria spore/mL, obtained large photovoltaicing leather bacteria spore suspension.
Particularly, the composition of described malt extract medium comprises Fructus Hordei Germinatus leaching powder, agar powder, KH
2pO
4, sterilized water, wherein, in often liter of malt extract medium, described Fructus Hordei Germinatus leaching powder is 20.0 ± 2g, and agar powder is 18.0 ± 2g, KH
2pO
4be 3.0 ± 0.5g, all the other are sterilized water.
Particularly, described biological prevention and control agent is prepared from as follows: large photovoltaicing leather bacteria spore and mycelia liquid are inoculated in the beech wood chip after sterilizing, are sealed in polyethylene packet, obtain final product.
Wherein, described large photovoltaicing leather bacteria enforcement to the method for Chinese softwood tree root rot is: be sprayed on after large photovoltaicing leather bacteria formulation dissolution dilution in stump.
Wherein, described large photovoltaicing leather bacteria enforcement to the method for Chinese softwood tree root rot is: be sprayed onto after large photovoltaicing leather bacteria formulation dissolution dilution on electric saw chain, the Simultaneous vaccination stump of cutting down trees with a chainsaw.
Tool of the present invention has the following advantages:
1, large photovoltaicing leather bacteria CGMCCNo.8653 bacterial strain provided by the invention reaches 55.83% to Chinese softwood tree Pathogens Causing Root Rot Disease aperture heterobasidium bacterium antagonistic rate, has good fungistatic effect.
2, large photovoltaicing leather bacteria CGMCCNo.8653 bacterial strain provided by the invention can suppress aperture heterobasidium bacterium determining on stub to be grown, effectively control softwood tree root rot, and the biological control for Chinese softwood tree root rot provides a kind of effective method.
Accompanying drawing explanation
Fig. 1 is the asexual spore figure of large photovoltaicing leather bacteria CGMCCNo.8653 in the embodiment of the present invention 1;
Fig. 2 is the glucose standard curve in embodiment 3.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.
The formula of several substratum selected in the embodiment of the present invention is as follows:
Solid medium: glucose 10.0g/L, Fructus Hordei Germinatus leaching powder 20.0g/L, agar powder 18.0g/L, KH
2pO
43.0g/L, pH nature;
Liquid nutrient medium: glucose 10.0g/L, Fructus Hordei Germinatus leaching powder 20.0g/L, KH
2pO
43.0g/L, pH nature;
Screening culture medium: glucose 30.0g/L, peptone 5.0g/L, KH
2pO
43.0g/L, MgSO
47H
2o1.5g/L, initial pH4.0;
Malt extract medium: Fructus Hordei Germinatus leaching powder 20.0g/L, agar powder 18.0g/L, KH
2pO
43.0g/L, pH nature.
The qualification of the large photovoltaicing leather bacteria CGMCCNo.8653 of embodiment 1
The morphological feature of comprehensive large photovoltaicing leather bacteria, cultural characters, physio-biochemical characteristics and the Internal Transcribed Spacer (ITS) sequence etc., be accredited as large photovoltaicing leather bacteria (Phlebiopsisgigantea).Concrete qualification result is as follows:
1, Morphological Identification
Mycelia system unified system, generative hyphae tool is simply separated, all without metachromasia in the blue reagent of Melzer and cotton, hypohostroma in KOH reagent without variable color.Bacterial context hyphae colorless, thin-walled is to slightly heavy wall, and smooth, have branch, closely regularly arranged, diameter is 2-4 μm.Nearly thalamium hyphae colorless, thin-walled, with bacterial context Hyphal form seemingly, frequent branch, closely regularly arranged, diameter is 2-3 μm; Have cystidium in thalamium, cystidium taper, colourless; thin-walled or heavy wall; top is sharper, there is a very narrow chamber centre, by xln; base portion tool one is simply separated; size is 55-86x8-11 μm, load club-like or closely cylindric, top tool 4 sterigmas; base portion tool one is simply separated, and size is 20.6-29x4-5 μm; Intend load similar to load, smaller.Sporidium is oval, colourless, and thin-walled is smooth, and all without metachromasia in Melzer and the blue reagent of cotton, size is 5.5-7x2.5-3.9 μm, average long L=6.19 μm, average wide W=3.02 μm, long-width ratio Q=2.05; Asexual spore fragment of brick shape, is ruptured by mycelia and forms.
