CN109554354A

CN109554354A - The tobacco ferredoxin and its encoding gene of Rice Resistance characteristic of disease can be improved

Info

Publication number: CN109554354A
Application number: CN201811582005.4A
Authority: CN
Inventors: 陈功友; 马文秀; 邹丽芳; 徐夏萌; 朱章飞
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2018-12-24
Filing date: 2018-12-24
Publication date: 2019-04-02

Abstract

The present invention relates to the tobacco ferredoxins and its encoding gene that can improve Rice Resistance characteristic of disease, belong to Genetic Engineering for Disease Resistance in Rice field.Ubiquitination occurs for the tobacco ferredoxin Ferredoxin (NbFd) in effect protein XopL mediated plant cell, it is degraded immediately by proteasome, the quantity for making NbFd enter plant cell chloroplast reduces, to inhibit the electron transmission in photosynthesis, lead to accumulated active oxygen, inducing plant generates allergic reaction (HR) class disease resistance response.With XopL interaction, but after the Ferredoxin protein coding gene NbFd from tobacco is transferred to rice, rice does not can be improved to the resistance of bacterial leaf-blight in Ferredoxin albumen in rice.The present invention passes through the tobacco Ferredoxin protein coding gene NbFd that protein interaction approach obtains, and can be used as the genetic resources of rice bacterial blight resistance breeding, the NbFd transgenic paddy rice of acquisition significantly improves the resistance to bacterial leaf-blight.

Description

The tobacco ferredoxin and its encoding gene of Rice Resistance characteristic of disease can be improved

Technical field

The invention belongs to Genetic Engineering for Disease Resistance in Rice fields, more particularly, to a kind of and rice Xanthomonas campestris effect protein XopL Interaction and the tobacco ferredoxin Ferredoxin and its encoding gene NbFd that Rice Resistance characteristic of disease can be significantly improved.

Background technique

Bacterial blight of rice by rice Xanthomonas campestris bacterial leaf spot pvs oryzae and oryzicola (Xanthomonas oryzae pv.oryzae, Xoo) cause, be a kind of important rice disease.The disease has generation in each rice region in China, and South Rice Region of China morbidity is heavier, can lead Underproduction 20%-50% is caused, can cause to have no harvest when serious.Plantation resistant variety is the prevention and treatment most economical effective means of bacterial leaf-blight.

The three type excretory systems (type III secretion system, T3SS) of Xoo are bacterial invasion and build with plant The key pathogenetic factor of vertical parasitism, it is the hrp gene cluster formed by nearly 30 genes, the table after accurately regulating and controlling It reaches, encode, assembling formation.The type III effect protein secretion that T3SS synthesizes bacterium enters plant cell, causes host plant Susceptibility.In Xoo and plant cooperated evolutionary process, resistance plant enters the effect egg of cell by generating resistance protein identification It is white, and start Resistant reaction.However, target of the majority Xoo type III effect protein in plant has not yet to see report.

Tobacco is the non-host plant of Xoo, and strong Resistant reaction is generated after being infected by Xoo, it is bad to show as anaphylaxis Dead reaction (hypersensitive response, HR).Non―technological factors have the characteristics that stablize, persistently, be not easy to be overcome. The resistant gene that non-host source is expressed in host plant can effectively improve the disease resistance of plant.Xoo excites tobacco to generate HR The ability of reaction also relies on T3SS, therefore using the type III effect protein of Xoo as starting point, and there is excitation tobacco to generate for screening The effect protein of HR respond, and to identifying that the factor of the effect protein identifies in tobacco helps to excavate new anti- Property gene.

Summary of the invention

It is an object of the invention to: overcome existing Resistance genes of vice inadequate resource, provide it is a kind of from tobacco can be with Excitation tobacco generates the effect protein XopL interaction of HR and improves the tobacco protein Ferredoxin of rice bacterial blight resistance ability And its encoding gene NbFd.

The purpose of the present invention can be achieved through the following technical solutions:

First aspect present invention: a kind of rice Xanthomonas campestris effect protein XopL, the rice Xanthomonas campestris effect protein are provided XopL amino acid sequence is as shown in SEQ ID NO.1, by mediated by agriculture bacillus, in Ben's tobacco (Nicotiana Benthamiana) in blade after transient expression, it is anti-that the rice Xanthomonas campestris effect protein XopL can excite tobacco to generate allergy Answer (HR).

The rice Xanthomonas campestris effect protein XopL comes from No. six microspecies of rice Xanthomonas campestris bacterial leaf spot pvs oryzae and oryzicola Philippine PXO99^A。

Rice Xanthomonas campestris effect protein XopL is in ncbi database (https: //www.ncbi.nlm.nih.gov/) Number is PXO_01620, which is 656 amino acid.

The transient expression vector is binary vector pHB, in (" Mao J.et al., A role for Arabidopsis cryptochromes and COP1in the regulation of stomatal opening.Procedings of the National Academy of Sciences of the United States Of America, 2005.102 (34) .p.12270-12275 ") in disclose.

It is conventional experimental technique means using mediated by agriculture bacillus albumen transient expression, this method exists (《Shamloul M.et al.,Optimization and utilization of Agrobacterium-mediated transient protein production in Nicotiana.Journal of Visualized Experiments, 2014.19 (86) .doi:10.3791/51204 ") in disclose.

The rice Xanthomonas campestris effect protein XopL has ubiquitin ligase activity.

Second aspect of the present invention: a kind of tobacco ferredoxin that can improve Rice Resistance characteristic of disease, i.e. Ferredoxin are provided Albumen, abbreviation NbFd, amino acid sequence is as shown in SEQ ID NO.2.

The tobacco ferredoxin that Rice Resistance characteristic of disease can be improved and rice Xanthomonas campestris effect protein XopL interaction, it is described Rice Xanthomonas campestris effect protein XopL amino acid sequence is as shown in SEQ ID NO.1.

The tobacco ferredoxin that Rice Resistance characteristic of disease can be improved comes from Ben's tobacco (Nicotiana benthamiana)。

Searching number of the Ferredoxin albumen in ncbi database (https: //www.ncbi.nlm.nih.gov/) be AKQ98361, sequence length are 144 amino acid.

By yeast two-hybrid method, NbFd albumen and XopL interaction are screened in Ben's Tobacco cDNA library.

Third aspect present invention: providing a kind of tobacco ferredoxin encoding gene that can improve Rice Resistance characteristic of disease, referred to as NbFd encodes the tobacco ferredoxin that can improve Rice Resistance characteristic of disease.The tobacco iron oxygen of Rice Resistance characteristic of disease can be improved also Protein coding gene nucleotide sequence is as shown in SEQ ID NO.3, sequence length 435bp.

Fourth aspect present invention: the application of the tobacco ferredoxin that can improve Rice Resistance characteristic of disease is provided.

The tobacco ferredoxin that Rice Resistance characteristic of disease can be improved is mediated by rice Xanthomonas campestris effect protein XopL and occurs Ubiquitination and degradation are positioned at the ability decline of plant chloroplast, cause photosynthesis electron transmission to be obstructed to plant cell Interior accumulated active oxygen generates, and then leads to the disease resistance response of tobacco generation allergic reaction class.

Wherein, the method for vitro detection ubiquitination experiment is disclosed.Used kit Ubiquitin Conjugation Kit-960 be purchased from U.S. Boston Biochem company, experimental implementation according to kit specification (http: // Www.bostonbiochem.com/product/k-960 it) carries out.

Fifth aspect present invention: answering for the tobacco ferredoxin encoding gene that can improve Rice Resistance characteristic of disease is provided With by transgenic method, the tobacco ferredoxin encoding gene that will improve Rice Resistance characteristic of disease is transferred in rice, is resisted The increased rice of bacterial leaf-blight ability.

The transgenic method is pCAMBIA1300 by mediated by agriculture bacillus, transgene carrier used, and eukaryon selection markers are Hygromycin.

Wherein, pCAMBIA1300 binary vector information ncbi database (https: // Www.ncbi.nlm.nih.gov/ it is disclosed in), searching number AF234296.1.

Further, the rice is japonica rice variety OryzasativaLcv.Nipponbare (Nipponbare).

The present invention is transferred to japonica rice variety OryzasativaLcv.Nipponbare by transgenic technology, by NbFd gene, obtains bacterial blight-resisting ability Increased rice strain A121.

Compared with prior art, the invention has the following beneficial effects:

The present invention obtains the tobacco protein with rice Xanthomonas campestris effect protein XopL interaction by yeast two-hybrid method Ferredoxin and its encoding gene NbFd.Be experimentally confirmed XopL mediate tobacco Ferredoxin albumen occur ubiquitination and Degradation causes resistance to generate so that reactive oxygen species in plant be made to increase.Express the anti-Bai Ye of transgenic paddy rice A121 of NbFd Blight ability improves.

Detailed description of the invention

Fig. 1, mediated by agriculture bacillus the XopL evoking tobacco after Ben's Tobacco Leaf on piece transient expression generate Resistant reaction, containing sky The Agrobacterium of carrier pHB is as control.A figure is XopL evoking tobacco cell death.B figure is XopL evoking tobacco active oxygen in leaves Accumulation.C figure is qRT-PCR detection Resistant reaction related gene expression.

Fig. 2, XopL and tobacco Ferredoxin (being abbreviated as NbFd) interactions between protein are verified by yeast two-hybrid method, and Not with rice Fe rredoxin albumen (OsFd) interaction.Specifically, A figure is XopL and NbFd full-length proteins double cross result. For xopL gene cloning to pGADT7 (AD) carrier, NbFd encoding gene is cloned into pGBKT7 (BD) carrier, empty carrier AD and NbFd Or empty carrier BD and XopL cotransformation are as negative control.N-terminal, C-terminal and the Fd interaction that B figure is XopL, the C-terminal of NbFd albumen with XopL interaction.C figure is XopL and three OsFd protein yeast double cross result.

Fig. 3, XopL mediate tobacco Ferredoxin albumen (NbFd) ubiquitination and degradation.Specifically, A figure is vitro detection XopL mediates NbFd proteins ubiquitin.B figure is XopL induction NbFd protein degradation.Dpi represents number of days after injection.

Fig. 4, turn the increase of NbFd trans-genetic hybrid rice (A121) bacterial blight-resisting ability.Specifically, A figure is that RT-PCR detection turns base Because of NbFd gene expression detection in rice, OsActin is as reference gene.B figure is PXO99^ABacterial strain is in transgenic paddy rice A121 With scab length caused on wild rice OryzasativaLcv.Nipponbare (being abbreviated as Np).*: being examined using Student T-test, P < 0.05 When significant difference.C figure is representative leaf spot lesion photo.

Specific embodiment

The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.

In the following examples, the experimental methods for specific conditions are not specified, is conventional method.

Embodiment 1.xopL gene cloning and expression

(1) clone of xopL gene

With PXO99^AGenome is template, with primer XopL-F (see SEQ ID NO.4) and XopL-R (see SEQ ID NO.5 xopL gene) is expanded, is cloned on binary vector pHB using the site XbaI, the plasmid pHBxopL of acquisition is transferred to agriculture bar In bacterium EHA105, for expressing xopL.

(2) mediated by agriculture bacillus xopL transient expression

After the overnight Agrobacterium culture containing plasmid pHBxopL, with buffer-induced liquid (10mM MgCl₂, 0.2mM Acetosyringone, 200mM MES, pH 5.6) wash it is primary after, adjust bacterial concentration OD₆₀₀To 1.0.After being stored at room temperature 1 hour, Inject tobacco leaf；The Agrobacterium for injecting the pHB containing empty carrier is negative control.After expression 7 days, XopL evoking tobacco blade is generated HR reaction and cell death (referring to Figure 1A), this process are expressed with accumulated active oxygen (referring to Figure 1B) and resistance related gene (referring to Fig. 1 C).

Dead cell is detected with Evans blue dye method in the present embodiment.Specifically, it after Agrobacterium is injected 7 days, uses After the Evans Blue dye solution of 0.25% (w/v) impregnates blade 24 hours, the boiling decoloring in 95% ethyl alcohol.

Reactive oxygen species are detected with DAB decoration method in the present embodiment.Specifically, after Agrobacterium is injected 6 days, with 1mg/mL's After DAB dye liquor impregnates blade 24 hours, the boiling decoloring in 95% ethyl alcohol.

2. yeast two-hybrid of embodiment obtains Ferredoxin albumen and XopL interaction

The present embodiment clones the overall length of tobacco Ferredoxin gene, and it is mutual with XopL to verify it by yeast-two hybrid technique Make.Specifically: using XopL as bait, the interaction factor is screened from Tobacco cDNA library, is sequenced in determining positive colony and is contained Ferredoxin protein coding gene.With primers F d-F (SEQ ID NO.6) and Fd-R (SEQ ID NO.7) in tobacco cDNA Expand Ferredoxin gene.PCR product is connected to pGBKT7 carrier after NdeI and EcoRI digestion, obtains pGBKT7-Fd, With expression xopL pGADT7-xopL plasmid cotransformation yeast AH109 after, carry out double cross, determine Ferredoxin albumen with XopL interaction (A referring to fig. 2).

The verifying of embodiment 3.XopL and Ferredoxin interaction structural domain

The present embodiment constructs the mutant of XopL and Ferrdoxin albumen by truncating, and further both verifyings mutually make knots Structure domain.Specifically, with the N-terminal (1- of primer XopL-F (SEQ ID NO.4) and XopL-N-R (SEQ ID NO.8) amplification XopL 452aa) structural domain XopL-N；The C of primer XopL-C-F (SEQ ID NO.9) and XopL-R (SEQ ID NO.5) amplification XopL It holds (453-656aa), i.e. XopL-C.The PCR product of each mutant of XopL is cloned into pGADT7 carrier respectively.With primers F d- The C-terminal (51-144aa) of C-F (SEQ ID NO.10) and Fd-R (SEQ ID NO.7) amplification Ferredoxin, is cloned into PGBKT7 carrier.Yeast two-hybrid result prove XopL N-terminal and C-terminal all with Ferredoxin interactions between protein, and The C-terminal of Ferredoxin albumen still with XopL interaction (B referring to fig. 2).

Ferredoxin albumen in 4. rice of embodiment not with XopL interaction

Ferredoxin albumen is present in all plants, but protein sequence has variation.There are four in rice Ferredoxin albumen, the website rice genome annotation (http: // Rice.plantbiology.msu.edu/ the gene number on) is LOC_Os01g64120.1 (OsFd1), LOC_ respectively Os05g37140.2 (OsFd2), LOC_Os08g01380.1 (OsFd3) and LOC_Os03g61960.2 (OsFd4).With OryzasativaLcv.Nipponbare Oryza sativa genomic dna is template, is expanded with primer OsFd1-F (SEQ ID NO.11) and OsFd1-R (SEQ ID NO.12) OsFd1；OsFd2 is expanded with primer OsFd2-F (SEQ ID NO.13) and OsFd2-R (SEQ ID NO.14)；Use primer OsFd3-F (SEQ ID NO.15) and OsFd3-R (SEQ ID NO.16) expands OsFd3, and three OsFd genes are utilized NdeI and EcoRI is cloned respectively to be entered in pGBKT7 carrier, and pGBKT7-OsFd1, pGBKT7-OsFd2 and pGBKT7- are obtained OsFd3.PGBKT7-OsFd1, pGBKT7-OsFd2 or pGBKT7-OsFd3 and pGADT7-xopL plasmid are distinguished into cotransformation ferment After female AH109, double cross is carried out, determines that OsFd albumen cannot be with XopL interaction (C referring to fig. 2).

Embodiment 5.XopL mediates Ferredoxin proteins ubiquitin and degradation

(1) vitro detection Ferredoxin proteins ubiquitinization is reacted

In the present embodiment, the Ubiquitin Conjugation Kit-960 of Boston Biochem company is used.The examination E1 and E2 enzyme, ubiquitin molecule and reaction buffer needed for agent box provides ubiquitin reaction.The fusion of purifying has the XopL of GST label For albumen as E3 ligase, the tobacco Ferredoxin albumen (NbFd) for merging His label is used as substrate, small in 37 DEG C of reactions 4 When.After reaction, 5 × SDS loading buffer is added, boiling water bath boils 8 minutes.Albumen is through 10%SDS-PAGE glue point It from rear, is transferred on pvdf membrane, is detected after being incubated for His antibody.In the reaction containing XopL, NbFd molecular weight of albumen increases Add, ubiquitination reaction occurs (referring to Fig. 3 A).

(2) in the present embodiment, the XopL albumen of Flag label and the NbFd albumen of fusion myc label will be merged in Tobacco Leaf It is co-expressed in piece, respectively the Western hybridization check NbFd protein content after 2 days, 3 days and 4 days, to be total to table with empty carrier pHB The NbFd protein content reached is control.At the 3rd day, XopL is obviously promoted NbFd protein degradation；NbFd protein degradation is more at the 4th day Add significant (referring to Fig. 3 B).Being hybridized with internal reference albumen actin autoantibody proves that actin protein content is not become with XopL presence Change.Even if co-express with XopL, NbFd protein coding gene is in rna level without significant difference (referring to Fig. 3 B).

6. turns of NbFd trans-genetic hybrid rice Resistance detectings of embodiment and its application

(1) acquisition of transgenic paddy rice

The NbFd gene in tobacco source is transferred in OryzasativaLcv.Nipponbare rice varieties by the present embodiment, obtains transgenic paddy rice A121. Specifically: expanding NbFd gene, and and 35s with primer NbFd-F1 (SEQ ID NO.17) and NbFd-R1 (SEQ ID NO.18) After promoter and NOS terminate fusion, it is cloned into pCAMBIA1300.It constructs correct plasmid and is transferred to Agrobacterium EHA105.Recombination Agrobacterium infects OryzasativaLcv.Nipponbare Mature Embryos of Rice, evoked callus, will successful regeneration on Antibiotic medium containing hygromycin simultaneously The plant to take root is named as A121.

(2) transgenic paddy rice detects

A121 rice plant blade total serum IgE is extracted, the cDNA obtained after reversion is as template, respectively with primer NbFd-F1 (SEQ ID NO.17) and NbFd-R1 (SEQ ID NO.18) are expanded, with primer Actin-F (ATCTCACGCATTACCCTACCTT is shown in SEQ by (GTTCCTGCTGTTTGTTCTGTTG is shown in SEQ ID NO.19) and Actin-R ID NO.20) amplification reference gene Actin.

Amplification is shown in that Fig. 4 A, the first swimming lane indicate receptor rice OryzasativaLcv.Nipponbare, second and third swimming lane indicates transgenic paddy rice No. 2 of A121 and No. 3, NbFd gene successful expression in A121 rice.

(3) transgenic paddy rice bacterial blight-resisting ability detects

Xoo bacterial strain PXO99 is inoculated with to No. 2 of transgenic paddy rice A121 and No. 3 strain leaf-cutting^A, bacterial concentration is OD₆₀₀Value is equal to 0.8.Method particularly includes: blade tip about 2cm is cut off after the scissors of bacterium solution wetting sterilizing.Every plant of rice is inoculated with 3-5 piece Leaf investigates scab length, finally takes the average value of multiple blades, do t-test variance analysis (P < 0.05) after ten days.As a result such as Shown in Fig. 4 B and Fig. 4 C, compared with OryzasativaLcv.Nipponbare rice (Np), A121-2 and A121-3 are significantly increased to PXO99^ABacterial strain resists Property.

It is transferred in rice using NbFd gene provided by the invention (nucleotide sequence is shown in SEQ ID NO.3) as a result, to Rice is mediated to generate bacterial blight-resisting ability.

The above description of the embodiments is intended to facilitate ordinary skill in the art to understand and use the invention. Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein general Principle is applied in other embodiments without having to go through creative labor.Therefore, the present invention is not limited to the above embodiments, ability Field technique personnel announcement according to the present invention, improvement and modification made without departing from the scope of the present invention all should be of the invention Within protection scope.

Sequence table

<110>Shanghai Communications University

<120>the tobacco ferredoxin and its encoding gene of Rice Resistance characteristic of disease can be improved

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 656

<212> PRT

<213> Xanthomonas oryzae pv. oryzae

<400> 1

Met Arg Lys Ala Met Arg Arg Val Asp Gln Pro Arg Leu Pro Gly Thr

1 5 10 15

Pro Val Gly Leu Arg Glu Gln Ser Thr Ser Asn Ala Asp Ala Pro Ala

20 25 30

Arg Asn Glu Pro Ala Ala Gln Pro Ala Pro Glu Arg Pro Ala Gly Met

35 40 45

Leu Arg Gly Leu Ala Ser Tyr Leu Pro Gly Tyr Arg Ser Gly Arg Pro

50 55 60

Pro Ala Thr Pro Ala Ser Ala Gln Thr Ser Ser Arg Pro Thr Thr Ser

65 70 75 80

Ala Arg Pro Val Arg His Gly Glu Ser Ser Ser Ser Val Arg Met Asn

85 90 95

Glu Ala Pro Ala Asp Pro Ser Gln Thr Pro Gln Leu Pro Gln Leu Ser

100 105 110

Asn Ile Glu Arg Ala Arg Phe His Ala Val Ala Thr Asp Ser His His

115 120 125

Leu Gly Pro Thr Arg Pro Thr Val Pro Pro Thr Val Gly Ala Ser Leu

130 135 140

Gln Ser Ser Thr Pro Ile Arg Pro Tyr Arg Asp Val Leu Ser Gln Trp

145 150 155 160

Gln Gln His Tyr Asp Ala Asp Arg Asn Gly Trp His Ser Ala Trp Arg

165 170 175

Gln Ala Asn Ser Asp Thr Ser Val Val Glu Thr Ser Thr Gly Gln Ala

180 185 190

Leu Lys Ala Thr Ala Asp Met Leu Glu Asn Ala Thr Leu Ala Glu Arg

195 200 205

Val Ser Leu Glu Leu Arg Ser Val Pro Leu Pro His Phe Pro Glu Gln

210 215 220

Thr Phe Arg Leu Ser His Leu Gln His Ile Thr Ile Asp Ala Ala Gly

225 230 235 240

Leu Met Lys Leu Pro Ala Asp Met Gln Lys Phe Ala Ala Leu Glu Thr

245 250 255

Leu Thr Leu Ala Arg Asn Pro Leu Arg Ser Leu Pro Ala Ser Ile Ser

260 265 270

Ser Leu Arg Arg Leu Arg Glu Leu Ser Ile Leu Ala Cys Pro Thr Leu

275 280 285

Lys Glu Leu Pro Glu Ser Leu Ala Gly Thr Asn Ala Ser Gly Glu His

290 295 300

Glu Gly Leu Val Asn Leu Gln Arg Leu Gln Leu Glu Glu Thr Gly Ile

305 310 315 320

Thr Ser Leu Pro Ala Ser Ile Ala Thr Leu Gln Asn Leu Lys Arg Leu

325 330 335

Gln Val Arg His Ser Pro Leu Leu Ala Val Ala Pro Ala Ile His Gln

340 345 350

Met Pro Lys Leu Glu Glu Leu Asp Phe Gln Gly Cys Thr Ala Leu Arg

355 360 365

Asn Tyr Pro Pro Ile Phe Gly Gly Ser Ala Pro Leu Lys Arg Leu Asn

370 375 380

Leu Lys Asp Cys Ser Asn Leu Arg Thr Leu Pro Leu Asp Ile His Asn

385 390 395 400

Leu Thr Gln Leu Glu Glu Leu Asp Leu Arg Gly Cys Asn Asn Leu Ser

405 410 415

Arg Leu Pro Ser Ser Ile Gly Arg Leu Pro Ala Asn Cys Val Ile Leu

420 425 430

Val Pro Pro His Leu Gln Val Gln Leu Asp Arg Arg Arg Leu Ser Ala

435 440 445

Arg Pro Ala Glu Pro Gln Arg Thr Asp Pro Ser Ile Pro Gly Pro Ser

450 455 460

Gly His Gly Ser Ser Ala Ser Ser Val Thr Thr Thr Glu Leu Leu His

465 470 475 480

Lys Ala Ala Leu Glu Arg Ile Glu Asp Ala Ala His Ala Met Leu Ser

485 490 495

Ala Val Ile Asp Gln Glu Arg Asn Pro Phe Leu Glu Gly Ala Pro Pro

500 505 510

Tyr Leu Pro Glu Lys Arg Pro Pro Gly Ala Thr Thr Phe Gly Gln Ile

515 520 525

Pro Val Leu Lys Lys Met Leu Arg Glu Ser Arg Asp Arg His Phe Leu

530 535 540

Lys Arg Val Ser Glu Met Ala Gly Pro Cys Pro Arg Val Glu Asp Gln

545 550 555 560

Thr Glu Glu Gly Leu Ser Arg His Tyr Met Asn Val Ser Asn Trp Lys

565 570 575

Ala Gln Lys Ser Ala His Leu Gly Ile Val Asp His Leu Gly Gln Phe

580 585 590

Val Tyr Arg Glu Gly Ser Gln Leu Asp Ala Ala Thr Leu Ala Lys Ala

595 600 605

Val Gln Met Trp Lys Thr Arg Glu Leu Ile Val Asp Ala His Pro Glu

610 615 620

Asp Arg Ala Arg Phe Pro Ser Phe Thr Ile His Ile Pro Asp Gln Ala

625 630 635 640

Ser Asp Asp Ser Asp Ser Glu Gln Gln Thr Thr Ser Glu Pro Ser Arg

645 650 655

<210> 2

<211> 144

<212> PRT

<213> Nicotiana benthamiana

<400> 2

Met Ala Ser Ile Ser Gly Thr Met Val Ser Thr Ser Phe Leu Pro Arg

1 5 10 15

Lys Pro Ala Val Thr Ser Leu Lys Ala Ile Pro Asn Val Gly Gln Ala

20 25 30

Leu Phe Gly Leu Lys Ser Gln Arg Gly Gly Arg Ile Thr Cys Met Ala

35 40 45

Ser Tyr Lys Val Lys Leu Ile Thr Pro Glu Gly Ala Val Glu Phe Asp

50 55 60

Cys Pro Asp Asp Val Tyr Ile Leu Asp Gln Ala Glu Glu Met Gly His

65 70 75 80

Asp Leu Pro Tyr Ser Cys Arg Ala Gly Ser Cys Ser Ser Cys Ala Gly

85 90 95

Lys Val Thr Ala Gly Asn Val Asp Gln Ser Asp Gly Asn Phe Leu Asp

100 105 110

Asp Asp Gln Met Ala Asp Gly Phe Val Leu Thr Cys Val Ala Tyr Pro

115 120 125

Gln Ser Asp Val Thr Ile Glu Thr His Lys Glu Glu Glu Leu Thr Ala

130 135 140

<210> 3

<211> 435

<212> DNA

<213> Nicotiana benthamiana

<400> 3

atggccagta tttcaggtac catggttagc acctctttcc tcccaaggaa accagcagtg 60

actagcctga aagccatacc aaatgttggg caagctctct ttggccttaa atctcagagg 120

ggtggtagga ttacttgcat ggccagttac aaagtgaagc ttattacacc agaaggagct 180

gttgagtttg attgtcccga tgatgtttac attcttgatc aagctgagga aatgggacat 240

gatcttcctt actcatgcag agctggttct tgctcttctt gtgctggaaa agttacagct 300

ggaaatgttg atcagtctga tggaaacttt cttgatgatg accaaatggc tgatggattt 360

gttctaactt gtgttgctta cccacagtct gatgttacta ttgagacaca caaggaggag 420

gagctcactg cctaa 435

<210> 4

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tctagaatgc gacgcgtcga tcaa 24

<210> 5

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

tctagactag cgcgagggtt ccga 24

<210> 6

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

catatggcca gtatttcagg tac 23

<210> 7

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gaattcttag ccagtgagct cctcctcctt a 31

<210> 8

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

ggaattcttc ggcttggcgc gcactca 27

<210> 9

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

catatgccac aacggactga cccgtccatc c 31

<210> 10

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

catatggtga agcttattac accag 25

<210> 11

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

catatggcaa ccatgcctgc tcctgta 27

<210> 12

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

gaattcctag tgcacctcct cttccttgtg 30

<210> 13

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gatatggcaa ctgcaactgc tccgaga 27

<210> 14

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

gaattcctag tagagttctt cctccttgtg 30

<210> 15

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

catatggcgg cgacggcact g 21

<210> 16

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

gaattcttag atgaggtcgt cctcc 25

<210> 17

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

tctagaatgg ccagtatttc aggtac 26

<210> 18

<211> 28

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

gggcccgcca gtgagctcct cctcctta 28

<210> 19

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

gttcctgctg tttgttctgt tg 22

<210> 20

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

atctcacgca ttaccctacc tt 22

Claims

1. a kind of rice Xanthomonas campestris effect protein XopL, which is characterized in that the rice Xanthomonas campestris effect protein XopL amino acid Sequence is as shown in SEQ ID NO.1, through mediated by agriculture bacillus, in Ben's tobacco (Nicotiana benthamiana) blade After transient expression, the rice Xanthomonas campestris effect protein XopL can excite tobacco to generate allergic reaction.

2. a kind of rice Xanthomonas campestris effect protein XopL according to claim 1, which is characterized in that the rice Xanthomonas campestris Effect protein XopL has ubiquitin ligase activity.

3. a kind of tobacco ferredoxin that can improve Rice Resistance characteristic of disease, which is characterized in that its amino acid sequence such as SEQ ID Shown in NO.2.

4. a kind of tobacco ferredoxin that can improve Rice Resistance characteristic of disease according to claim 3, which is characterized in that described The tobacco ferredoxin and rice Xanthomonas campestris effect protein XopL interaction of Rice Resistance characteristic of disease, the rice Xanthomonas campestris effect can be improved Answer albumin X opL amino acid sequence as shown in SEQ ID NO.1.

5. a kind of tobacco ferredoxin that can improve Rice Resistance characteristic of disease according to claim 3, which is characterized in that described The tobacco ferredoxin of Rice Resistance characteristic of disease can be improved from Ben's tobacco (Nicotiana benthamiana).

6. a kind of tobacco ferredoxin encoding gene that can improve Rice Resistance characteristic of disease, which is characterized in that described to improve rice The tobacco ferredoxin encoding gene nucleotide sequence of disease resistance is as shown in SEQ ID NO.3.

7. the application that one kind can improve the tobacco ferredoxin of Rice Resistance characteristic of disease as claimed in claim 3, which is characterized in that institute The tobacco ferredoxin that can improve Rice Resistance characteristic of disease is stated, is mediated by rice Xanthomonas campestris effect protein XopL and ubiquitination and drop occurs Solution causes tobacco to generate the disease resistance response of allergic reaction class.

8. one kind can improve the application of the tobacco ferredoxin encoding gene of Rice Resistance characteristic of disease as claimed in claim 6, special Sign is that, by transgenic method, the tobacco ferredoxin encoding gene that will improve Rice Resistance characteristic of disease is transferred in rice, obtains Obtain the increased rice of bacterial blight-resisting ability.

9. the application of the tobacco ferredoxin encoding gene of Rice Resistance characteristic of disease, feature can be improved according to claim 8 It is, for the transgenic method by mediated by agriculture bacillus, transgene carrier used is pCAMBIA1300, and eukaryon selection markers are tide Mycin.

10. the application of the tobacco ferredoxin encoding gene of Rice Resistance characteristic of disease, feature can be improved according to claim 8 It is, the rice is japonica rice variety OryzasativaLcv.Nipponbare (Nipponbare).