CN103898127B

CN103898127B - Derive from the little heat shock protein HSP gene of hearty flame bacterium, expression vector and structure thereof and application

Info

Publication number: CN103898127B
Application number: CN201210585887.6A
Authority: CN
Inventors: 彭日荷; 姚泉洪; 田永生; 赵伟; 付晓燕; 朱波; 许晶; 高建杰; 韩红娟; 王波; 王丽娟; 韩静; 薛永
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: SHANGHAI BAIXIN BIO-TECH CO LTD; Shanghai Academy of Agricultural Sciences
Priority date: 2012-12-28
Filing date: 2012-12-28
Publication date: 2016-03-30
Anticipated expiration: 2032-12-28
Also published as: CN103898127A

Abstract

The present invention relates to a kind of derive from hearty flame bacterium little heat shock protein HSP gene, expression vector and structure thereof and application.Is the base sequence of described gene as SEQ? ID? shown in No1, by building the Escherichia coli-Clostridia shuttle expression carrier comprising this gene, the results showed, this HSP gene can be expressed by stability and high efficiency in clostridium, effectively improves the tolerance of clostridium to butanols.Meanwhile, utilize anaerobically fermenting, also show that this HSP gene can increase substantially the product butanols ability of clostridium.

Description

Derive from the little heat shock protein HSP gene of hearty flame bacterium, expression vector and structure thereof and application

Technical field

The present invention relates to one and derive from the little heat shock protein HSP gene of hearty flame bacterium (Pyrococcusfuriosus), the Escherichia coli-Clostridia shuttle expression carrier comprising this gene and construction process thereof, and they are improving the application in the butanol tolerance of clostridium and clostridium butanols output.

Background technology

The oil crisis of the seventies in last century, impels people to re-recognize the importance of acetone/butanol fermentation industry, and developing renewable energy source becomes the important measures that energy security, GHG (Greenhouse Gases) emissions mitigation, reply climate change improve in many countries thus.Biofuel in the market with alcohol fuel and biofuel the most common.Biological butanol is as a kind of important industrial chemicals, a kind of s-generation novel biological fuel (Durre2007 of great potential, BiotechnolJ), butanols has following numerous advantage than ethanol as biofuel: 1) energy content is high, can walk the distance of 30% compared with ethanol more; 2) volatility of butanols only has 1/6 times of ethanol, 1/13.5 of gasoline, mixes the latitude of water large, have better adaptive faculty to moist and low water vapour pressure with gasoline; 3) butanols can use in existing supply of fuel and distribution system, and ethanol then needs by railway, boats and ships or truck haul(ing); 4) compared with other biological fuel, corrodibility is less, than ethanol, gasoline safety; 5) compared with existing biofuel, the ratio of mixture of biological butanol and gasoline is higher, without the need to transforming vehicle, just can use the butanols of almost 100% concentration, and the economy of propellant combination is higher; 6) butanols can by not consuming grain, not occupying cultivated land, not increasing under premised on environmental stress and carry out fermentative production.If butanols accounts for 20% of biofuel market, world market will more than 20,000,000,000 dollars.

2006, Dupont (Dupont) company and BP (BP) company combined declaration and set up partnership relation, and joint development is produced and released biofuel of new generation to market--biological butanol, and with the demand for fuel that the satisfied whole world is growing.BP company utilized acetone/butanol fermentation clostridium to carry out commercial production from 2008, and target utilized the method improved further to produce butanols.USDA Agricultural Research Institute (USDA-ARS) project verification in 2004 utilizes Bai Shi clostridium to transform cellulose biomass and produces biological butanol, within 2009, completes.Biogreen Co., Ltd. of the U.S. (GBL) cooperates with EKB company of professional company, invests 85.5 ten thousand Euros of innovation butylic fermentation Technologies, and plan Development and Production biofuel butanols is used for communications and transportation, is reduced by its production cost.

Early stage butylic fermentation industry because of its cost high, be defeated by and decline in petrochemicals, this is also the bottleneck place limiting its extensive development now.Cause the high major cause of butylic fermentation cost to be that traditional butylic fermentation output, productive rate are low, and butanols is to the toxic action of thalline.Therefore, substantial contribution and technology are dropped into for the output that improves butylic fermentation and produce and productive rate in current countries in the world, to reduce the cost of butanols large-scale production.

Most of microbe is dealt with toxic substance by 3 kinds of approach and is coerced, and first method is the injury being alleviated toxic substance by the component of change cytolemma; Second method is for pumping toxic substance, once first two lost efficacy, bacterium directly can also be degraded toxic substance in cell.Bacterium, in long-term evolution process, has developed a set of answering system for toxic substance, once contact toxic substance, just can induce the expression of some genes, heat shock protein (HSPs) is exactly modal inducible protein.Heat shock protein as molecular chaperones, the synthesis of albumen, transhipment and folding on all play an important role.Family I heat shock protein, can protected protein under external coercing, and enables normally to fold (Yu Jun 1998, Progress in Biochemistry and Biophysics).

HSP belongs to emergency reaction albumen, and Heat-temperature stress can induce this protein to be formed.HSP is the one of molecular chaperones, in protein post-translational modification process, plays and promotes to need folding polypeptide chain to be folded into the protein of natural space conformation.Find the research of protein folding in intestinal bacteria, the HSP participating in protein folding in intestinal bacteria comprises HSP70, HSP40 and GreE three races.Wherein HSP70 has gene dnaK to encode, the DnaK therefore HSP70 is otherwise known as.It has two functional domains: one is the ATP enzyme structural domain of high conservative being present in N-end, can in conjunction with and hydrolysising ATP; Another is the polypeptide chain binding domain being present in C-end.The interaction of these two structural domains of folding needs of protein.

HSP promotes that the primary process of protein folding is HSP70 reaction cycle, and in intestinal bacteria, first DnaJ is combined with not folding or partially folded polypeptide chain, and lead polypeptide chain DnaK-ATP mixture, and be combined with DnaK.DnaJ activates the ATP enzyme of DnaK, makes its hydrolysising ATP generate ADP, produces stable DnaJ-DnaK-ADP-polypeptide complex.Under the effect of GrpE, ADP in ATP and mixture exchanges, mixture is made to become instability and dissociate rapidly, discharge and be fully folded or complete partially folded protein, wherein not yet complete folding protein and both can enter new round HSP70 reaction cycle, GroEL reaction cycle can be entered again, finally complete folding process (Zhang Yuxiu 1999, Progress in Biochemistry and Biophysics).

Heat stress proteins (HSPs) is prevalent in the whole organic sphere comprising people from bacterium to higher eucaryote, can be induced by multiple stress factors such as amino acid analogue, heavy metal ion, virus infectiones.HSPs give cell or biology from various stress the ability of recovery, and protect them to exempt from the infringement of stress factors.Wherein show the formation being apparent that hot tolerance the most, namely when after cell or the non-fatal temperature of biological, show and the survival rate of fatal temperature is significantly improved.Utilize this point, we can develop the original resistance to not biology be heated makes it more tolerate thermal source.The biology tolerating low temperature not can be made equally more to tolerate low temperature.

Due to the nonpolar nature of butanol molecules, the interact transdermal delivery system that inhibits clostridium and enzyme thereof of the cytolemma of itself and clostridium is lived, and finally cause cytolysis, this toxicity just because of butanols seriously inhibits carrying out smoothly of fermentation.Therefore, cause fermentation total solvent to measure less than raising, butanols output is not enough especially.

Summary of the invention

Technical problem to be solved by this invention be to provide a kind of derive from hearty flame bacterium little heat shock protein HSP gene (PfHSPS), expression vector and structure thereof and application, to make up deficiency of the prior art.

The present invention is under the prerequisite not changing aminoacid sequence, the little heat shock protein HSP gene (GenbankAF256212) from hearty flame bacterium (Pyrococcusfuriosus) is synthesized according to the preference password of clostridium, and design primer, utilize PTDS method (Xiong2004, NucleicAcidsRes) synthetic clone this gene, through sequencing, its base sequence as shown in SEQIDNO1, called after PfHSPS gene.

Then, the present invention constructs again the Escherichia coli-Clostridia shuttle expression carrier pPFHSP comprising above-mentioned PfHSPS gene, thus utilize the expression of the promotor control PfHSPS gene from clostridium CAC2546 gene (NC_003030) in this expression vector, utilize from Bacillus subtilus 168(ATCC) PYK gene (NC_000964) terminator stop transcribing of this PfHSPS.

Described Escherichia coli-Clostridia shuttle expression carrier is with pSOS94 carrier (Desai1999, ApplEnvironMicrobiol) carrier based on, chloramphenicol resistance gene is expressed unit, clostridium CAC2546 gene (NC_003030) promotor, the open reading frame of PfHSPS gene and Bacillus subtilus pyruvatekinase(PYK, NC_000964) gene terminator (PYK) ctfAB and abc connected in the rear pSOS94 of replacement carrier expresses cell formation, and this carrier is about 6720bp.Concrete construction process is as follows:

From pXYP251(GenBank accession number AY178046, being T1T2 containing medium tenacity protokaryon PGm promotor and terminator) paraxin that increases in carrier expresses unit.Primer is cm1:5 '-AAGCTTATAACTTCGTATAATGTATGCTATACGAAG-3 '; Cm2:5 '-TCTAGATATACGAAGATAACTTCGTATAGCATACAT-3 '.Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 60s; 25 circulations.

From clostridium C.acetobutylicumATCC824(American type culture collection, US7432090) middle amplification CAC2546 gene promoter.Primer is cac1:5 '-TCTAGAAAAGGAAAATATGATAAAAAATTTCA-3 '; Cac2:5 '-GGATCCTAATATCGAAAATAGCTTAAAC-3 '.Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s; 25 circulations.

From Bacillus subtilus Bacillussubtilis168(ATCC) increase gene PYK terminator.Primer is pyk1:5 '-GAGCTCTTACAGGTGAAAATGGAAGGGGA-3 '; Pyk2:5 '-CATATGTATAGCGGGTAACCCAACGGGATAAGAAGACAGGCGCCG-3 '.Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s; 25 circulations.

After above-mentioned three pcr amplification segments being reclaimed, flush end connects, and clones and checks order.Obtain the gene that order-checking is correct, paraxin is expressed unit HindIII and XbaI double digestion; CAC2546 gene promoter BamHI and XbaI double digestion; PfHSPS gene BamHI of the present invention and SacI double digestion; Bacillus subtilus Bacillussubtilis168(ATCC) PYK gene terminator NdeI and SacI double digestion after be cloned into pCAMBIA1301 carrier (http://www.cambia.org) successively.

CtfAB and abc expressed by the paraxin obtained after clone in unit, CAC2546 gene promoter, PfHSPS gene and Bacillus subtilus PYK gene terminator entirety replacement pSOS94 carrier expresses unit, namely obtains the Escherichia coli-Clostridia shuttle expression carrier pPFHSP containing PfHSPS gene of the present invention.

Electric shocking method is utilized to import in clostridium by above-mentioned clostridium-bacillus coli shuttle expression carrier containing PfHSPS gene, transformant is screened by erythromycin, the PfHSPS gene that utilization demonstrates the present invention's synthesis containing butanols substratum can be expressed by stability and high efficiency in clostridium, improves the tolerance of clostridium to butanols.

Meanwhile, the present invention also utilizes anaerobically fermenting, demonstrates the ability that described PfHSPS gene pairs clostridium improves butylic fermentation output.Experiment results proved, PfHSPS gene of the present invention can increase substantially the product butanols ability of clostridium, and comparatively original strain improves 29.2%.

Accompanying drawing explanation

Fig. 1 is the structure collection of illustrative plates of the clostridium-bacillus coli shuttle expression carrier containing PfHSPS gene.

Fig. 2 is that HSP transformant and original strain butanol tolerance compare.

Fig. 3 and Fig. 4 be HSP transformant and original strain fermentation after product and growing state compare.

Embodiment

Embodiment 1 is from the synthesis of the little heat shock protein HSP gene of hearty flame bacterium (Pyrococcusfuriosus)

Under the prerequisite not changing aminoacid sequence, according to the HSP gene (GenbankAF256212) of clostridium preference codon synthesis from hearty flame bacterium (Pyrococcusfuriosus), design primer, and synthetic.Primer is as follows, and primer length is 50-60bp.

Pfhsp1:GGATCCATGGTTAGAAGAATTAGAAGATGGGATATTTGGGACCCATTTGATCTTATTAGA

Pfhsp2:AAAATTCATCAAACATTGCATCAATTTCCTCTTGAATTTCTCTAATAAGATCAAATGGGT

Pfhsp3:TGCAATGTTTGATGAATTTTTTAGTAGACCAAGACTTTGGACTTATAGAAGATGGAGTGA

Pfhsp4:TCTCCAAACTTCTCCAACTCTCTCTTCATACATTGCTGGTTCACTCCATCTTCTATAAGT

Pfhsp5:GAGTTGGAGAAGTTTGGAGAGAACCATTTGTTGATATTTTTGATAATGGAGATGAGTTTG

Pfhsp6:ATATCTTCTTTTCTAACTCCTGGAAGTTCTGCTGTAATAACAAACTCATCTCCATTATCA

Pfhsp7:GGAGTTAGAAAAGAAGATATTAAAGTTAGAGTTACTGAGGATACTGTTTATATTGAGGCA

Pfhsp8:CTGCTCCTTCTCTTTCAAGTTCTTTCTCTCTCTTAACAGTTGCCTCAATATAAACAGTAT

Pfhsp9:ACTTGAAAGAGAAGGAGCAGTTAGAATTGAGAGATATTTTACTGGTTATAGAAGAGCTAT

pfhsp10:TGCCTTTGCCTTCTCTGGAATAACTTCTTCTGGAAGTCTAATAGCTCTTCTATAACCAGT

pfhsp11:TTCCAGAAGAAGTTATTCCAGAGAAGGCAAAGGCAAAGTATAATAATGGAGTTCTTGAGA

pfhsp12:TCACTCTCCTTCTTAGTTGGATGCTTCTTTGGAACTCTAATCTCAAGAACTCCATTATTA

pfhsp13:GAGCTCTTATTCAACTTTAACTTCAAATCCTTCACTCTCCTTCTTAGTTGG

Utilize PCR to carry out hearty flame bacterium HSP to increase, in 100 μ l reaction systems, the addition of pfhsp2 ~ pfhsp12 totally 11 primers is 2ng, and Outside primer pfhsp1 and pfhsp13 addition are 30ng, and amplification condition is: 94 DEG C of preheating 1min; 94 DEG C of 30s, 50 DEG C of 30s, 72 DEG C of 30s, after totally 25 circulations, 72 DEG C extend 10min, and the Taq DNA polymerase of use is KODFXtaq enzyme (Toyobo company, Japan).

After PCR terminates, 1% agarose gel reclaims, and gets the pUC18 carrier flush end that 10 μ l directly cut with SmaI enzyme and is connected.16 DEG C connect in 1h, Efficient Conversion DH5 α competence.Obtain positive colony, and carry out sequencing, its base sequence is as shown in SEQIDNO1, and this positive colony is little heat shock protein HSP gene of the present invention, called after PfHSPS gene.

The structure of the Escherichia coli-Clostridia shuttle expression carrier of embodiment 2 containing PfHSPS gene

With pSOS94 carrier (Desai1999, ApplEnvironMicrobiol) carrier based on, chloramphenicol resistance gene is expressed unit, clostridium CAC2546 gene (NC_003030) promotor, the open reading frame of the PfHSPS gene that embodiment 1 obtains and Bacillus subtilus pyruvatekinase(PYK, NC_000964) gene terminator (PYK) replaces ctfAB and the abc expression unit in pSOS94 carrier after connecting, clostridium-bacillus coli shuttle expression carrier the pPFHSP(containing PfHSPS gene expression units that structure is controlled by strong promoter is referring to Fig. 1), this carrier is about 6720bp.Concrete construction step is as follows:

After above-mentioned three pcr amplification segments being reclaimed, flush end connects, and clones and checks order.Obtain the gene that order-checking is correct, paraxin is expressed unit HindIII and XbaI double digestion; CAC2546 gene promoter BamHI and XbaI double digestion; The PfHSPS gene BamHI that embodiment 1 obtains and SacI double digestion; Bacillus subtilus Bacillussubtilis168(ATCC) PYK gene terminator NdeI and SacI double digestion after be cloned into pCAMBIA1301 carrier (http://www.cambia.org) successively.

Embodiment 3 transform plastids process and method for transformation

The Escherichia coli-Clostridia shuttle expression carrier pPFHSP that above-described embodiment 2 builds contains penbritin and Erythromycinresistant, can copy in intestinal bacteria, the clostridium that can be transformed by erythromycin screening again.This shuttle expression carrier is utilized (Mermelstein1993 on pAN1 plasmid; ApplEnvironMicrobiol) methylase methylates; it contains the δ 3T methyl transferase gene from Bacillus subtilus; the protection that methylates of clostridium carrier can be realized; thus avoid plasmid by the segment of Cac824I restriction enzyme in clostridium, because this restriction enzyme site extensively exists in clostridium.

The bacterial classification that intestinal bacteria for plasmid amplification must adopt methylase to lack, because when being transformed in common E.coli bacterial strain by the DNA of some cytosine methylation, transformation efficiency can obviously reduce.Reason may come from the restriction system of E.coli self.Present invention utilizes the strain Escherichia coli of bacterial classification (TOP10, Invitrogen, Carlsbad, CA, USA) as plasmid amplification of methylase mcrBC disappearance.

By the Escherichia coli-Clostridia shuttle expression carrier cotransformation of pAN1 and above-mentioned structure in TOP10 bacterial classification, utilize chloramphenicol resistance (CM) and anti-penbritin (AP) twin antibiotic to screen these two plasmids and transform successful transformant simultaneously, alkaline process is extracting plasmid DNA in a small amount.

Method for transformation is as follows: clostridium C.acetobutylicum824 utilizes 60mLCGM culture medium culturing to OD ₆₀₀=0.5, ice puts 10 minutes, and 7000g4 DEG C centrifugal 10 minutes; With electroporation buffer (270mM glucose and the 686mMNaH of precooling ₂pO ₄, pH=7.4) and wash three times; The electroporation buffer of last 1mL precooling suspends and precipitates; Clostridium competent cell prepared by packing, every 80ul competence adds the plasmid DNA of 1ug; Proceed in the electric shock cup of 4mm after mixing; Electric shock condition: (2.5kV, infinite, 25uF); The 2YTG substratum (16g/L peptone, 10g/L yeast extract paste, 4g/LNaCl, and 5g/L glucose) of 1mL precooling is added immediately after electric shock terminates; Mixing proceeds to 1.5mLeppendorf pipe, places 37 DEG C of cultivation 4h in anaerobic environment; Transformant is coated on the 2YTG solid plate containing 40ug/mL erythromycin and carries out transformant screening.Anaerobic culturel, after 2 days, obtains a large amount of HSP transformant, and transformation efficiency is 5 × 10 ⁵/ ugDNA.

Embodiment 4 transformant butanols patience detects

The HSP transformant of picking clostridium C.acetobutylicum824 and acquisition on flat board, is inoculated in 10mL liquid RCM substratum respectively, and in 75 DEG C of water-baths heat shock 10min, then 37 DEG C of Anaerobic culturel; When thalli growth is to OD ₆₀₀when=0.8, thalline is forwarded in 40mL liquid CGM substratum, 37 DEG C of Anaerobic culturel; When thalli growth is to OD exponential phase of growth ₆₀₀when=1.0 ± 0.05 (about 12h); Culture is divided into 4 equal portions (10mL/ part), carries out Stress treatment respectively, monitor the growth conditions of clostridium under different butanol concentration is coerced with 0,6,12 and 18g/L butanols.

Test-results is referring to Fig. 2 (824--original strain, the conversion bacterial classification of HSP--PfHSPS gene of the present invention), can find out: original strain--clostridium C.acetobutylicum824 can grow in 6g/L and 12g/L butanols, but almost can not grow in 18g/L butanols; HSP transforms bacterial classification at 6g/L, 12g/L and 18g/L butanols stable growth, also receive part suppression, but overall growth situation can be better than original strain though can grow.These results clearly show the butanols that can tolerate greater concn after HSP is transformed into clostridium, effectively improve the growth perfonnance of bacterial classification under butanols is coerced.

The pilot scale fermentation of embodiment 5 clostridium

Transform the more physiologic character of bacterial classification to obtain HSP, we carry out control pH(pH < 5.0) batch fermentation experiment.Having carried out twice biology revision test is respectively averaged as net result, and fermenting experiment carries out in BioStatB fermentor tank (German Bei Lang company) on a small scale.First on flat board, picking clostridium and HSP transformant mono-clonal are inoculated in 10mL liquid RCM substratum respectively, and HSP transforms in the substratum of clostridium and adds 20ug/l erythromycin, 37 DEG C of Anaerobic culturel; When thalli growth is to OD ₆₀₀when=0.8, thalline to be forwarded in liquid CGM substratum Anaerobic culturel as seed liquor; When seed liquor thalli growth is to OD ₆₀₀when=0.2, the inoculum size by 10% is inoculated into containing 4L liquid CGM(80g/L glucose) carry out fermenting experiment in the fermentor tank of substratum; Anaerobic environment in fermentor tank is maintained by inflated with nitrogen (flow velocity 50mL/min); The initial pH that ferments is approximately 6.5, by add 6mol ammoniacal liquor control thalline fermentation pH maintain 5.0.When glucose amount is down to original bulk one half, add glucose to starting point concentration.

Embodiment 6 ferment after the detection of meta-bolites

With meta-bolites after the fermentation of Agilent6890 gas chromatograph for determination.

Chromatographic condition: chromatographic column: phenomenZB--WAXplus, detector: FID(220 DEG C) sample size 0.2txL, inlet pressure: 16.92psi, post case temperature: 100 DEG C, hydrogen flowing quantity: 30mL/min, n-propyl alcohol carries out quantitative analysis as interior mark.

Test-results, referring to Fig. 3 and Fig. 4, can be found out: the production peak that 1) HSP transforms bacterial classification butanols during the fermentation reaches 230mM, and the output of original strain butanols is only up to 178mM, improves 29.2%; The production peak that HSP transforms bacterial classification acetone is during the fermentation 139mM, and the output of original strain acetone, only up to 94mM, improves 47.8%; In fermenting process, HSP transforms the production peak of bacterial classification ethanol is 24.2mM, suitable with original strain output; HSP transforms bacterial classification solvent ultimate production and reaches 393.2mM, improves 32.6% relative to original strain.The butyric acid production peak of two bacterial classifications only has little difference, and HSP bacterial classification is 71mM, slightly lower than the 75.2mM of original strain.

2) original strain can utilize glucose fast, and after 30 hours, increment reaches the highest (OD ₆₀₀reach 8.4), but, along with the generation of butanols, bacterial classification after 50 hours, stand density sharply declines (OD ₆₀₀be 6.2), butanols output slowly reduces, until reach certain balance, the harm of the butanol concentration now in fermented liquid to bacterial classification is less.And HSP transformant during the fermentation, in 30-70 hour, bacterial classification is all in high-density growth state, butanols output continues to increase within this period, until close to original strain production peak level, after this, butanols output maintains the period of one section of low growth, increase fast again from the output of 80-110 hour butanols, until maximum, the later stage due to butanols output higher, there is certain toxic action to bacterial classification, cause thalli growth density sharply to decline.

As can be seen from above-mentioned fermentation results, because HSP transformed bacteria can tolerate the butanols of greater concn, bacterial classification can keep high-density growth for a long time, thus ensures the continuous increase of butanols output.The generation rule of acetone is similar with butanols, and HSP transforms bacterial classification acetone output in 110 hours all in stable growth.

Claims

1. derive from a little heat shock protein HSP gene of hearty flame bacterium Pyrococcusfuriosus, its base sequence is as shown in SEQIDNO1.

2. one kind comprises the Escherichia coli-Clostridia shuttle expression carrier deriving from the little heat shock protein HSP gene of hearty flame bacterium according to claim 1, described expression vector is carrier based on pSOS94 carrier, chloramphenicol resistance gene is expressed unit, clostridium CAC2546 gene promoter, ctfAB and abc that replace after the open reading frame of little heat shock protein HSP gene according to claim 1 is connected with Bacillus subtilus pyruvatekinase in pSOS94 carrier expresses cell formation;

Wherein, increase CAC2546 gene promoter from clostridium C.acetobutylicumATCC824, and primer is cac1:5 '-TCTAGAAAAGGAAAATATGATAAAAAATTTCA-3 '; Cac2:5 '-GGATCCTAATATCGAAAATAGCTTAAAC-3 '; Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s; 25 circulations.

3. Escherichia coli-Clostridia shuttle expression carrier according to claim 2, is characterized in that, unit expressed by the paraxin that increases from pXYP251 carrier, and primer is cm1:5 '-AAGCTTATAACTTCGTATAATGTATGCTATACGAAG-3 '; Cm2:5 '-TCTAGATATACGAAGATAACTTCGTATAGCATACAT-3 '; Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 60s; 25 circulations.

4. Escherichia coli-Clostridia shuttle expression carrier according to claim 2, is characterized in that, increase PYK terminator from Bacillus subtilus Bacillussubtilis168 gene, and primer is pyk1:5 '-GAGCTCTTACAGGTGAAAATGGAAGGGGA-3 '; Pyk2:5 '-CATATGTATAGCGGGTAACCCAACGGGATAAGAAGACAGGCGCCG-3 '; Amplification condition: 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s; 25 circulations.

5. the application of little heat shock protein HSP gene in clostridium high expression deriving from hearty flame bacterium according to claim 1.

6. the application of little heat shock protein HSP gene in clostridium butanol tolerance deriving from hearty flame bacterium according to claim 1.

7. the little heat shock protein HSP gene deriving from hearty flame bacterium according to claim 1 is improving the application in clostridium butylic fermentation output.