2, the Internal Transcribed Spacer (ITS) qualification
Extract the genome of large photovoltaicing leather bacteria (Phlebiopsisgigantea) CGMCCNo.8653, material and method as follows:
2.1 material
This research is used for the sample of DNA extraction and directly has drawn from the mycelia after separation and purification.Scraping mycelia used tool is aseptic operation blade and tweezers, sterilizing above spirit lamp flame before using.
2.2Aidlab kit method
1) broken wall, adds 100 μ L lysate PL.
2) each sample adds 400 μ L lysate PL altogether, shakes up, about 65 DEG C of water-bath half an hour.
3) add 24:1 chloroform isoamyl alcohol solution 400 μ L, 13000 leave heart 5min.
4) separately get clean 1.5mL centrifuge tube, respectively get 300 μ L supernatant liquors, add 450 μ L respectively in conjunction with liquid PQ, mix immediately.
5) moved into by solution in adsorption column AC, 13000 leave heart 30s, outwell waste liquid.
6) add 400 μ L inhibitions and remove liquid IR, 12000 leave heart 30s, outwell waste liquid.
7) add 500 μ L rinsing liquid WB, 12000 leave heart 30s, outwell waste liquid.
8) add 500 μ L rinsing liquid WB, 12000 leave heart 30s, outwell waste liquid.13000 leave heart 2min again.
9) take out adsorption column AC, proceed in clean centrifuge tube, the several minutes that dries in the air of uncapping, ethanol is fully volatilized.
10) add 50-80 μ L elutriant EB, put 3-5 minute, 12000 leave heart 30s.
2.3PCR amplimer
ITS5(F):GGAAGTAAAAGTCGTAACAAGG
ITS4(R):TCCTCCGCTTATTGATATGC
2.4ITS-PCR amplification reaction system and reaction conditions
Amplification reaction system is in table 1.
Table 1PCR basis amplification reaction system
ITS-PCR reaction conditions: 95 DEG C of 3min denaturations, 94 DEG C of sex change 40s, 54 DEG C of annealing 45s, 72 DEG C extend 1min, after 34 circulations; 72 DEG C fully extend 10min, 4 DEG C of preservations.
Amplification terminate after, amplified production 3 μ L is mixed with 3 μ L bromophenol blue indicators, point sample on 1.5% sepharose, voltage stabilizing 90V, electrophoresis 30min.Checked order by Beijing Hua Da Gene science Services Co., Ltd after obtained PCR primer is reclaimed with GelExtractionKit (OMEGA), sequencing result blast program is carried out sequence alignment analysis in GenBank, and the Internal Transcribed Spacer (ITS) sequence similarity of result display bacterial strain CGMCCNo.8653 and large photovoltaicing leather bacteria (Phlebiopsisgigantea) reaches 99% (ITS sequence is shown in sequence table).
Comprehensive morphological and molecular systematics result of study, be accredited as large photovoltaicing leather bacteria (Phlebiopsisgigantea) by biocontrol strain CGMCCNo.8653.
The large photovoltaicing leather bacteria antagonism aperture heterobasidium bacterium experiment of embodiment 2
1) spore suspension is prepared
Large photovoltaicing leather bacteria (Phlebiopsisgigantea) strains tested is activated on solid medium, getting appropriate activated spawn is inoculated on wort plate culture medium, cultivate 3 weeks under 28 ± 2 DEG C of conditions, produce after a large amount of spore until large photovoltaicing leather bacteria, with the spore on aseptic water washing wort plate culture medium, and demarcate 10 with blood counting chamber
4individual large photovoltaicing leather bacteria spore/mL, obtained large photovoltaicing leather bacteria spore suspension, for subsequent use;
Aperture heterobasidium bacterium (Heterobasidionparviporum) strains tested is activated on solid medium, getting appropriate activated spawn is inoculated on wort plate culture medium, cultivate 3 weeks under 28 ± 2 DEG C of conditions, after aperture heterobasidium bacterium produces a large amount of spore, with the spore on aseptic water washing wort plate culture medium, and demarcate 4000 aperture heterobasidium bacterium spore/mL with blood counting chamber, obtained aperture heterobasidium bacterium spore suspension, for subsequent use;
Wherein, described large photovoltaicing leather bacteria (Phlebiopsisgigantea) is respectively and is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), and preserving number is the large photovoltaicing leather bacteria of CGMCCNo.8653 and the large photovoltaicing leather bacteria biotechnological formulation Rotstop-F being purchased from Verdra company of Finland; Described aperture heterobasidium bacterium (Heterobasidionparviporum) is purchased from institute of microbiology of Beijing Forestry University.
2) timber pre-treatment
Get 3 fish scale dragon spruce timbers, be numbered A, B, C respectively, wherein A is as blank group, only inoculates aperture heterobasidium bacterium; B, C are as test group, and wherein, timber B inoculates large photovoltaicing leather bacteria CGMCCNo.8653 and aperture heterobasidium bacterium; Timber C inoculates large photovoltaicing leather bacteria biotechnological formulation Rotstop-F and aperture heterobasidium bacterium; Setup Experiments 3 repetition.
Wherein, the height of described fish scale dragon spruce timber is 20cm, and diameter is 30-35cm.
3) the whole surface uniform respectively to timber B, C sprays 50mL large photovoltaicing leather bacteria CGMCCNo.8653 spore suspension and large photovoltaicing leather bacteria biotechnological formulation Rotstop-F spore suspension, and leave standstill 2 hours afterwards, timber A is left intact;
4) after described large photovoltaicing leather bacteria spore suspension is absorbed completely by timber B, C, respectively to the whole surface sprinkling 50mL aperture heterobasidium bacterium spore suspension of timber A, B, C;
5) timber A, B, C of spraying small holes heterobasidium bacterium spore suspension are placed in moist shady and cool moist place and cultivate 5-6 week, grow mycelia to large photovoltaicing leather bacteria and aperture heterobasidium bacterium;
6) on timber after incubation, direction along the radial direction perpendicular to timber cuts print, then with distilled water, the impurity on print is rinsed well, then print is placed in moist place and cultivates 1-2 week, produce spore to the large photovoltaicing leather bacteria on timber and aperture heterobasidium bacterium;
Wherein, the direction of each timber perpendicular to timber radial direction cuts 3 prints successively, the thickness of each print is 3cm.
7) antagonistic rate is calculated
Count the spore of the aperture heterobasidium bacterium in blank group and test group print, calculate the antagonistic rate of large photovoltaicing leather bacteria to aperture heterobasidium bacterium according to count results, method of calculation are as follows:
Wherein, H
(contrast)represent the aperture heterobasidium bacterium spore count of blank group, H
(test)represent the aperture heterobasidium bacterium spore count of test group.
Result shows, the antagonistic rate of large photovoltaicing leather bacteria CGMCCNo.8653 to aperture heterobasidium bacterium can reach 55.83%; And the large antagonistic rate of photovoltaicing leather bacteria biotechnological formulation Rotstop-F to aperture heterobasidium bacterium is only 42.55%.The large photovoltaicing leather bacteria Extracellular enzyme activity determination experiment of embodiment 3
1) large photovoltaicing leather bacteria seed suspension is prepared
Large photovoltaicing leather bacteria (Phlebiopsisgigantea) strains tested is activated on solid medium, getting appropriate activated spawn is inoculated in liquid nutrient medium, be 28 ± 2 DEG C in temperature, shaking speed is cultivate 7 days under 150rpm condition, obtains one grade fermemtation seed, after liquid nutrient medium homogenate, by volume for the inoculum size of 1:10 is inoculated in liquid nutrient medium, be 28 ± 2 DEG C in temperature, shaking speed is cultivate 3 days under 150rpm condition, obtain second order fermentation seed, for subsequent use;
Wherein, described large photovoltaicing leather bacteria (Phlebiopsisgigantea) is respectively and is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), and preserving number is the large photovoltaicing leather bacteria of CGMCCNo.8653 and the Rotstop biotechnological formulation Rotstop-F being purchased from Verdra company of Finland.
2) cellulase solution is prepared
Large photovoltaicing leather bacteria secondary liquid ferment-seeded is seeded in screening culture medium by 1:20 volume ratio inoculum size, it is 28 ± 2 DEG C in temperature, cultivate under rotating speed 150r/min condition after 7 days, get high fermentation liquid, centrifugal 10min under rotating speed 12000r/min condition, get supernatant liquid and be cellulase solution, for subsequent use;
3) cellulase activity is measured
Conventional sodium carboxymethyl-cellulose (CMC-Na) activity determination method is adopted to measure cellulase activity: to get 0.1mL cellulase solution, add 1.9mL carboxymethylcellulose sodium solution, mixing, be placed in after 40 DEG C of water-baths are incubated 30min, add 1.5mLDNS reagent immediately, boiling water bath 5min, taking-up is cooled to room temperature, with distilled water diluting to 25mL, after putting upside down mixing, measure light absorption value in 540nm place, the cellulase solution boiled with 0.1mL adds 1.9mL substrate carboxymethyl sodium cellulosate solution and contrasts, each process repetition 3 times.
Cellulase activity calculates: according to glucose standard curve, calculates the glucose content that CMC-Na is decomposed by carboxymethylcelluloenzyme enzyme, the enzyme amount of 1 enzyme unit definition alive required for per minute generation 1umol glucose.
As shown in Figure 2, calculate large photovoltaicing leather bacteria bacterial strain bacterial strain CGMCCNo.8653 cellulase activity according to typical curve is 3494.12U/L to glucose standard curve; And large photovoltaicing leather bacteria biotechnological formulation Rotstop-F cellulase activity is only 3332.65U/L.
The born of the same parents' outer fiber element enzyme secreted due to large photovoltaicing leather bacteria can be degraded tree cell wall cellulosic structure, reach the object of surely growing fast in stump, therefore, large photovoltaicing leather bacteria CGMCCNo.8653 of the present invention has obvious restraining effect for causing the aperture heterobasidium bacterium of Chinese softwood tree root rot.
The preparation of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 4
1) large photovoltaicing leather bacteria (Phlebiopsisgigantea) CGMCCNo.8653 is activated on solid medium, getting appropriate activated spawn is inoculated on wort plate culture medium, cultivate 3 weeks under 28 ± 2 DEG C of conditions, produce after a large amount of spore until large photovoltaicing leather bacteria, with the spore on aseptic water washing wort plate culture medium, and demarcate 10 with blood counting chamber
4individual large photovoltaicing leather bacteria spore/mL, obtained large photovoltaicing leather bacteria spore suspension;
Being formulated as follows of above-mentioned solid medium: glucose 10.0g, Fructus Hordei Germinatus leaching powder 20.0g, agar powder 18.0g, KH
2pO
43.0g, adds water to 1000mL, pH nature;
Being formulated as follows of malt extract medium: Fructus Hordei Germinatus leaching powder 20.0g, agar powder 18.0g, KH
2pO
43.0g, adds water to 1000mL, pH nature.
2) by large for 3mL photovoltaicing leather bacteria spore suspension and 7mL sucrose solution (a
w0.854, viscosity is 816mPa.s) mixing after, be sealed in polyethylene packet, obtain final product.
The preparation of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 5
1) preparation method of large photovoltaicing leather bacteria spore suspension is identical with embodiment 1;
2) after large photovoltaicing leather bacteria spore suspension is concentrated, naturally dry, obtained large photovoltaicing leather bacteria spore powder;
3) large photovoltaicing leather bacteria spore powder is mixed with diatomite, methylcellulose gum, saltpetre, Sodium dodecylbenzene sulfonate, make wettable powder;
Wherein, the weight of each component is: large photovoltaicing leather bacteria spore powder 1-10, diatomite 80-90, methylcellulose gum 0.5-1, saltpetre 0.1-1, Sodium dodecylbenzene sulfonate 8-10.
4) wettable powder is sealed in foil bag, obtains final product.
The preparation of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 6
1) preparation of large photovoltaicing leather bacteria spore and mycelia liquid:
Large photovoltaicing leather bacteria (Phlebiopsisgigantea) CGMCCNo.8653 is activated on solid medium, getting appropriate activated spawn is inoculated in liquid nutrient medium, be 28 ± 2 DEG C in temperature, shaking speed is cultivate 7 days under 150rpm condition, obtains large photovoltaicing leather bacteria fermented liquid;
With refiner by the homogenate of large photovoltaicing leather bacteria fermented liquid, obtain large photovoltaicing leather bacteria spore and mycelia liquid, save backup in 4 DEG C;
Wherein, being formulated as follows of described liquid nutrient medium: glucose 10.0g/L, Fructus Hordei Germinatus leaching powder 20.0g/L, KH
2pO
43.0g/L, pH nature;
2) large for 5mL photovoltaicing leather bacteria spore and mycelia liquid are inoculated in the beech wood chip after 5g sterilizing, grow into a certain degree until large photovoltaicing leather bacteria, be sealed in polyethylene packet, obtain final product.
The implementation method of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 7
Large photovoltaicing leather bacteria biological prevention and control agent 10mL embodiment 4 prepared is dissolved in 10L tap water, makes biological and ecological methods to prevent plant disease, pests, and erosion and controls dilution agent liquid;
Control in dilution agent liquid in biological and ecological methods to prevent plant disease, pests, and erosion and add a small amount of water-soluble dye, for marking spray area;
Dilution agent liquid is controlled in the biological and ecological methods to prevent plant disease, pests, and erosion that with the addition of dyestuff be sprayed in stump.
Wherein, every square metre of stump is sprayed the large photovoltaicing leather bacteria preparation 1 ± 5%L after dilution, spraying time is for felling in rear 24h, until fell stub water saturation, stump spray area is 100%, and spraying season is the annual 4-10 month.
The implementation method of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 8
Large photovoltaicing leather bacteria biological prevention and control agent 10mL embodiment 4 prepared is dissolved in 10L tap water, makes biological and ecological methods to prevent plant disease, pests, and erosion and controls dilution agent liquid;
Control in dilution agent liquid in biological and ecological methods to prevent plant disease, pests, and erosion and add a small amount of water-soluble dye;
Dilution agent liquid is controlled in the biological and ecological methods to prevent plant disease, pests, and erosion that with the addition of dyestuff be sprayed on electric saw chain, the Simultaneous vaccination stump of cutting down trees with a chainsaw.
Wherein, the large photovoltaicing leather bacteria preparation 1 ± 5%L in every square metre of stump after inoculation dilution, inoculating season is the annual 4-10 month.
The implementation method of the large photovoltaicing leather bacteria biological prevention and control agent of embodiment 9
Take the raw control agent of large photovoltaicing leather bacteria prepared by 5g embodiment 5 or 6, add 5L tap water, be sprayed in stump after stirring and evenly mixing.
Wherein, every square metre of stump is sprayed the large photovoltaicing leather bacteria preparation 1 ± 5%L after dilution, spraying time is for felling in rear 24h, until fell stub water saturation, timber spray area is 100%, and spraying season is the annual 4-10 month.
Claims (10)
1. a large photovoltaicing leather bacteria (Phlebiopsisgigantea), is characterized in that, is: CGMCCNo.8653 at the preserving number of CGMCC.
2. the application of large photovoltaicing leather bacteria as claimed in claim 1 in the Chinese softwood tree root rot of control.
3. apply as claimed in claim 2, it is characterized in that, described large photovoltaicing leather bacteria is implemented with the form of biological prevention and control agent.
4. apply as claimed in claim 3, it is characterized in that, described biological prevention and control agent is prepared from as follows: after being mixed with sucrose solution by large photovoltaicing leather bacteria spore suspension, be sealed in polyethylene packet, obtain final product.
5. apply as claimed in claim 3, it is characterized in that, described biological prevention and control agent is prepared from as follows: large photovoltaicing leather bacteria spore suspension is made wettable powder, is sealed in foil bag, obtains final product.
6. the application as described in claim 4 or 5, is characterized in that, described large photovoltaicing leather bacteria spore suspension is prepared from as follows:
Large photovoltaicing leather bacteria strains tested is activated on solid medium;
Getting appropriate activated spawn is inoculated on wort plate culture medium, cultivates 2-4 week under 28 ± 2 DEG C of conditions;
Produce after a large amount of spore until large photovoltaicing leather bacteria, with the spore on aseptic water washing wort plate culture medium, and demarcate 1.0 × 10 with blood counting chamber
4-1.5 × 10
4individual large photovoltaicing leather bacteria spore/mL, obtained large photovoltaicing leather bacteria spore suspension.
7. apply as claimed in claim 6, it is characterized in that, the composition of described malt extract medium comprises Fructus Hordei Germinatus leaching powder, agar powder, KH
2pO
4, sterilized water, wherein, in often liter of malt extract medium, described Fructus Hordei Germinatus leaching powder is 20.0 ± 2g, and agar powder is 18.0 ± 2g, KH
2pO
4be 3.0 ± 0.5g, all the other are sterilized water.
8. apply as claimed in claim 3, it is characterized in that, described biological prevention and control agent is prepared from as follows: large photovoltaicing leather bacteria spore and mycelia liquid are inoculated in the beech wood chip after sterilizing, are sealed in polyethylene packet, obtain final product.
9. apply as claimed in claim 3, it is characterized in that, described large photovoltaicing leather bacteria enforcement to the method for Chinese softwood tree root rot is: be sprayed on after large photovoltaicing leather bacteria biological prevention and control agent dissolved dilution in stump.
10. apply as claimed in claim 3, it is characterized in that, described large photovoltaicing leather bacteria enforcement to the method for Chinese softwood tree root rot is: be sprayed onto after large photovoltaicing leather bacteria biological prevention and control agent dissolved dilution on electric saw chain, the Simultaneous vaccination stump of cutting down trees with a chainsaw.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410162801.8A CN103923844B (en) | 2014-04-22 | 2014-04-22 | A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410162801.8A CN103923844B (en) | 2014-04-22 | 2014-04-22 | A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103923844A CN103923844A (en) | 2014-07-16 |
| CN103923844B true CN103923844B (en) | 2016-01-06 |
Family
ID=51142243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410162801.8A Expired - Fee Related CN103923844B (en) | 2014-04-22 | 2014-04-22 | A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103923844B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000067581A1 (en) * | 1999-05-07 | 2000-11-16 | Markku Halonen | Biological control method against pathogenic heterobasidion annosum and the ballet transplant manufactured by the method |
| WO2001019192A1 (en) * | 1999-09-13 | 2001-03-22 | Markku Halonen | Chemical solution, which prevents micro-organism/watersuspension to freeze, preserves micro-organisms viable and increases their growth |
| WO2002013615A1 (en) * | 2000-08-17 | 2002-02-21 | Markku Halonen | Biological control method against mosses, algae, fungi and other micro-organisms as well as the method to improve the growth of the plants |
-
2014
- 2014-04-22 CN CN201410162801.8A patent/CN103923844B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000067581A1 (en) * | 1999-05-07 | 2000-11-16 | Markku Halonen | Biological control method against pathogenic heterobasidion annosum and the ballet transplant manufactured by the method |
| WO2001019192A1 (en) * | 1999-09-13 | 2001-03-22 | Markku Halonen | Chemical solution, which prevents micro-organism/watersuspension to freeze, preserves micro-organisms viable and increases their growth |
| WO2002013615A1 (en) * | 2000-08-17 | 2002-02-21 | Markku Halonen | Biological control method against mosses, algae, fungi and other micro-organisms as well as the method to improve the growth of the plants |
Non-Patent Citations (3)
| Title |
|---|
| 大伏革菌产纤维素酶条件优化及高效菌株筛选;李杏春;《生物技术通报》;20140430(第4期);152-158页 * |
| 小孔异担子菌及其引起腐朽病害的生物防治研究;李杏春;《中国优秀硕士学位论文全文数据库农业科技辑》;20141215(第12期);D049-70页 * |
| 异担子菌及其病害防治的研究现状;戴玉成;《林业科学研究》;20051031;第18卷(第5期);615-620页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103923844A (en) | 2014-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1806495B (en) | Method for cultivating edible fungus by utilizing exotic invasive weed | |
| Kleczewski et al. | Leaf blight disease on the invasive grass Microstegium vimineum caused by a Bipolaris sp. | |
| CN110468057B (en) | Endophytic pestalotiopsis fungus M7SB41 and application thereof | |
| CN103483064A (en) | Culture medium using waste pomegranate twigs as matrix and preparation method thereof | |
| CN109554319A (en) | A kind of Bacillus strain and its application | |
| Baumgartner et al. | Spread of Armillaria root disease in a California vineyard | |
| Pelleteret et al. | Urban London plane tree dieback linked to fungi in the Botryosphaeriaceae | |
| WO2017028767A1 (en) | Method of using specialized fungus source formed from ectomycorrhiza under natural forest | |
| Snehalatharani et al. | Status of coconut basal stem rot disease in India–A review | |
| CN105112302A (en) | Metarhizium strain pathogenic to Laos false blister beetles and application of metarhizium strain | |
| CN106591145A (en) | Plectosphaerella sp. EF01 separated from root tuber of radix tetrastigme and application of Plectosphaerella sp. EF01 | |
| CN106472289A (en) | Herba Dendrobii lichen association culture systems altogether | |
| Safaee et al. | Some aspects of biology and host range of Biscogniauxia mediterranea, one of the causal agent of oak charcoal disease | |
| CN102965299A (en) | Fermentation process of Bacillus pumilus LD-b1 and its application in control of plant diseases | |
| CN103923844B (en) | A kind of large photovoltaicing leather bacteria and the application in the Chinese softwood tree root rot of control thereof | |
| CN104673723A (en) | Streptomyces longissimus SL01, microbial agents prepared from streptomyces longissimus SL01 and application of microbial agents | |
| CN104004667A (en) | Endophytic fungus capable of accelerating phosphorus absorption of cedar | |
| CN110499254A (en) | A kind of salt resistance alkali Aspergillus ochraceus bacterial strain W1 and its microbial inoculum and application | |
| CN104962501A (en) | Preparation and application of bacterial strain resistant to gray mould of vegetables and fruits and antagonist | |
| CN105483041A (en) | Application of sophora tonkinensis endogenetic bacterium B22 in prevention and treatment of panax notoginseng black spot | |
| CN105462890A (en) | Application of sophora tonkinensis endophytic bacterium B22 in preventing and controlling panax notoginseng root rot | |
| Sultana et al. | Characterization of Lasiodiplodia pseudotheobromae associated with citrus stem-end rot disease in Bangladesh | |
| CN102229892B (en) | Nomuraea rileyi strain, and application thereof | |
| Pulungan et al. | Biodiversity arbuscular mycorrhizal fungi in the former gold mine area in North Sumatra | |
| CN104232748A (en) | Rapid molecular detection method for detecting whether waxberry nursery-grown plant carries wilting germs or not |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160106 Termination date: 20210422 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |