CN103898133B - A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof - Google Patents
A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof Download PDFInfo
- Publication number
- CN103898133B CN103898133B CN201410147753.5A CN201410147753A CN103898133B CN 103898133 B CN103898133 B CN 103898133B CN 201410147753 A CN201410147753 A CN 201410147753A CN 103898133 B CN103898133 B CN 103898133B
- Authority
- CN
- China
- Prior art keywords
- beta
- mannase
- gene
- man
- optimized
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to genetically engineered field, particularly, the present invention relates to beta-mannase gene MAN and the yeast expression vector thereof of optimization.The application to nucleotide sequence as SEQ? ID? beta-mannase gene shown in NO.1 is transformed, is the nucleotide sequence of the gene that is optimized as SEQ? ID? shown in NO.3.Construct the restructured Pichia pastoris in expression carrier of optimizing beta-mannase gene and to be transformed in pichia spp competent cell X33 that screening obtains high expression 'beta '-mannase turn 'beta '-mannase Pichi strain; Zymologic property measures and shows, the beta-mannase gene optimized can stablize in pichia spp, express efficiently and heredity, the enzymic activity of the 'beta '-mannase expressed by expressed 'beta '-mannase enzymic activity and stability are significantly higher than in original beta-mannase gene pichia spp and stability.
Description
Technical field
The present invention relates to genetically engineered field, relate to a kind of beta-mannase gene MAN and yeast expression vector thereof of optimization particularly.
Background technology
In beans, cereal and byproduct thereof, ubiquity a kind of antinutritional factor---and beta-mannase, it has extremely strong water-absorbent, in monogastric animal digestive tube, easily form gel, affects the contact of nutritive substance and Digestive system, reduces efficiency of feed utilization.And 'beta '-mannase be a class can the lytic enzyme of selective degradation beta-mannase, belong to hemicellulose enzyme.The substrate of hydrolysis has polygalactomannan, glucomannan, gala glucomannan and mannosans, the oligosaccharides that product has a small amount of monose and 2-10 monosaccharide molecule to form.Can effectively reduce alimentary canal content viscosity; And it decomposes the manna oligosaccharide that beta-mannase produces, as the multiplicaiton factor of bifidus bacillus, the propagation promoting profitable strain in enteron aisle, the production performance of animal can be improved.'beta '-mannase can improve feed digestion utilization ratio on the one hand, expands feedstuff raw material source, alleviates the feeding situation that there is lack of raw materials; Stool output and the Substitute For Partial microbiotic of cultivation can be reduced on the other hand, thus reduce the pollution of environment and avoid drug residue.
'beta '-mannase is a kind of wide spectrum induction type multifunctional enzyme, now be mainly used in both at home and abroad the bleaching of paper industry paper pulp, the broken glue of oil well, degrading plant glue produces oligose and be used as bifidus bacillus somatomedin, as antinutritional factor in the protective foods that anti-disease, anti-aging is old and fodder industry.
Summary of the invention
An object of the present invention is to provide a kind of beta-mannase gene of optimization, and the sequence GC content after optimization reduces to 0.54 by original 0.56; CAI value has original 0.68 to bring up to 0.81.
Another object of the present invention is to provide the restructured Pichia pastoris in expression carrier of the beta-mannase gene of optimization.
Another object of the present invention is to provide the recombinant bacterial strain of the beta-mannase gene of optimization.
The present invention is optimized the beta-mannase gene of nucleotide sequence as shown in SEQIDNO.1.
SEQIDNO.1：
1CTGCCGAAAGCATCCCCTGCACCGAGCACCAGCAGCAGTGCTGCCTCCACCTCCTTCGCT
61AGCACCTCCGGCCTCCAATTCACCATTGATGGCGAAACTGGCTACTTCGCCGGAACGAAC
121AGCTACTGGATCGGTTTCCTCACTGACAACGCGGACGTCGACCTCGTCATGGGCCACCTG
181AAGTCGTCCGGCCTCAAGATCCTCCGCGTGTGGGGCTTCAACGATGTCACCTCGCAGCCC
241TCCTCCGGCACAGTTTGGTACCAACTGCACCAGGACGGCAAATCGACAATCAACACGGGT
301GCCGACGGTCTCCAGCGCCTCGACTACGTCGTCTCGTCTGCCGAACAGCACGACATCAAA
361CTCATCATCAACTTCGTCAACTACTGGACCGATTACGGTGGTATGTCTGCGTACGTGAGC
421GCGTATGGCGGATCCGGCGAGACGGATTTCTATACCAGTGATACCATGCAGAGTGCCTAT
481CAGACATATATCAAGACGGTCGTGGAGCGGTACAGTAACTCCTCGGCGGTGTTTGCGTGG
541GAGTTGGCGAATGAGCCGAGATGTCCGAGTTGCGATACTTCTGTGTTGTATAACTGGATT
601GAGAAGACGAGTAAGTTTATTAAGGGGTTGGATGCGGATCGTATGGTTTGTATTGGTGAT
661GAGGGCTTCGGTCTCAACATCGACTCGGACGGCAGCTACCCTTATCAATTCTCCGAGGGC
721TTGAACTTTACGATGAACCTCGGTATCGATACTATTGACTTTGGTACCCTCCACTTGTAC
781CCTGATAGCTGGGGCACCTCCGACGACTGGGGCAACGGCTGGATCACCGCCCACGGCGCA
841GCCTGCAAAGCGGCCGGCAAGCCATGTCTCCTGGAGGAATACGGAGTCACCTCGAACCAC
901TGCAGTGTGGAGGGCTCGTGGCAGAAGACAGCGCTCAGCACAACGGGCGTCGGCGCGGAT
961CTGTTCTGGCAGTATGGTGATGATTTGAGTACCGGGAAGTCGCCGGATGATGGGAATACT
1021ATCTACTATGGGACTAGTGATTATCAGTGTCTGGTGACGGATCATGTTGCTGCTATTGAT
1081AGCGCCTAA
The aminoacid sequence of the 'beta '-mannase before transformation is as shown in SEQIDNO.2:
LPKASPAPSTSSSAASTSFASTSGLQFTIDGETGYFAGTNSYWIGFLTDNADVDLVMGHLKSSGLKILRVWGFNDVTSQPSSGTVWYQLHQDGKSTINTGADGLQRLDYVVSSAEQHDIKLIINFVNYWTDYGGMSAYVSAYGGSGETDFYTSDTMQSAYQTYIKTVVERYSNSSAVFAWELANEPRCPSCDTSVLYNWIEKTSKFIKGLDADRMVCIGDEGFGLNIDSDGSYPYQFSEGLNFTMNLGIDTIDFGTLHLYPDSWGTSDDWGNGWITAHGAACKAAGKPCLLEEYGVTSNHCSVEGSWQKTALSTTGVGADLFWQYGDDLSTGKSPDDGNTIYYGTSDYQCLVTDHVAAIDSA
The present invention is optimized the original beta-mannase gene shown in SEQIDNO.1, and obtains the beta-mannase gene engineering strain of high expression by the method screening of high flux screening.The nucleotide sequence of the beta-mannase gene after optimization is as shown in SEQIDNO.3
1
TTGCCAAAAGCATCCCCT
GCTCCATCCACC
TCCTCCTCTGCCGCC
TCTACC
TCTTTCGCT
61
TCCACTTCC
GGTCTTCAGTTCACC
ATCGACGGAGAGACCGGATACTTCGCC
GGTACCAAC
121
TCCTACTGGATC
GGATTC
TTGACCGAC
AATGCTGACGTCGAC
CTTGTCATG
GGACAC
TTG
181AAG
TCCTCC
GGACTTAAAATC
TTGCGTGTCTGG
GGTTTCAAC
GACGTCACC
TCCCAG
CCA
241
TCTTCTGGTACTGTTTGGTAC
CAGTTGCACCAGGAC
GGTAAGTCTACCATCAAC
ACTGGT
301GCC
GATGGACTTCAG
CGTTTGGAC
TATGTTGTC
TCCTCCGCTGAGCAACACGACATC
AAG
361
CTTATCATCAAC
TTTGTCAAC
TATTGG
ACTGACTACGGT
GGAATG
TCCGCCTAC
GTCTCT
421
GCCTACGGTGGTTCC
GGTGAG
ACTGACTTC
TACACTTCCGACACCATGCAG
TCCGCCTAT
481
CAAACCTACATTAAAACTGTTGTCGAG
AGATAC
TCCAACTCC
TCCGCCGTCTTCGCCTGG
541GAGTTG
GCCAACGAG
CCTAGATGT
CCTTCCTGC
GACACCTCCGTTCTTTACAACTGG
ATC
601
GAAAAG
ACCTCCAAGTTT
ATCAAG
GGACTTGACGCTGACCGTATG
GTCTGT
ATCGGT
GAC
661GAG
GGATTC
GGATTGAACATCGAC
TCCGAC
GGATCCTACCCT
TACCAGTTCTCC
GAAGGA
721TTGAACTTT
ACTATGAAC
TTGGGT
ATTGACACCATCGAC
TTCGGAACC
TTGCACTTGTAC
781
CCAGACTCCTGG
GGAACTTCCGACGACTGG
GGTAAC
GGTTGG
ATTACTGCTCAC
GGTGCC
841GCC
TGTAAGGCTGCC
GGTAAG
CCTTGCTTGTTGGAG
GAGTAC
GGTGTCACC
TCCAACCAC
901
TGTTCCGTCGAG
GGATCCTGGCAGAAG
ACTGCCTTGTCTACCACCGGTGTC
GGAGCTGAC
961
TTGTTCTGGCAG
TACGGT
GACGACCTTTCCACC
GGAAAG
TCCCCAGACGAT
GGAAACACC
1021ATCTAC
TACGGTACCTCCGACTACCAGTGT
TTGGTCACCGACCACGTT
GCCGCT
ATCGAC
1081
TCCGCCTAA
Beta-mannase enzyme amino acid sequence after optimization is identical with SEQIDNO.2.
Present invention also offers the recombinant vectors of the beta-mannase gene comprising above-mentioned optimization, the beta-mannase gene MAN of optimization of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, preferably beta-mannase gene MAN of the present invention is inserted between EcoRI and the NotI restriction enzyme site on plasmid pPICZ α A, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain expression of recombinant yeast plasmid pPICZ α A-MAN.
Present invention also offers the recombinant bacterial strain comprising above-mentioned beta-mannase gene MAN, preferred recombinant bacterial strain is pichia spp X33.
Present invention also offers the method expressing above-mentioned 'beta '-mannase MAN, comprise the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained;
2) recombinant bacterial strain ferments, the expression of induction restructuring 'beta '-mannase;
3) after fermentation ends, the 'beta '-mannase MAN expressed by recovery.
Particularly, expression of recombinant yeast plasmid pPICZ α A-MAN is transformed in pichia spp host strain X33, with the microbiotic plate screening positive transformant of high density, by the transformant screened, ferment in the fermentor tank of 50L, in fermenting process, go fermented liquid to measure OD every 24h
600and thalline weight in wet base, get supernatant liquor and carry out beta-mannase Enzyme assay.The final average fermentation enzymic activity of fermentation ends reaches 34000U/ml, improves the expression level of 'beta '-mannase; 'beta '-mannase optimum temperature after optimization is 60 DEG C, and heat resistance is better; The suitableeest action pH scope is 3.5-4.0, is more suitable for being used as fodder additives, more effectively plays a role under the sour environment of animal gastrointestinal tract.
The present invention utilizes the gene of genetic engineering means to aspergillus niger 'beta '-mannase MAN to be optimized, the expression level of 50L fermentor tank induction 'beta '-mannase is greatly improved, and pass through high flux screening, obtain the bacterial strain of high expression, meet the requirement that suitability for industrialized production reduces costs further, therefore, the 'beta '-mannase of optimization of the present invention can demonstrate huge application potential in fodder industry.
Accompanying drawing explanation
Fig. 1 is the 'beta '-mannase recombinant bacterial strain PCR detected result optimized; Wherein, M is DNA molecular standard; ASm is the beta-mannase gene PCR optimized; All the other are negative control.
Fig. 2 .1 is that the puc57-MAN recombinant plasmid optimized and pPICZ α A carry with EcoR1 and Not1 double digestion agarose gel electrophoresis figure; Wherein M is DNA molecular standard, and ASm is the puc57-MAN recombinant plasmid utilizing EcoR1 and Not1 double digestion, and pPIC is the pPICZ α A carrier utilizing EcoR1 and Not1 double digestion
Fig. 2 .2 is that the pPICZ α A-MAN recombinant plasmid enzyme optimized cuts agarose gel electrophoresis figure; Wherein, M is DNA molecular standard, and Asm is the pPICZ α A-MAN recombinant plasmid for utilizing EcoR1 and Not1 double digestion, and other is positive control.
Fig. 3 is the fermentation situation of original pPICZ α A-MAN yeast strain in 50L fermentor tank.
Fig. 4 is the fermentation situation of pPICZ α A-MAN yeast strain in 50L fermentor tank optimized.
Fig. 5 .1 ~ Fig. 5 .4 is the property analysis that original strain produces 'beta '-mannase.Wherein Fig. 5 .1 is optimum temperature curve; Fig. 5 .2 is temperature tolerance curve; Fig. 5 .3 is the suitableeest action pH curve; Fig. 5 .4 resistance to acids and bases curve.
Fig. 6 .1 ~ Fig. 6 .4 is the property analysis of the 'beta '-mannase that Pichia anomala expression is optimized.Wherein Fig. 6 .1 is optimum temperature curve; Fig. 6 .2 is temperature tolerance curve; Fig. 6 .3 is the suitableeest action pH curve; Fig. 6 .4 resistance to acids and bases curve;
Fig. 7 is the fermented supernatant fluid protein electrophoresis figure induction of 41h, 65h, 89h, 113h, 137h, 161h and 185h.
Embodiment
Do not make the molecular biology test method illustrated in following examples, all carry out with reference to concrete grammar listed in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book, or carry out according to test kit and product description; Described test kit biomaterial, if no special instructions, all can obtain from commercial channels.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.
Experiment material and reagent
1, bacterial strain and carrier
Coli strain Top10, pichia spp X33, carrier pPICZ α A, Zeocin are purchased from Invitrogen company.The Gene A sman of synthesis is stored on pUC57.
2, enzyme and test kit
PCR enzyme, plasmid extraction kit, gel purification kit are purchased from Shanghai Sheng Gong company, and restriction enzyme is purchased from NEB company.
3, substratum
Escherichia coli culture medium is LB(1% peptone, 0.5% yeast extract, 1%NaCL, pH7.0).LB-Amp is that LB substratum adds 100 μ g/ml penbritins.LB-Zeocin is that LB substratum adds 25 μ g/mlZeocin.Yeast culture medium is YPD(1% yeast extract, 2% peptone, 2% glucose).Yeast screening assay substratum is YPDzeo (YPD+100 μ g/mlZeocin).
Yeast inducing culture BMGY(1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (v/v)) and BMMY(replace glycerine divided by 0.5% methyl alcohol, all the other compositions are identical with BMGY).
The basic salt culture medium of recombination yeast fermentation culture: Secondary ammonium phosphate 5%, potassium primary phosphate 0.5%, magnesium sulfate heptahydrate 1.5%, potassium sulfate 1.95%, calcium sulfate 0.1%, defoamer 0.03%.After high pressure, often liter adds 4.35mlPTM1.PTM1(Trace salts solution): copper sulfate 0.6%, potassiumiodide 0.018%.Manganese sulfate monohydrate 0.3%, Sodium Molybdate Dihydrate 0.02%, boric acid 0.002%, flowing water cobalt chloride 0.05%, zinc chloride 2%, green vitriol 6.5%, the vitriol oil 0.5%, vitamin H 0.02%
Chemical reagent: mannosans and locust bean gum are purchased from Sigma company.
Embodiment 1 beta-mannase gene optimization and expression vector establishment
1) beta-mannase gene optimization and synthesis
Original beta-mannase gene VMAN derives from screening from the natural soil near konjaku root, is separated the strain aspergillus niger obtained.Its nucleotides sequence is classified as shown in SEQIDNO.1, and coded aminoacid sequence is for shown in SEQIDNO.2.VMAN carried out codon optimized (not changing coded aminoacid sequence), improve stability rear clone on pUC57 plasmid, the 'beta '-mannase recombinant plasmid pUC57-MAN after being optimized, its nucleotides sequence is classified as shown in SEQIDNO.3.
2) enzyme is cut and is connected
EcoRI and NotI enzyme is utilized to cut pUC57-MAN recombinant plasmid and yeast expression vector pPICZ α A, utilize both T4 ligase enzyme connections of NEB company, build pPICZ α A-MAN, connect product conversion intestinal bacteria and experience polypeptide cell Top10, cultivate screening positive clone at LBZ agarose plate.Extract the plasmid of positive colony.Sample presentation is to Hua Da gene sequencing, and sequencing result shows, this beta-mannase gene MAN total length 1089bp, 362 amino acid of encoding, the recombinant expression vector called after pPICZ α A-MAN obtained.
The high expression of the 'beta '-mannase recombinant bacterial strain that embodiment 2 is optimized
Above-mentioned recombinant expression vector pPICz α A-MAN SacI is carried out linearizing, by electroporated for the recombinant vectors after linearizing pichia spp competent cell X33, obtains pichia spp recombinant bacterial strain X33/MAN.
The mono-bacterium colony of above-mentioned recombinant bacterium X33/MAN is carried out high density fermentation cultivation.The basic salt culture medium of configuration 20L, automatically controls in fermentor tank after sterilizing at 50L, is cooled to normal temperature for subsequent use.Regulate the pH value to 5.0 of fermented liquid with ammoniacal liquor and phosphoric acid, be greater than 30% by adjusting rotary speed and air flow control dissolved oxygen, leavening temperature is 30 DEG C.Whole fermenting process divides 3 stages: the first stage is the yeast culture stage, by recombinant bacterium X33/MAN-pPIC according to 10% inoculum size be seeded in fermentor tank, stream adds the glucose of sterilized 4L50%, cultivate 24-30h, with supplemented glucose for indicate; Subordinate phase is the hungry stage, and after glucose is not complete, stream does not add any carbon source, namely shows that this stage terminates, about need 30-60min when dissolved oxygen rises to more than 80%; Phase III is the abduction delivering stage, and in this stage, stream adds inducing culture, and keeps dissolved oxygen more than 20%, and incubation time is between 180-200h.Fermented liquid is by obtaining enzyme liquid after ceramic membrane or ultrafiltration membrane treatment.Different time points sampling and measuring enzyme is during the fermentation lived, and as shown in Figure 4, the enzymic activity of the fermented liquid of inducing culture 185h is 34000U/ml to the expression of the 'beta '-mannase optimized in fermenting process.Under same fermentation condition, the original 'beta '-mannase Pichi strain of the present inventor's Laboratories Accession is carried out high density fermentation cultivation, in fermenting process, the expression of original 'beta '-mannase as shown in Figure 3, and after inducing culture 185h, the enzymic activity of its fermented liquid is 21300U/ml.Illustrate that the 'beta '-mannase Pichi strain of restructuring optimization can improve the expression level of 'beta '-mannase significantly.
