CN103898156B - Longan ferredoxin gene is utilized to transform the method for orchid raising disease resistance - Google Patents

Abstract

The invention provides a kind of method utilizing longan ferredoxin gene to transform orchid raising disease resistance, belong to gene engineering technology field.Utilize transgenic technology that longan ferredoxin gene <i>Dlfd3</iGreat T.GreaT.GT (accession number: JF733784) is imported orchid oncidiumLuridum, obtain the ability of the transformed plant higher transplanting survival rate of performance and antagonism disease.Compared with WT lines, transfer-gen plant opposing soft rot ability improves, by height feel soft rot (Di=100) be promoted in anti-soft rot (Di=27.5), transplanting survival rate is increased to 95.7% by 79.3%, all reaches pole significant difference level.

Description

Longan ferredoxin gene is utilized to transform the method for orchid raising disease resistance

Technical field

The invention belongs to gene engineering technology field, relate to a kind of method utilizing longan ferredoxin gene to transform orchid raising disease resistance, be specifically related to application and the orchid breeding of longan ferredoxin gene.

Background technology

OncidiumLuridum ( oncidium) have another name called taxi dancer orchid, gold phalaenopsis, Oncidinm etc., be important basin cut-flower Economical cultivation kind.OncidiumLuridum easily suffers from soft rot (Softrot), and in the transplanting stage of tissue cultured seedling, soft rot more can bring the strike of ruining property.At present, this disease does not have special effectively preventing method, and therefore seed selection anti-soft rot oncidiumLuridum kind is the important topic of oncidiumLuridum breeding.OncidiumLuridum can carry out genus cross and intergeneric hybridization widely, but genus cross or its avidity of intergeneric hybridization all poor, result is comparatively rare under field conditions (factors), be difficult to utilize traditional breeding method to change the single traits of some kind, thus utilize transgenic technology fast lifting oncidiumLuridum Economical cultivation proterties to become the important means of oncidiumLuridum breeding.

Ferredoxin gene (ferredoxin, fd) gene is as large gene family ubiquity in plant, plant FD albumen mostly is [2Fe-2S] type, electron transmission is participated in photosynthesis PSI system, electron donor as Ferredoxin-NAD (P) (+) oxidoreductase (FNR) participates in the regeneration of NADP, closely related with the accumulation of plant activity in vivo oxygen (reactiveoxygenspecies, ROS).Because ROS plays intracellular signaling and allergy (hypersensitiveresponse in the generation of plant resistance to environment stress, and programmed cell death (programmedcelldeath HR), PCD) dual function of energy sources, now confirmed to be derived from pimento (Capsicumannuum) class ferredoxin gene ( pflp) paddy rice, tobacco, Arabidopis thaliana and oncidiumLuridum can be helped to obtain resistance of wide spectrum interior many plants, but transform the different subcellular organelle in location fdcan gene pairs plant produce disease resistance material impact.

Before this, we are based on Dimocarpus longan transcript profile data, the dissimilar ferredoxin NCBIGenBank gene accession number of separating clone 6 is respectively JF733781, JF733783, JF733784, JF733785, JF733787, JF733788, JX996183, wherein, that obtain cDNA total length is JF733784, JF957855, JF957858, JF957857, respectively called after dlfd3, dlMFDX1, dlfdc1, dlMFDX2.Phylogenetic analysis shows, dlfd3, dlfdc1 and pimento pflpgene has certain homology, may have physiological action in raising disease resistance of plant.Before this, related genera ferredoxin gene improves the rarely seen class ferredoxin being derived from pimento in disease resistance of plant aspect and is in the news, and is derived from the dissimilar of other species fdwhether gene is and to be improved disease resistance function still unknown.The present invention will be by being derived from two ferredoxin gene of longan dlfd3, dlfdc1 utilize agriculture bacillus mediated technological sourcing oncidiumLuridum cut-flower cultivar south alizarin ( onc.GowerRamsey) protocorm (protocorm-likebody, PLB), have successfully been obtained transformed plant, connect bacterium test through soft rot (softrot), find to transform dlfd3 gene oncidiumLuridum plants can significantly improve the anti-soft rot ability of oncidiumLuridum seedling.

summary of the invention:

The object of this invention is to provide a kind of method utilizing longan ferredoxin gene to transform orchid raising disease resistance, utilize transgenic technology by longan ferredoxin gene dlfd3 import orchid, improve the ability of transformed plant antagonism disease.Wherein said orchid is oncidiumLuridum or dendrobium, preferred oncidiumLuridum.To resist disease be soft rot.

For achieving the above object, the present invention adopts following technical scheme:

Utilize longan ferredoxin gene to transform a method for orchid raising disease resistance, utilize transgenic technology by longan ferredoxin gene dlfd3, NCBIGenBank gene accession number: JF733784, imports orchid, obtains the transformed plant with disease resistance ability.

Described orchid is oncidiumLuridum or dendrobium.

Described disease resistance is soft rot.

beneficial effect of the present invention:

1,the present invention, by systematic study, has cloned longan ferredoxin gene first dlfd3and dlfdc1cDNA total length.

2, utilize transgenic technology that longan ferredoxin is imported orchid, the transplanting survival rate of orchid can be significantly improved.

3, utilize transgenic technology that longan ferredoxin is imported orchid, the ability of the opposing soft rot of orchid can be significantly improved.

accompanying drawing illustrates:

Fig. 1 carrier structure figure.

Fig. 2 transforms dlfd3/Dlfdc1the PCR qualification of plant.Wherein, A is for transforming dlfdc1plant, B is for transforming dlfd3plant; Get the seedling leaf of taking root after screening and culturing to carry out transforming rear PCR and identify.About 500bp present positive band for integrate foreign genes plant.

Fig. 3 transforms dlfd3plantlet of transplant simultaneous test.Seedling of taking root grows to more than 6cm and transplants, each process transplanting 128 strain, repeats 3 times, transplants and add up surviving rate after 2 months.Overexpression dlfd3positive plant transplanting survival rate is significantly higher than wild-type.Wherein WT: wild-type, E2: overexpression dlfdc1positive plant, E3: overexpression dlfd3positive plant.

Fig. 4 transforms dlfd3/Dlfdc1the anti-soft rot ability test of plantlet of transplant.Overexpression dlfd3positive plant is transplanted anti-soft rot ability and is significantly higher than wild-type.Wherein WT: wild-type, E2: overexpression dlfdc1positive plant, E3: overexpression dlfd3positive plant.

Embodiment

Embodiment 1

1, dlfd3/Dlfdcoverexpression vector builds

Utilize Trizol ^tMtest kit (Ivitrogen) extracts Dimocarpus longan RNA, utilizes RevertAidTMFirst-StrandSynthesisSystem (Fermantas) to synthesize cDNA first chain.

According to longan ferredoxin gene dlfd3, dlfdc1design band restriction endonuclease sites bgliI, spethe corresponding primer of upstream and downstream of I dlfd3f:5 '-GAAGATCTATGGCAACTGTGACCCTTAG-3 ', dlfd3r:5 '-GGACTAGTGTAAAGTTCGCCTTCCTTGTG-3 '; dlfdc1f:5 '-GAAGATCTATGGCAACACTTCACTTCAG-3 ', dlfdc1r:5 '-GGACTAGTATCATCAGCAGTTGCCAGTTG-3 '.25 μ LPCR reaction systems: 10XPCRbuffer (plusMg ²⁺) 2.5 μ L, dNTPs (2.5mmolL ^-1) 0.5 μ L, forward primer (10 μm of olL ^-1) 1 μ L, reverse primer (10 μm of olL ^-1) 1 μ L, Taq (5U μ L ^-1) 0.2 μ L, ddH ₂o18.8 μ L.PCR response procedures: 94 DEG C of denaturation 4min, 94 DEG C of sex change 45s, 54 DEG C of annealing 45s, 72 DEG C extend 40s, if 35 circulations, last 72 DEG C extend 10min.1.0% (W/V) agarose electrophoresis detects PCR primer, reclaims about 500bp band, imports PMD18-T(TAKARA) build PMD18-T plasmid.Utilize FermentasFastDigest(ThermoFisherScientific) restriction enzyme bglII, speIdouble digestion pCAMBIA1302 and PMD18-T- dlfd3/ dlfdc1plasmid, reclaims digested plasmid and about 500bp small segment, utilizes T4 ligase enzyme by longan dlfd3/ dlfdc1channel genes pCAMBIA1302(p1302), build p1302:: dlfd3/ dlfdc1plasmid, the plasmid built detects through PCR, imports E. coli competent DH5 α (TIANGEN), in containing peace penicillin G 50mgL ^-1lB solid medium coated plate, positive strain send Hua Da gene sequencing, detects montage exactness, completes binary expression vector p1302:: dlfd3/ dlfdc1structure (see figure 1).

2, the preparation of Agrobacterium

Utilize mini-scale plasmid to extract test kit (TIANGEN) and extract p1302: in bacillus coli DH 5 alpha: dlfd3/ dlfdc1plasmid, utilize calcium channel method by Plastid transformation EHA105 Agrobacterium competence, in being 75mg/LYEB solid medium coated plate containing kantlex and Streptomycin sulphate, picking positive colony, in being 75mg/LYEB liquid nutrient medium containing kantlex and Streptomycin sulphate, is placed in shaking table, 28 DEG C, 250rpm, is cultured to OD600=0.4, for subsequent use.

3, the conversion of oncidiumLuridum

With subculture 35dPLB for cultivated material, PLB is placed in 0.5M sucrose MS liquid nutrient medium, be placed in 80RPM shaking table, high osmotic treatment 2h, again by preculture under 3d dark condition, to be placed in by PLB material after pre-treatment with the concentration that MS liquid nutrient medium is resuspended be OD600=1.0, and EHA105 Agrobacterium bacterium liquid carries out infecting 30min, be placed in Dual culture 3d under MS substratum dark condition, bacterium 20min is washed with 200mg/L cephalo (cefatoxime), and be transferred to containing 50mg/L cephalo MS substratum, 25 DEG C, second order Dual culture is carried out in 16h/d illumination, proceeds to containing 5mgL after 30d ^-1hygromycin selection substratum, 25 DEG C, 16h/d illumination, cultivates 45d, repeats screening and culturing 3 times, resistant plant is proceeded to common culture medium culturing 60d of taking root, transplant to pasture and water to be measured.

4, after transforming, plant PCR detects

Utilize CTAB method to extract and transform rear oncidiumLuridum leaves genomic DNA.Whether plant is imported by PCR testing goal gene band checking T-DNA.PCR reaction system and reaction conditions the same.After testing, turn dlfdc1survey strain is waitd upon in 11 strains of gene has 7 plant to have positive band, turns dlfd3survey strain is waitd upon in 11 strains of gene has 8 plant to have positive band.

5, after transforming, the disease resistance of plant detects (see Fig. 2).

With reference to methods such as Yin Junmei, choose the sick leaf of oncidiumLuridum soft rot, after 75% ethanol surface sterilization, picking disease strong joint portion tissue juice draws plate in NA solid medium, single bacterium colony of picking is placed in shaking table in NA liquid nutrient medium, 28 DEG C, 250rpm, shakes bacterium and spends the night, and picking has virulence bacterium liquid to detect for disease resistance.Utilize 10 μ L rifle heads to dip bacterium liquid, in second true leaf surface punching, not penetrate blade for degree, after inoculation 10d, observe incidence.Reference Yin Junmei etc. [Yin Junmei, Ren Yu, Yang Guangsui, editors (2008) dendrobium germ plasm resource Description standard and Standard of control data quality. Beijing, statistics disease index .] method, statistics disease index.Find through contrast, compared with WT lines, turn dlfd3gene plant opposing soft rot ability improves, by height feel soft rot (Di=100) be promoted in anti-soft rot (Di=27.5) (see Fig. 3, transplanting survival rate is increased to 95.7%(by 79.3% and sees Fig. 4), reach pole significant difference level.

The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.

SEQUENCELISTING

<110> University Of Agriculture and Forestry In Fujian, Sanming City research of agricultural science institute

<120> utilizes longan ferredoxin gene to transform the method for orchid raising disease resistance

<130>4

<160>4

<170>PatentInversion3.3

<210>1

<211>28

<212>DNA

<213> artificial sequence

<400>1

gaagatctatggcaactgtgacccttag28

<210>2

<211>29

<212>DNA

<213> artificial sequence

<400>2

ggactagtgtaaagttcgccttccttgtg29

<210>3

<211>28

<212>DNA

<213> artificial sequence

<400>3

gaagatctatggcaacacttcacttcag28

<210>4

<211>29

<212>DNA

<213> artificial sequence

<400>4

ggactagtatcatcagcagttgccagttg29

Claims (3)

1. utilize longan ferredoxin gene to transform a method for orchid raising disease resistance, it is characterized in that: utilize transgenic technology by longan ferredoxin dlfd3, accession number: JF733784, imports orchid, obtains the transformed plant with disease resistance ability; Wherein carrier construction method is: according to longan ferredoxin gene dlfd3design band restriction endonuclease sites bgliI, spethe corresponding primer of upstream and downstream of I dlfd3f:5 '-GAAGATCTATGGCAACTGTGACCCTTAG-3 ', dlfd3r:5 '-GGACTAGTGTAAAGTTCGCCTTCCTTGTG-3 '; 25 μ LPCR reaction system: 10XPCRbuffer are containing Mg ²⁺2.5 μ L, dNTPs2.5mmol L ^-1, 0.5 μ L, forward primer 10 μm of ol L ^-1, 1 μ L, reverse primer 10 μm of ol L ^-1, 1 μ L, Taq5U μ L ^-1, 0.2 μ L, ddH ₂o18.8 μ L, PCR response procedures: 94 DEG C of denaturation 4min, 94 DEG C of sex change 45s, 54 DEG C of annealing 45s, 72 DEG C extend 40s, if 35 circulations, last 72 DEG C extend 10min; 1.0%W/V agarose electrophoresis detects PCR primer, reclaims about 500bp band, imports PMD18-T and builds PMD18-T plasmid; Utilize FermentasFastDigest restriction enzyme bglII, speIdouble digestion pCAMBIA1302 and PMD18-T- dlfd3plasmid, reclaims digested plasmid and about 500bp small segment, utilizes T4 ligase enzyme by longan dlfd3channel genes pCAMBIA1302, builds p1302:: dlfd3 plasmids, the plasmid built detects through PCR, imports E. coli competent DH5 α, in containing penbritin 50mg L ^-1lB solid medium coated plate, positive strain send Hua Da gene sequencing, detects montage exactness, completes binary expression vector p1302:: dlfdthe structure of 3/.

2. a kind of method utilizing longan ferredoxin gene to transform orchid raising disease resistance according to claim 1, is characterized in that: described orchid is oncidiumLuridum or dendrobium.

3. a kind of method utilizing longan ferredoxin gene to transform orchid raising disease resistance according to claim 1, is characterized in that: described disease resistance is soft rot.