CN103898025A - Bacillus thuringiensis for killing meloidogyn incognita and culture method of bacillus thuringiensis - Google Patents

Abstract

The invention relates to bacillus thuringiensis for killing meloidogyn incognita and a culture method of the bacillus thuringiensis. The bacillus thuringiensis NBIN-863 for killing meloidogyn incognita is preserved in the China Center for Type Culture Collection in Wuhan University in Wuhan China on 29th November, 2013, the survival date is 29th November, 2013, and the serial number in the Center is CCTCC NO: M2013612. A culture method of the Bacillus thuringiensis comprises the following steps: taking soil at 117 degrees and 29 minutes east longitude and 30 degrees and 39 minutes north latitude near the Jiuhuashan in Anhui province, suspending in sterile water, diluting according to gradient concentration, coating on a flat plate, culturing by using an LB (Lusso-Brillante) solid culture medium, diluting, drawing a line on an LB flat plate for culture, inoculating a single colony to a shake flask for culture, mixing with glycerin, preserving in a refrigerator, transferring the single colony into a liquid culture medium for culture, smearing and observing and confirming by using a crystal violet staining optical microscope.

Description

A kind of Tribactur and cultural method thereof that kills Meloidogyne incognita

Technical field

The present invention relates to a kind of Tribactur and cultural method thereof that kills Meloidogyne incognita.

Background technology

According to FAO conservative estimation, the whole world is approximately 12% because of the loss that eelworm harm causes grain and fibre crops every year, and the loss that vegetables, peanut, tobacco and some fruit tree are caused will exceed 20%, even reaches 50%.According to authoritative expert, approximately 1,500 hundred million dollars of the losses that plant nematode causes world agriculture to produce every year.About 3,500,000,000 dollars of the loss that China causes because of nematode every year.

At present the harmful nematode of plant is approximately had to kind more than 3000, and find in China have a kind more than 40, be wherein root knot nematode to one of the most serious nematode of crop harm.Root knot nematode polypide is small, lives in plant materials or in soil, can shift along with the transfer of rainwater, the operation of labor thing and diseased plant, and control is difficulty very.

The main method of control plant nematode disease has chemical prevention and biological control.Chemical agent major part is hypertoxic medicine, serious environment pollution.Biological control is to utilize the natural enemy of nematode control insect population quantity and limit the loss that nematode causes, and all comparatively safe to people, animal and environment, has a extensive future.At present most widely used in biological control is Tribactur (Bacillus thuringiensis, be called for short Bt), also have in addition the strong bacillus (Bacillus firmus) of puncture pasteurella (Psteuriapenetrans), false pseudomonas bacillus (Pseudomonas spp.) and discovery in recent years etc.

As far back as 1972, first Prasad etc. found that Bt β-extracellular toxin has very high activity to ovum and the larva of root knot nematode (Root-knot nematode, RKN).Find afterwards Bt β--extracellular toxin has very high insecticidal activity (Ignoff et al., 1977 to nematodes such as radopholus similes thorne (Radopholus similis), soybean cyst nematode Heterodera glycines and Chinese lantern plant nematodes (Panagrellus redivivus); Devidas et al., 1988).The discovery Bt Kurstakis (subsp.kurstaki) such as 20th century the mid-80 Bone and ovum and the larva of Israel subclass (subsp.israelensis) to animal parasitic nematodes trichostrongylus colubriformis (Trichostronglus colubriformis) have very high insecticidal activity, Mycogen company of the U.S. in 1988 finds that Bt crystallin is to Meloidogyne (Meloidogyne spp.), Tylenchorhynchus (Tylenchs spp.), Pratylenchidae belongs to the plants such as (Pratylenchus spp.) and Aphelenchoides (Aphlenchoides spp.).Mycogen company of the U.S. screens the Bt bacterial strain that much plant nematode is had insecticidal activity, has also applied for patent simultaneously.Our preliminary screening in 1993 have the Bt bacterial strain of insecticidal activity to plant nematode to 9 strains, these Bt bacterial strains have very high insecticidal activity to sweet potato stem nematode (Ditylenchus destructor), northern root knot nematode (M.hapla) and ramie Pratylenchidae (P.scribneri), the bacterial strain of wherein having applied for national patent is YBT-1532 (ZL00-1-16062.1) (minor congruence, 2007b).

Summary of the invention

The object of the invention is for above-mentioned present situation, aim to provide a kind of Tribactur and cultural method thereof that kills Meloidogyne incognita.

The implementation of the object of the invention is, a kind of Tribactur that kills Meloidogyne incognita, Tribactur NBIN-863Bacillus thuringiensis NBIN-863, depositary institution: Chinese Typical Representative culture collection center, address: China, Wuhan, Wuhan University, preservation center numbering CCTCC NO:M2013612, November 27 2013 preservation day, survival November 29 2013 date.

A cultural method that kills the Tribactur of Meloidogyne incognita, concrete steps are as follows:

1) get near Anhui Province's Jiuhuashan, east longitude 117 is spent 29 points, and north latitude 30 is spent the pedotheque 1g of 39 points of positions, suspends, according to 10 at use for laboratory 1ml sterilized water ^-3, 10 ^-4, 10 ^-5, 10 ^-6concentration is diluted and is coated with flat board, and with being inverted and cultivating 24h in 28 DEG C of constant incubators of LB solid culture liquid, from flat board, picking list bacterium colony again dilutes and lines on LB flat board, under 28 DEG C of conditions, cultivates 24h;

LB solid culture liquid formula: peptone 10g, yeast powder 5g, sodium-chlor 10g, agar powder 20g, is dissolved in 1L distilled water, and 121 DEG C, 30min, moist heat sterilization;

2) single colony inoculation repeated isolation being purified to is in 5ml LB liquid nutrient medium shaking flask, and 28 DEG C, 200rpm, cultivates 36h,

Described LB liquid culture based formulas: peptone 10g, yeast powder 5g, sodium-chlor 10g, be dissolved in 1L distilled water, 121 DEG C, 30min, moist heat sterilization;

3) first configure glycerine with deionized water, 121 DEG C of moist heat sterilization 30min, water: glycerine volume ratio=1:1;

4) by step 2) cultivate 500 μ l bacterium liquid after 36h and mixed with the glycerine equal-volume of 500 μ l50% of sterilizing, after mixing, be put in preservation in-80 DEG C of refrigerators;

5) by separation and purification from LB flat board to single bacterium colony be transferred in LB liquid medium, 28 DEG C, 200rpm, cultivates after 48h, carry out after smear, fixing, violet staining, under opticmicroscope oil lens head, carrying out morphologic observation is Bacillus thuringiensis bacterial strain.

Brief description of the drawings

Fig. 1 kills the microscopic examination picture that the Tribactur strain Bacillus thuringiensis NBIN-863 of Meloidogyne incognita grows after 48h in liquid LB substratum;

Fig. 2 is the phylogenetic analysis figure that kills the Tribactur strain Bacillus thuringiensis NBIN-863 of Meloidogyne incognita;

Fig. 3 is the precipitation SDS-PAGE gel electrophoresis figure that kills the Tribactur strain Bacillus thuringiensis NBIN-863 of Meloidogyne incognita;

Embodiment

Kill the Bacillus thuringiensis bacterial strain Bacillus thuringiensis NBIN-863 of Meloidogyne incognita, depositary institution: Chinese Typical Representative culture collection center, address: China, Wuhan, Wuhan University, preservation center numbering CCTCC NO:M2013612, November 27 2013 preservation day, survival November 29 2013 date.

Kill the Bacillus thuringiensis bacterial strain form of Meloidogyne incognita: on flat board, single bacterium colony of growth is oyster white flakes, surface irregularity, under growth 24h Electronic Speculum, be viewed as shaft-like, after growth 36h for stain-fast brood cell with catch the rhomboidan of look; Growth 48h after supernatant liquor produce 6 kinds of albumen, wherein 3 kinds is insecticidal crystal protein, be respectively Cry9Aa albumen (130kDa), Cry2Aa albumen (69kDa) and Cry1Ac albumen (130kDa) (Fig. 3).Tribactur has the Meloidogyne incognita of killing activity.

East longitude 117 is spent 29 points to the applicant near Anhui Province's Jiuhuashan on May 10th, 2012, and north latitude 30 is spent the position of 39 points and taked pedotheque 1g, suspends, according to 10 at use for laboratory 1ml sterilized water ^-3, 10 ^-4, 10 ^-5, 10 ^-6concentration is diluted and is coated with flat board, with LB solid culture liquid (peptone 10g, yeast powder 5g, sodium-chlor 10g, agar powder 20g, be dissolved in 1L distilled water, 121 DEG C, 30min, moist heat sterilization), in 28 DEG C of constant incubators, be inverted and cultivate 24h, from flat board, picking list bacterium colony again dilutes and lines on LB flat board, under 28 DEG C of conditions, cultivates 24h.Single colony inoculation that repeated isolation is purified to is in 5ml LB liquid nutrient medium shaking flask, and 28 DEG C, 200rpm, cultivates 36h.First, with the glycerine (water: glycerine volume ratio=1:1,121 DEG C of moist heat sterilization 30min) of deionized water configuration 50%, mix with the glycerine equal-volume of 500 μ l50% of sterilizing having cultivated 500 μ l bacterium liquid after 36h, after mixing, be put in preservation in-80 DEG C of refrigerators.By separation and purification from LB flat board to single bacterium colony be transferred in LB liquid medium, 28 DEG C, 200rpm, cultivate after 48h, carry out after smear, fixing, violet staining, under opticmicroscope oil lens head, carry out morphologic observation, microscopic examination picture as shown in Figure 1, turns out to be Bacillus thuringiensis bacterial strain.

The Bacillus thuringiensis bacterial strain that utilizes separation to kill Meloidogyne incognita obtains 16S rRNA gene, phylogenetic tree construction, specific implementation process: the Bacillus thuringiensis NBIN-863 bacterial strain activation culture of spending the night, 1%(V/V) inoculum size is seeded to fresh LB substratum (Sambrook et al., 1989), be cultured to OD ₆₀₀=0.6, centrifugal collecting cell, according to match Parkson resin type ^tMgenomic dna purification test kit working method is extracted genomic dna.Taking this genomic dna as template, adopt bacterial 16 S rRNA universal primer (16S-27f:AGAGTTTGATCCTGGCTCAG; 16S-1429R:GGTTACCTTGTTACGACTT) carry out pcr amplification.PCR reaction system is (25 μ l): 10 × amplification buffer is (containing Mg ²⁺1.5mM) 2.5 μ l, dNTP1 μ l, the each 1 μ l of primer, template DNA 1 μ l, Taq archaeal dna polymerase 0.2 μ l, adds deionized water and complements to 25 μ l; Pcr amplification condition: 94 DEG C of denaturation 2min, 94 DEG C of sex change 30s, 55 DEG C of annealing 1min, 72 DEG C are extended 1.5min, 25 circulations, 72 DEG C are extended 5min.The 16S rDNA of pcr amplification detects through agarose gel electrophoresis, adopt DNA purification kit to carry out purifying according to operation instructions, and be cloned on pMD19-T carrier, transform bacillus coli DH 5 alpha competent cell, choose positive colony, check order in Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

The 16S rDNA sequence that order-checking is obtained is carried out BLAST compare of analysis in GenBank, choose the bacillus 16S rDNA sequence that homology is close, utilize Clustal X v2.0 and MEGA5.1 software compare and design of graphics 2 shown in systematic evolution tree.

In sequence table, be to separate the Bacillus thuringiensis bacterial strain 16S rDNA sequence of killing Meloidogyne incognita, systematic evolution tree demonstration NBIN-863 and Bacillus thuringiensis L15 sibship are nearer, sequence homology is 100%, form a bunch of group, show that the bacterial strain being separated to soil belongs to kind of a Bacillus thuringiensis near Anhui Province's Jiuhuashan, further called after Bacillus thuringiensis NBIN-863, being submitted to the accession number obtaining in GenBank database is KF935650.

Meloidogyne incognita second instar larvae is carried out to biological assay, and result shows that Bacillus thuringiensis NBIN-863 bacterial strain has very high virulence to Meloidogyne incognita second instar larvae, processes after 24h, and Meloidogyne incognita mortality ratio has reached more than 80%.Fermented liquid is 0.1 μ g/ml to the LC50 value of root knot nematode, and supernatant liquor LC50 value is 0.6 μ g/ml, and precipitation LC50 value is 1.17 μ g/ml, as shown in Table 1.

The LC50 value of form 1 bacterial strain Bacillus thuringiensis NBIN-863 to Meloidogyne incognita second instar larvae

" the killing active substance and the application thereof of the Tribactur of Meloidogyne incognita " of applying on the same day the applicant, in file, mention: the active substance of the Tribactur of Meloidogyne incognita is the crystal protein gene cry9Aa-like that kills Meloidogyne incognita, be a kind of insecticidal crystal protein, molecular weight is 98kDa.Cry9Aa-like protein-coding region, by 2223 based compositions, has the nucleotide sequence shown in sequence table SEQ ID NO:1; Formed by 741 amino-acid residues, there is the aminoacid sequence shown in sequence table SEQ ID NO:1.Kill the bacillus active substance of Meloidogyne incognita for the biological control of Meloidogyne incognita.Nematicide crystallin Cry9Aa-like is 5.92 μ g/mL to Meloidogyne incognita toxic limit medium dose; Tomato root root knot quantity after filling with root greatly reduces, well developed root system, and prevention effect is 50%.

Claims (4)

1. one kind is killed the Tribactur of Meloidogyne incognita, it is characterized in that killing the Tribactur NBIN-863Bacillus thuringiensis NBIN-863 of Meloidogyne incognita, depositary institution: Chinese Typical Representative culture collection center, address: China, Wuhan, Wuhan University, preservation center numbering CCTCC NO:M2013612, November 27 2013 preservation day, survival November 29 2013 date.

2. a kind of Tribactur that kills Meloidogyne incognita according to claim 1, it is characterized in that killing the Bacillus thuringiensis bacterial strain form of Meloidogyne incognita: on flat board, single bacterium colony of growth is oyster white flakes, surface irregularity, under growth 24h Electronic Speculum, be viewed as shaft-like, after growth 36h for stain-fast brood cell with catch the rhomboidan of look; After growth 48h, supernatant liquor produces 6 kinds of albumen, and wherein 3 kinds is insecticidal crystal protein, is respectively Cry9Aa-like albumen (98kDa), Cry2Aa albumen (69kDa) and Cry1Ac albumen (130kDa).

3. a kind of Tribactur that kills Meloidogyne incognita according to claim 1, is characterized in that having the Meloidogyne incognita of killing activity.

4. the method for cultivating a kind of Tribactur that kills Meloidogyne incognita claimed in claim 1, is characterized in that concrete steps are as follows:

1) get near Anhui Province's Jiuhuashan, east longitude 117 is spent 29 points, and north latitude 30 is spent the pedotheque 1g of 39 points of positions, suspends, according to 10 at use for laboratory 1ml sterilized water ^-3, 10 ^-4, 10 ^-5, 10 ^-6concentration is diluted and is coated with flat board, and with being inverted and cultivating 24h in 28 DEG C of constant incubators of LB solid culture liquid, from flat board, picking list bacterium colony again dilutes and lines on LB flat board, under 28 DEG C of conditions, cultivates 24h;

LB solid culture liquid formula: peptone 10g, yeast powder 5g, sodium-chlor 10g, agar powder 20g, is dissolved in 1L distilled water, and 121 DEG C, 30min, moist heat sterilization;

2) single colony inoculation repeated isolation being purified to is in 5ml LB liquid nutrient medium shaking flask, and 28 DEG C, 200rpm, cultivates 36h,

Described LB liquid culture based formulas: peptone 10g, yeast powder 5g, sodium-chlor 10g, be dissolved in 1L distilled water, 121 DEG C, 30min, moist heat sterilization;

3) first configure glycerine with deionized water, 121 DEG C of moist heat sterilization 30min, water: glycerine volume ratio=1:1;

4) by step 2) cultivate 500 μ l bacterium liquid after 36h and mixed with the glycerine equal-volume of 500 μ l50% of sterilizing, after mixing, be put in preservation in-80 DEG C of refrigerators;

5) by separation and purification from LB flat board to single bacterium colony be transferred in LB liquid medium, 28 DEG C, 200rpm, cultivates after 48h, carry out after smear, fixing, violet staining, under opticmicroscope oil lens head, carrying out morphologic observation is Bacillus thuringiensis bacterial strain.

Images