The activation analysis of the 'beta '-mannase that embodiment 3 restructuring is optimized
DNS method is adopted to measure the reducing sugar of hydrolysis generation.The definition of each Mei Huo unit (U): 55 DEG C, under the condition of pH5.0, the per minute beta-mannase decomposed in locust bean gum produces the enzyme amount having reducing power and be equivalent to needed for 1 μm of ol seminose.Three repetitions are established in experiment, and each sample determination all establishes three parallel tests, and relative error controls within 8%.
Embodiment 4 original strain produces the property testing of 'beta '-mannase
Under the condition of pH5.0, respectively at 35 DEG C, 45 DEG C, 55 DEG C, 65 DEG C, 75 DEG C, the enzyme activity of restructuring 'beta '-mannase is measured by DNS method, result shows, the enzyme activity measured 55 DEG C time is the highest, live as 100% with the relative enzyme recorded under pH5.0,55 DEG C of conditions, make original strain and produce 'beta '-mannase optimum temperature curve.
By beta-mannase enzyme solution at 60 DEG C of standing 5min, 10min, 20min, 30min, 40min, 50min, 60min, then 55 DEG C, measure the remaining vigor of enzyme under the condition of pH5.0 by DNS method, Simultaneously test is without the 'beta '-mannase enzyme activity at heat place, as a control group, the relative activity of control group is 100%, makes original strain and produces 'beta '-mannase heat resistance curve.
Under 55 DEG C of conditions, respectively when pH is 3.0,4.0,5.0,6.0,7.0 and 8.0, the enzyme activity of restructuring 'beta '-mannase is measured by DNS method, result shows, when pH is 5.0, the catalysis activity of enzyme is the highest, with 55 DEG C, pH5.0 time enzyme catalysis activity for 100%, make original strain and produce 'beta '-mannase the suitableeest action pH curve.
In order to study the stability of restructuring 'beta '-mannase under different pH condition, be in the damping fluid of 3.0,4.0,5.0,6.0,7.0 and 8.0 respectively in pH value by beta-mannase enzyme solution, be placed in 4 DEG C of standing 4h, then 55 DEG C, under pH5.0 condition, the residual vigor of 'beta '-mannase is measured by DNS method, the enzyme activity recorded when being 5.0 with pH is 100%, makes original strain and produces 'beta '-mannase acid-proof alkaline curve.
The property testing of the 'beta '-mannase that embodiment 5 restructuring is optimized
Under the condition of pH5.0, respectively at 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 70 DEG C, the enzyme activity of restructuring 'beta '-mannase is measured by DNS method, result shows, the enzyme activity measured 60 DEG C time is the highest, live as 100% with the relative enzyme under pH5.0,60 DEG C of conditions, make the 'beta '-mannase optimum temperature curve that restructuring is optimized.
Beta-mannase enzyme solution restructuring optimized is at 60 DEG C of standing 5min, 10min, 15min, 20min, 30min, 40min, 50min, 60min, then 55 DEG C, measure the remaining vigor of enzyme under the condition of pH5.0 by DNS method, Simultaneously test is without the 'beta '-mannase enzyme activity at heat place, as a control group, the relative activity of control group is 100%, makes the 'beta '-mannase heat resistance curve that restructuring is optimized.
Under 55 DEG C of conditions, respectively when pH is 3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0, the enzyme activity of restructuring 'beta '-mannase is measured by DNS method, result shows, when pH is 3.5-4.0, the catalysis activity of enzyme is the highest, with 55 DEG C, pH3.0 time enzyme catalysis activity for 100%, make restructuring optimize the suitableeest action pH curve of 'beta '-mannase.
In order to study the stability of restructuring 'beta '-mannase under different pH condition, be in the damping fluid of 3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0 respectively in pH value by enzyme liquid, be placed in 4 DEG C of standing 4h, then 55 DEG C, under pH5.0 condition, the residual vigor of 'beta '-mannase is measured by DNS method, with undressed control group enzyme activity for 100%, make the 'beta '-mannase acid-proof alkaline curve that restructuring is optimized.
The suitableeest action pH scope of 'beta '-mannase that restructuring is optimized is 3.5-4.0, and optimum temperature is 60 DEG C.It is 5.0 that original strain produces the suitableeest action pH of 'beta '-mannase, and optimum temperature is 55 DEG C; Temperature tolerance experimental result shows, 60min is processed under uniform temp, the 'beta '-mannase enzyme retention rate more than 70% alive that restructuring is optimized, original strain produces the enzyme retention rate about 50% alive of 'beta '-mannase, and the 'beta '-mannase heat resistance that showing recombinates optimizes is better.Acid-proof alkaline test-results shows within the scope of pH3.0-7.0, the 'beta '-mannase enzyme that restructuring is optimized lives retention rate more than 70%, the 'beta '-mannase enzyme that original strain produces lives retention rate all below 70%, and the 'beta '-mannase acid-proof alkaline that showing recombinates optimizes is better.
The 'beta '-mannase SDS-PAGE that embodiment 6 restructuring is optimized
Get the fermented supernatant fluid of abduction delivering 41h, 65h, 89h, 113h, 137h, 161h, 185h, after distilled water diluting 30 times, add 5 × loadingbuffer and boil 5min, preparation SDS-PAGE sample; Prepare 12% separation gel and 5% concentrated glue, deposition condition: 100V, 3h, with coomassie brilliant blue staining liquid dyeing 4h, destainer decolours, and spends the night, then takes pictures with gel imaging instrument.
Claims (5)
1. the beta-mannase gene optimized, it is characterized in that, its nucleotide sequence is as shown in SEQIDNO.3.
2. comprise the recombinant vectors of the beta-mannase gene of optimization according to claim 1.
3. recombinant vectors according to claim 2, is characterized in that, described recombinant vectors is pPICZ α A-MAN, wherein, the beta-mannase gene of optimization according to claim 1 is inserted into the EcoR on plasmid pPICZ α A
and Not
between restriction enzyme site, make this gene order be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain recombinant vectors pPICZ α A-MAN.
4. comprise the recombinant bacterial strain of the beta-mannase gene of optimization according to claim 1.
5. recombinant bacterial strain according to claim 4, is characterized in that, described bacterial strain is restructuring Pichia yeast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410147753.5A CN103898133B (en) | 2014-04-14 | 2014-04-14 | A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410147753.5A CN103898133B (en) | 2014-04-14 | 2014-04-14 | A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898133A CN103898133A (en) | 2014-07-02 |
| CN103898133B true CN103898133B (en) | 2015-12-02 |
Family
ID=50989701
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410147753.5A Active CN103898133B (en) | 2014-04-14 | 2014-04-14 | A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898133B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107760700B (en) * | 2017-09-30 | 2020-11-06 | 武汉轻工大学 | Beta-mannase gene, recombinant expression vector, strain, beta-mannase and preparation method and application thereof |
| CN108396017A (en) * | 2017-10-20 | 2018-08-14 | 山东奥博生物科技有限公司 | A kind of industrial fermentation process of mannase |
| CN108060093B (en) * | 2017-12-14 | 2020-05-08 | 青岛蔚蓝生物集团有限公司 | Mannase high-yield strain and application thereof |
| CN110358780A (en) * | 2018-04-10 | 2019-10-22 | 东莞泛亚太生物科技有限公司 | A kind of gene encoding 'beta '-mannase, and the recombinant plasmid containing the gene and recombinant bacterium and its construction method |
| CN110093331B (en) * | 2019-05-06 | 2022-04-01 | 武汉轻工大学 | High-temperature-resistant wide-pH-stability mannase Man gold, gene and application |
| CN111424048B (en) * | 2020-06-09 | 2020-10-02 | 北京挑战农业科技有限公司 | Gene for expressing acidic beta-mannase, vector and application thereof |
| WO2022120543A1 (en) * | 2020-12-07 | 2022-06-16 | 江苏奕农生物股份有限公司 | ACIDIC HIGH-TEMPERATURE RESISTANT β-MANNANASE, AND GENE AND USE THEREOF |
| CN113151026A (en) * | 2021-03-12 | 2021-07-23 | 上海国龙生物科技有限公司 | Preparation method and application of pichia pastoris for expressing beta-mannase and alpha-galactosidase |
| CN113073107B (en) * | 2021-03-22 | 2022-10-14 | 武汉轻工大学 | Mannase gene AbMan5, recombinant expression plasmid, recombinant expression strain, mannase and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101089185A (en) * | 2006-06-16 | 2007-12-19 | 罗科 | Beta-mannosan enzyme gene and production method of its recombination enzyme |
| CN101392241A (en) * | 2007-09-18 | 2009-03-25 | 中国科学院微生物研究所 | Beta-mannanase, gene, preparation method, vector and host cell |
-
2014
- 2014-04-14 CN CN201410147753.5A patent/CN103898133B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101089185A (en) * | 2006-06-16 | 2007-12-19 | 罗科 | Beta-mannosan enzyme gene and production method of its recombination enzyme |
| CN101392241A (en) * | 2007-09-18 | 2009-03-25 | 中国科学院微生物研究所 | Beta-mannanase, gene, preparation method, vector and host cell |
Non-Patent Citations (1)
| Title |
|---|
| GenBank Accession NO.: JN123356.1;NCBI;《NCBI GenBank》;20111110;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898133A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898133B (en) | A kind of beta-mannase gene MAN of optimization and yeast expression vector thereof | |
| CN103074315B (en) | Lipase LIP, gene and application thereof | |
| CN102002487B (en) | Optimized and improved high temperature resistance phytase PHYTH as well as gene and application thereof | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN104651383A (en) | Recombinant pichia pastoris engineering bacteria and production method thereof | |
| CN106754601A (en) | A kind of application phospholipase C by intracellular protein extracellular expression method | |
| CN106520642B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN102002465B (en) | Acidic belta-mannase VMAN, gene thereof and application | |
| CN102757947A (en) | Xylanase xyn-CDBFV-m with modified thermal stability, gene thereof, and application thereof | |
| CN114686386B (en) | Pichia pastoris for producing methanol mycoprotein and co-producing cellulase and application thereof | |
| CN102676561B (en) | Recombinant bacterium for expressing keratinase and fermentation method thereof | |
| CN102115718A (en) | Recombinant strain for expressing beta-galactosidase and construction method and application thereof | |
| CN107988292A (en) | Improve the zymotechnique of the collagen-stabilized property of recombination human source | |
| CN111019851A (en) | Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof | |
| CN105002147A (en) | Mutated glucose oxidase with increased expression quantity and encoding gene and application thereof | |
| CN102732493B (en) | Heat-resistant beta-mannanase and its coding gene, recombinant bacterium and use | |
| CN103952326A (en) | Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain | |
| CN103160483B (en) | Beta-glucosidase, as well as expression gene and application thereof | |
| CN102181413B (en) | Alpha-galactosidase and encoding gene and application thereof | |
| CN104357425A (en) | Novel alpha-galactosidase NGAL, and gene and application thereof | |
| CN111378635B (en) | Method for co-expressing lysozyme and xylanase and method for preparing feed additive for replacing antibiotics | |
| CN1847400A (en) | Improved xylanase with high specific activity, its gene expression vector and recombinant yeast cell, and expression method | |
| CN105219672A (en) | A kind of extensive method preparing methane-oxidizing bacteria | |
| CN101555485B (en) | Non-fusion expression of recombinant human parathyroid hormone (1-84) and large-scale preparation method | |
| CN104726481A (en) | Super-high-temperature-resistant and alkali-resistant beta-mannase gene, amino acid sequence and application of beta-mannase gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |