CN103898109B - One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof - Google Patents
One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof Download PDFInfo
- Publication number
- CN103898109B CN103898109B CN201410164373.2A CN201410164373A CN103898109B CN 103898109 B CN103898109 B CN 103898109B CN 201410164373 A CN201410164373 A CN 201410164373A CN 103898109 B CN103898109 B CN 103898109B
- Authority
- CN
- China
- Prior art keywords
- wheat
- molecule marker
- sharp eyespot
- eyespot resistance
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention open a kind of and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof, size is the molecule marker Xgwm484-145 of 145bp, the DNA with wheat breed CI12633, with primer pair SEQ? No:1 and SEQ? No:2 carries out pcr amplification, and amplified production obtains after electrophoretic separation on 6% polyacrylamide gel; This molecule marker is used for wheat breed CI12633 and derived varieties thereof or the genotypic detection of strain, to judge whether this kind or strain have sharp eyespot resistance; It is easily affected by environment that the present invention overcomes wheat sharp eyespot resistance qualification in conventional breeding, can only in the shortcoming of seed milk stage evaluation and screening, just the sharp eyespot resistance of wheat plant predicted and screens by detection molecules mark in seedling stage, eliminating disease plant, improving breeding efficiency.
Description
Technical field
The present invention relates to wheat breeding and biology field, particularly a kind of and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof.
Background technology
Wheat hypochnus is the important disease of wheat of China middle and lower reach of Yangtze River Mai Qu and Yellow River-Huai River region, infect primarily of Rhizoctonia cerealis (RhizoctoniacerealisVanderHoeven) etc. and cause, it is serious that this disease causes wheat yield to lose, only 2005 ~ 2009, the wheatland area that China is caused harm by banded sclerotial blight every year about 670 ~ 8,000,000 hectares, the financial loss caused thus is more than billions of unit.The control of this disease is based on chemical prevention at present, because disease happening part is at wheat culm base portion, control not only needs dose large and prevention effect is subject to the such environmental effects such as weather, chemical prevention too increases agriculture originally, extensive use chemical agent is bound to influence ecological environment, cultivates and uses the disease-resistant variety most economical and effective means of control wheat hypochnus beyond doubt.
The anti-source that the cultivation of disease-resistant variety needs resistance is combined for preparing hybrid.In the last thirty years, China researchist has carried out sharp eyespot resistance qualification to more than 3000 part wheat idioplasms, though screen some anti-sources, knows little about it to the genetics of resistance rule in these anti-sources, major part anti-source agronomy is poor, and the anti-source of the banded sclerotial blight that can use in breeding still lacks.
The research report carrying out wheat sharp eyespot resistance is abroad less, mainly concentrate on domestic to the report that wheat hypochnus disease-resistant gene (QTL) is located, toothpick is utilized to embed and trench sowing is carried disease germs (the wheat crops journals such as disease wheat Resistance Identification method Tang Ting, 2004,24 (4): 11-16) adopt recombinant inbred lines ARz/ Yangmai No.158,2D, 3B, 3D and 7D karyomit(e) detects sharp eyespot resistance QTL, explain the 8%-14% of sharp eyespot resistance respectively; Open (the plant genetic resources journals such as hamlet, 2005,6 (3): 276-279) potted plant seed dressing inoculation method is adopted to identify the sharp eyespot resistance of recombinant inbred lines river 35050/ mountain agriculture 483, QTL positioning result shows that 1A karyomit(e) exists anti-banded sclerotial blight QTL, the sharp eyespot resistance of this QTL soluble 21.57%, detect that 4 to making QTL mutually, total contribution rate is 52.2% simultaneously; Adopting Shandong wheat 21/ mountain agriculture 0431 recombinant inbred lines, the anti-banded sclerotial blight QTL chain with marking Xgwm526 being detected at 2B karyomit(e).(the wheat crops journal such as Ren Lijuan, 2007,27 (3): 416-420) toothpick is utilized to embed and method such as table soil inoculation etc. identifies the sharp eyespot resistance of No. 3, recombinant inbred lines Sumai 3/exempt from vain, in conjunction with genotype data, karyomit(e) 2B, 3B, 5A, 6A and 6B find anti-banded sclerotial blight QTL, and phenotypic interpretation rate is respectively 9%-13%; Chen etc. (TheoreticalandAppliedGenetics, 2013,126 (11): 2865-2878) also find to there is sharp eyespot resistance QTL at 1A, 2B, 3B, 4A, 5D, 6B and 7B karyomit(e).
CI12633 is the anti-source of Powdery Mildew containing Pm2 and Pm6 that China introduces, and this anti-source is double Resistant Gene To Rust and smut simultaneously, and Resistance Identification shows for many years, and this anti-source stem stalk is tough and tensile, has more stable sharp eyespot resistance, can be used for varietal resistance improvement.Genetic analysis shows, the sharp eyespot resistance of CI12633 is the quantitative character by major gene and minor gene co-controlling, be conducive to molecule location and the molecular marker assisted selection (Ren Lijuan etc. of major gene, Jiangsu's agriculture journal, 2010, 26 (6): 1156-1161), we adopt CI12633/ Yangmai No.158 recombinant inbred lines to locate its sharp eyespot resistance main effect QTL, at 6B, 5A karyomit(e) finds the anti-banded sclerotial blight main effect QTL of phenotypic interpretation rate more than 10%, with the GWM608 of 6B and 5A karyomit(e) resistance main effect QTL compact linkage, GWM88, WMC727 and GWM410.2 molecule marker is applied for a patent (patent No.: ZL200710019279.8), but have not yet to see report with the molecule marker of sharp eyespot resistance main effect QTL compact linkage in CI12633 kind 2D karyomit(e).
Summary of the invention
The object of the invention is to provide a kind of detection in wheat 2D karyomit(e) and whether there is the molecule marker with the sharp eyespot resistance main effect QTL compact linkage of wheat breed CI12633, judge that whether wheat plant is containing sharp eyespot resistance main effect QTL, thus the sharp eyespot resistance of prediction wheat plant, accelerate the selection progress of anti-banded sclerotial blight wheat, concrete steps are as follows:
One and the closely linked molecule marker of wheat sharp eyespot resistance QTL, with the DNA of wheat breed CI12633, pcr amplification is carried out with primer pair SEQNo:1 and SEQNo:2, amplified production after electrophoretic separation, obtains the molecule marker Xgwm484-145 that size is 145bp on 6% polyacrylamide gel.
In the present invention, the DNA of wheat breed CI12633 refers to and is separated to the blade of CI12633 wheat plant the DNA obtained, and described 6% polyacrylamide gel refers in 100ml polyacrylamide sol solution containing 5.7g acrylamide and 0.3g methylene diacrylamide.
A kind of above-mentioned application with the closely linked molecule marker of wheat sharp eyespot resistance QTL, molecule marker Xgwm484-145 is used for the genotypic detection of wheat breed CI12633 and derived varieties or strain thereof, to judge whether this kind or strain have sharp eyespot resistance.
In application of the present invention, the described method judging whether this kind or strain have a sharp eyespot resistance is: be male parent by CI12633 and derived varieties thereof or product or maternally also multiply to F with other wheat hybridizings
2more than generation, extract wheat plant leaf DNA, pcr amplification is carried out with primer pair SEQNo:1 and SEQNo:2, amplified production is on 6% polyacrylamide gel after electrophoretic separation, check whether containing size to be the molecule marker Xgwm484-145 closely linked with wheat sharp eyespot resistance QTL of 145bp, there is this molecule marker, then " in anti-" level of predicting that the resistance of the banded sclerotial blight of this wheat at least reaches; Described " in anti-" level refers to that wheat hypochnus disease index is 20.1-30.0%.
In application of the present invention, described wheat breed CI12633 and derived varieties thereof or strain refer to, take CI12633 as parent, by conventional hybridization or adopt corn and wheat hybridizing to induce monoploid, then double wheat breed or the strain of acquisition double haploid by colchicine.
It is easily affected by environment that the present invention can overcome wheat sharp eyespot resistance qualification in conventional breeding, and can only in the shortcoming of seed milk stage evaluation and screening, just the sharp eyespot resistance of wheat plant predicted and screens by detection molecules mark in seedling stage, eliminate disease plant, reduce the waste of manpower and materials, improve breeding efficiency.
Embodiment
Embodiment 1 is verified in seed materials with the molecule marker of wheat sharp eyespot resistance main effect QTL compact linkage:
The primer pair that the present embodiment relates to:
SEQNO:15’ACATCGCTCTTCACAAACCC3’；
SEQNO:25’AGTTCCGGTCATGGCTAGG3’
1. the strain being customized for W001 ~ W018 is male parent with CI12633, is female parent, hybridizes and multiply to F with Yangmai No.158
6the seed materials in generation; The strain being customized for W019 ~ W048 take CI12633 as male parent, is maternal, hybridizes and multiply to F with peaceful wheat No. 9
6the seed materials in generation; The strain being customized for W049 ~ W068 is male parent with CI12633, and take Yangmai No.158 as female parent, hybridization F1, adopts Pollen Maydis induction monoploid, and the double haploid strain after doubling by colchicine.
2. pair each seed materials adopts the method for CTAB to extract leaf DNA respectively.
3. the DNA that pair step (2) obtains carries out pcr amplification with PCR primer pair SEQNO:1 and SEQNO:2 respectively, and PCR reaction system is: cumulative volume 20 μ l, 1.5mmol/LMgCl
2, 0.2mmol/LdNTP
s, 0.4mmol/L primer SEQNo:1 and primer SEQNo:2,50ng wheat template DNA, 1uTag enzyme, surplus is 1 × PCR damping fluid; PCR reaction conditions: 95 DEG C of sex change 3min, then 94 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 30s totally 35 circulations, last 72 DEG C extend 5min;
Amplified production is on 6% polyacrylamide gel after electrophoretic separation, check whether containing size to be the Xgwm484-145 molecule marker of 145bp, described 6% polyacrylamide gel is containing 5.7g acrylamide and 0.3g methylene diacrylamide in 100ml polyacrylamide sol solution.
4. as containing Xgwm484-145 molecule marker, then the resistance of the banded sclerotial blight of this wheat measurable at least reaches " in anti-" level.
5. the sick garden in field, carries out wheat sharp eyespot resistance qualification to W001 ~ W068 seed materials, in wheat during jointing stage inoculation banded sclerotial blight germ, and the milk stage investigation banded sclerotial blight state of an illness, severity criterion is as follows: 0 grade: without illness; 1 grade: leaf sheath has typical banded sclerotial blight scab, but does not invade stem; 2 grades: germ invades people's stem stalk, scab width ring stem is no more than 1/2 of stem stalk girth; 3 grades: germ invades people's stem stalk, on stem stalk, scab ring stem width is between 1/2-3/4 stem stalk girth; 4 grades: germ invades people's stem stalk, and on stem stalk, scab is around stem stalk more than 3/4, or the soft corruption of stem stalk; 5 grades: withered booting or withered dead ears.
Disease index calculates as follows:
Disease index=[(Σ diseased plant at different levels number × typical value at different levels)/(total strain number × highest typical value)] × 100
Resistance criterion: wheat hypochnus disease index less than 20.0% is " resisting ", 20.1-30.0% is " in anti-", and 30.1-40.0% is " middle sense ", and more than 40.1% is " sense ".
6. by Xgwm484-145 Molecular Prediction result and the comparison of Disease garden identification actual result, the results are shown in subordinate list 1, predict the outcome very identical with measured result, as long as there is Xgwm484-145 molecule marker to exist, this strain banded sclerotial blight disease index is all lower than 30%, wherein 3 parts of material disease indexs are lower than 20.0%, reach the level of " resisting ".
Table 1 Molecular Prediction result compares with actual result
Note :+expressive notation exists, and-expressive notation does not exist.
SEQUENCELISTING
<110> Jiangsu Province Agriculture Science Institute
<120> mono-kind and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof
<130>2
<160>2
<170>PatentInversion3.3
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
acatcgctcttcacaaaccc20
<210>2
<211>19
<212>DNA
<213> artificial sequence
<400>2
agttccggtcatggctagg19
Claims (5)
1. one kind and the closely linked molecule marker of wheat sharp eyespot resistance QTL, it is characterized in that, size is the molecule marker Xgwm484-145 of 145bp, the DNA with wheat breed CI12633, carry out pcr amplification with primer pair SEQNo:1 and SEQNo:2, amplified production obtains after electrophoretic separation on 6% polyacrylamide gel.
2. require molecule marker closely linked with wheat sharp eyespot resistance QTL described in 1 according to power, it is characterized in that, the DNA of described wheat breed CI12633 refers to and is separated to the blade of CI12633 wheat plant the DNA obtained, and described 6% polyacrylamide gel refers in 100ml polyacrylamide sol solution containing 5.7g acrylamide and 0.3g methylene diacrylamide.
3. the application of molecule marker as claimed in claim 1 or 2, is characterized in that, molecule marker Xgwm484-145 is used for the genotypic detection of wheat breed CI12633 and derived varieties or strain thereof, to judge whether this kind or strain have sharp eyespot resistance.
4. the application of molecule marker according to claim 3, is characterized in that, the described method judging whether this kind or strain have a sharp eyespot resistance is: be male parent by CI12633 and derived varieties thereof or product or maternally also multiply to F with other wheat hybridizings
2more than generation, extract wheat plant leaf DNA, pcr amplification is carried out with primer pair SEQNo:1 and SEQNo:2, amplified production is on 6% polyacrylamide gel after electrophoretic separation, check whether containing size to be the molecule marker Xgwm484-145 closely linked with wheat sharp eyespot resistance QTL of 145bp, there is this molecule marker, then " in anti-" level of predicting that the resistance of the banded sclerotial blight of this wheat at least reaches; Described " in anti-" level refers to that wheat hypochnus disease index is 20.1-30.0%.
5. the application of molecule marker according to claim 4, it is characterized in that, described wheat breed CI12633 and derived varieties thereof or strain refer to, take CI12633 as parent, by conventional hybridization or adopt corn and wheat hybridizing to induce monoploid, then double wheat breed or the strain of acquisition double haploid by colchicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410164373.2A CN103898109B (en) | 2014-04-22 | 2014-04-22 | One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410164373.2A CN103898109B (en) | 2014-04-22 | 2014-04-22 | One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898109A CN103898109A (en) | 2014-07-02 |
| CN103898109B true CN103898109B (en) | 2015-12-30 |
Family
ID=50989680
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410164373.2A Active CN103898109B (en) | 2014-04-22 | 2014-04-22 | One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898109B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498503A (en) * | 2014-11-28 | 2015-04-08 | 安徽拜森生物科技有限公司 | Corn sheath blight anti-disease gene GRMZM2G127328 and application thereof |
| CN106834527B (en) * | 2017-04-01 | 2020-09-04 | 江苏省农业科学院 | Molecular marker closely linked with wheat seedling sheath blight resistance QTL and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003839A (en) * | 2007-01-11 | 2007-07-25 | 江苏省农业科学院 | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application |
| CN103688846A (en) * | 2013-12-02 | 2014-04-02 | 西北农林科技大学 | Wheat-tritileymus 3D (3Ns) alien substitution line cultivation method and identification method |
-
2014
- 2014-04-22 CN CN201410164373.2A patent/CN103898109B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003839A (en) * | 2007-01-11 | 2007-07-25 | 江苏省农业科学院 | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application |
| CN103688846A (en) * | 2013-12-02 | 2014-04-02 | 西北农林科技大学 | Wheat-tritileymus 3D (3Ns) alien substitution line cultivation method and identification method |
Non-Patent Citations (1)
| Title |
|---|
| 小麦纹枯病抗性相关QTL的筛选、定位及我国部分冬、春小麦品种（系）遗传多样性的研究;杨慧勇;《中国优秀硕士论文全文数据库》;20080515(第5期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898109A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Que et al. | Genetic analysis of diversity within a Chinese local sugarcane germplasm based on start codon targeted polymorphism | |
| Adhikari et al. | Pathogenic and genetic diversity of Xanthomonas translucens pv. undulosa in North Dakota | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN105349684B (en) | With the molecular labeling of the anti-rough dwarf disease main effect QTL compact linkage of corn | |
| CN106555001B (en) | A kind of molecular labeling of rice blast resistant gene and its application | |
| CN104498490A (en) | Molecular marker tightly linked with low-protein-content QTL of wheat grains and application of molecular marker | |
| CN105950617B (en) | Chain molecular labeling, preparation method and application with tomato wilt resistant gene | |
| Salami et al. | Genetic diversity of maize accessions (Zea mays L.) cultivated from Benin using microsatellites markers | |
| CN100519763C (en) | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application | |
| CN104450694A (en) | q SRBSDV6 (Southern rice black-streaked dwarf virus 6) and molecular marker method thereof | |
| CN101240342B (en) | Cucumber powdery mildew resistance main effect QTL compact linkage molecule labeling method and applying method | |
| CN103898109B (en) | One and the closely linked molecule marker of wheat sharp eyespot resistance QTL and application thereof | |
| CN103436533A (en) | Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker | |
| CN101372710A (en) | Method for determining soybean phytophthora root rot resistant quantitative trait loci and use of the loci | |
| CN100491541C (en) | Molecular mark closely linked to Sumai No.3 head blight resistance main effect QTL and its application | |
| Alhajturki et al. | Genetic variation of sorghum (Sorghum bicolor L. Moench) varieties assessed by ISSR markers | |
| Chakraborty et al. | rDNA sequence and phylogenetic analysis of Macrophomina phaseolina, root rot pathogen of Citrus reticulata (Blanco) | |
| CN104232764B (en) | The SNP marker of the low-phosphorous responsive genes ZmARF31 of corn and application thereof | |
| CN103088109B (en) | Method for auxiliary identification of corn haploid induction line, and special primer pair thereof | |
| Gougerdchi et al. | Using SSR markers for assessment genetic diversity and detection drought escape candidate genes in barley lines (Hordeum vulgare L.) | |
| CN104031995B (en) | A kind of method of molecular marker auxiliary breeding for disease resistance | |
| CN101974511B (en) | Molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at tomato seedling stage and application thereof | |
| Jaradat | Synthesis and assessment of date palm genetic diversity studies | |
| Ullah | Molecular genetic studies for drought tolerance in cotton | |
| CN102994498B (en) | Molecular marker for co-separating soybean anti-phytophthora megasperma candidate gene RpsWD15-1 and application of molecular marker for co-separating soybean anti-phytophthora megasperma candidate gene RpsWD15-1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |