CN103882039B - Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene - Google Patents
Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene Download PDFInfo
- Publication number
- CN103882039B CN103882039B CN201310435432.0A CN201310435432A CN103882039B CN 103882039 B CN103882039 B CN 103882039B CN 201310435432 A CN201310435432 A CN 201310435432A CN 103882039 B CN103882039 B CN 103882039B
- Authority
- CN
- China
- Prior art keywords
- mapk1
- duck
- gene
- primer
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention provides the fluorescent quantitative RT-PCR method detecting duck MAPK1 gene, belong to genetically engineered field.The present invention obtains the complete genome sequence of duck MAPK1 by the method for gene clone, and establishes the fluorescent quantitative RT-PCR method of MAPK1 gene expression dose in a kind of rapid detection duck body.Is duck MAPK1 gene order provided by the invention as SEQ? ID? shown in NO.1, for the fluorescence quantification PCR primer sequence of this gene of specific detection as SEQ? ID? shown in NO.3 and 4.The inventive method has accurate, highly sensitive, the high specificity of detection, and simple and rapid advantage has excellent detectivity, can be used for the effect of research duck MAPK1 in pathogenic course, has good using value.
Description
Technical field
The invention belongs to genetically engineered field, particularly, relate to the method that duck MAPK1 gene and fluorescent quantitation detect this gene.
Background technology
Mitogen activated protein kinase (mitogen-activatedproteinkinase, MAPK) be one of signal transduction system important in organism, participate in the various kinds of cell processes such as mediating growth, growth, division, differentiation, death and intercellular function be synchronous.In mammalian cell, ERK, JNK/SAPK, p38/RK and ERK5/BMK1 tetra-MAPK subtribes have been found and have cloned.These MAPK can activate by multiple inflammatory stimulus, and to the generation of inflammation, developed important regulating and controlling effect.After different MAPK subtribe is activated by its upstream kinases, regulate various kinds of cell physiological process by multiple substrates such as phosphorylation transcription factor, cytoskeleton related protein and enzymes, comprise inflammation, stress, Growth of Cells, growth, differentiation, death and function synchronization etc.MAPK subtribe member is the important way playing its physiological action to the kinase whose phosphorylation of downstream albumen.Mitogen-activated protein kinase 1 (MAPK1) is also called extracellular signal-regulated protein kinase (extracellularsignal-regulatedkinase2, ERK2), and its molecular weight is 42KDa.
Compare with Mammals with people, the research of bird MAPK1 relatively lags behind, and only reports about the part research of chicken MAPK1 at present.Duck MAPK1 gene has no report, is the effect of research duck MAPK1 in duck pathogenic process and its expression level in duck body, is badly in need of setting up a kind of quick, accurate, responsive detection method.Fluorescence quantitative RT-RCR has highly sensitive, high specificity, good stability, level of automation high, has now been widely used in the research field such as molecular biology and medical science, has played significant role.The method being used for fluorescence quantitative RT-RCR to detect duck MAPK1 gene at present have not been reported.
Summary of the invention
The object of the present invention is to provide the complete genome sequence of duck MAPK1 gene.
Another object of the present invention is to the fluorescent quantitative RT-PCR method that MAPK1 expression level in a kind of rapid detection duck body is provided.
For achieving the above object, the present invention adopts following technical scheme:
(1) according to the chicken MAPK1 gene order (accession number: NM_204150) that GenBank delivers, with PrimerPremier5.0 software design upstream primer MAPK1-AF and downstream primer MAPK1-AR(nucleotide sequence as shown in SEQIDNO.5 and SEQIDNO.6).Extract duck spleen total serum IgE, be made up of strand six aggressiveness with RandomPrimer(, the random combine of six bases, purchased from Promega company) be the primer of reverse transcription, take RNA as templated synthesis cDNA.Take cDNA as template, MAPK1-AF/MAPK1-AR is primer, pcr amplification MAPK1 gene.Amplified production is through agarose gel electrophoresis analysis, recovery.By the PCR primer reclaimed by connecting, transforming, extract positive colony order-checking, sequencing result and chicken MAPK1 sequence compare, the plasmid called after pMD18-MAPK1 checking order correct.
(2) use 3 ' fullRACEKit and 5 ' fullRACEKit, according to the requirement of RACE operation, the zone design 3 ' correct in order-checking is held and 5 ' end primer.Extract duck spleen total serum IgE, carry out 3 ' fullRACE experiment according to 3 ' fullRACEKit test kit specification sheets.With MAPK1-3GSP1(SEQIDNO.7) and 3 ' RACEOuterPrimer(SEQIDNO.9) carry out OuterPCR reaction, MAPK1-3GSP2(SEQIDNO.8) and 3 ' RACEInnerPrimer(SEQIDNO.10) carry out InnerPCR reaction.After reaction terminates, agarose gel electrophoresis, confirms pcr amplification product, recovery.The PCR primer reclaimed be connected with carrier, transform, choose doubtful positive colony and check order, sequencing result and chicken MAPK1 sequence compare, plasmid the called after 3 '-pMD18-MAPK1 checking order correct.
(3) extract duck spleen total serum IgE, carry out 5 ' fullRACE experiment according to 5 ' fullRACEKit test kit specification sheets.With MAPK1-5GSP1(SEQIDNO.11) and 5 ' RACEOuterPrimer(SEQIDNO.13) carry out OuterPCR reaction, MAPK1-5GSP2(SEQIDNO.12) and 5 ' RACEInnerPrimer(SEQIDNO.14) carry out InnerPCR reaction.After reaction terminates, agarose gel electrophoresis, confirms pcr amplification product, recovery.The PCR primer reclaimed be connected with pMD18-T, proceeded to by connection product in DH5 α competence, choose doubtful positive colony and check order, sequencing result and chicken MAPK1 sequence compare, plasmid the called after 5 '-pMD18-MAPK1 checking order correct.
(4) spliced by the sequencing result of pMD18-MAPK1,3 '-pMD18-MAPK1 and 5 '-pMD18-MAPK1 plasmid, obtain the complete genome sequence of duck MAPK1, its nucleotide sequence is as shown in SEQIDNO.1.
Therefore, the invention provides the method for clone duck MAPK1 gene, comprise the following steps:
(1) extract duck spleen total serum IgE, reverse transcription is cDNA; Take cDNA as template, MAPK1-AF and MAPK1-AR is primer, pcr amplification MAPK1 gene; Amplified production is connected with pMD18-T carrier after reclaiming, transform, extract positive colony checks order, and sequencing result and chicken MAPK1 sequence compare, the plasmid called after pMD18-MAPK1 checking order correct; The nucleotide sequence of upstream primer MAPK1-AF and downstream primer MAPK1-AR is as shown in SEQIDNO.5 and SEQIDNO.6;
(2) duck spleen total serum IgE is extracted, OuterPCR reaction is carried out with MAPK1-3GSP1 and 3 ' RACEOuterPrimer, MAPK1-3GSP2 and 3 ' RACEInnerPrimer carries out InnerPCR reaction, the PCR primer reclaimed is connected with pMD18-T carrier, transform, choose doubtful positive colony to check order, sequencing result and chicken MAPK1 sequence compare, plasmid the called after 3 '-pMD18-MAPK1 checking order correct; MAPK1-3GSP1 and MAPK1-3GSP2, nucleotide sequence is as shown in SEQIDNO.7 and 8, and 3 ' RACEOuterPrimer and 3 ' RACEInnerPrimer nucleotide sequence is as shown in SEQIDNO.9 and 10;
(3) duck spleen total serum IgE is extracted, with MAPK1-5GSP1(SEQIDNO.11) and 5 ' RACEOuterPrimer(SEQIDNO.13) carry out OuterPCR reaction, MAPK1-5GSP2(SEQIDNO.12) and 5 ' RACEInnerPrimer(SEQIDNO.14) carry out InnerPCR reaction, the PCR primer reclaimed is connected with pMD18-T, transform, choose doubtful positive colony to check order, sequencing result and chicken MAPK1 sequence compare, plasmid the called after 5 '-pMD18-MAPK1 checking order correct; MAPK1-5GSP1 and MAPK1-5GSP2, nucleotide sequence is as shown in SEQIDNO.11 and 12, and the nucleotide sequence of 5 ' RACEOuterPrimer and 5 ' RACEInnerPrimer is as shown in SEQIDNO.13 and 14;
(4) spliced by the sequencing result of pMD18-MAPK1,3 '-pMD18-MAPK1 and 5 '-pMD18-MAPK1 plasmid, obtain the complete genome sequence of duck MAPK1, its nucleotide sequence is as shown in SEQIDNO.1.In one embodiment of the invention, the spleen total serum IgE of cherry valley duck is extracted as experiment RNA.
The invention provides a kind of genetic marker for detecting duck MAPK1 gene, its nucleotide sequence has the sequence shown in SEQIDNO.2 or its specific fragment.
The invention provides the primer for the above-mentioned genetic marker that increases.
Primer for the above-mentioned genetic marker that increases provided by the invention, the nucleotide sequence of its upstream primer MAPK1-TR-F and downstream primer MAPK1-TR-R is respectively as shown in SEQIDNO.3 and 4.
Present invention also offers a kind of method detecting duck MAPK1 gene, by extracting duck total tissue RNA, reverse transcription obtains cDNA, with it for template, utilizes the primer shown in SEQIDNO.3 and 4 to carry out quantitative fluorescent PCR, according to amplification curve result of determination.
Further, the present invention detects the reaction system of the real-time fluorescence quantitative PCR of duck MAPK1 gene and is: the specific configuration of 20 μ L reaction systems is: 2 × Go
each 0.5 μ L, cDNA1 μ L, the stoning sour water 8 μ l of qPCRMasterMix10 μ L, upstream primer MAPK1-TR-F and downstream primer MAPK1-TR-R.
The response procedures of described real-time fluorescence quantitative PCR is: 95 DEG C of 10min; 95 DEG C of sex change 15s, 60 DEG C of annealing 1min, 40 circulations.
Test kit containing upstream primer MAPK1-TR-F and downstream primer MAPK1-TR-R also belongs to protection scope of the present invention.
Present invention also offers mentioned reagent box and detect the application in duck MAPK1 gene.
The present invention obtains duck MAPK1 gene and sequence thereof, belongs to pioneering in the world.For follow-up study duck MAPK1 gene and effect thereof provide foundation.Fluorescent quantitative RT-PCR method provided by the invention detects the specific sequence of duck MAPK1 gene, the method has accurate, highly sensitive, the high specificity of detection, simple and rapid advantage, there is excellent detectivity, can be used for the effect of research duck MAPK1 in pathogenic course, there is good using value.
Accompanying drawing explanation
Fig. 1 is duck MAPK1 partial sequence fragment clone.
Fig. 2 is that duck MAPK1 gene 3 ' fullRACE tests, and No. 1 swimming lane is 3 ' InnerPCR product.
Fig. 3 is that duck MAPK1 gene 5 ' fullRACE tests, and No. 1 swimming lane is 5 ' InnerPCR product.
Fig. 4 detects duck MAPK1mRNA annealing temperature for optimizing fluorescence quantitative RT-RCR.
Fig. 5 is the linear amplification curve of fluorescence quantitative RT-PCR primer specificity experiments.
Fig. 6 is fluorescence quantitative RT-RCR typical curve.
Fig. 7 is fluorescence quantitative RT-RCR specific test linear amplification curve.
Fig. 8 is fluorescence quantitative RT-RCR sensitivity test linear amplification curve.
Fig. 9 is the expression amount that fluorescence quantitative RT-RCR bacterial detection infects MAPK1mRNA in disease duck spleen tissue.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments are only not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, the usually conveniently conditioned disjunction condition of advising according to manufacturer.Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.The present invention's cherry valley duck used is purchased from test duck field, Jiangsu Province.
Mitogen activated protein kinase (MAPK1) gene clone of embodiment 1 duck and complete genome sequence measure
(1) according to the chicken MAPK1 gene order (accession number: NM_204150) that GenBank delivers, upstream primer and downstream primer with PrimerPremier5.0 software design amplification duck MAPK1 gene: be respectively MAPK1-AF:5 '-AAGTGTTCGACGTGGGG-3 ' (SEQIDNO.5); MAPK1-AR:5 '-TCCTTCGGCAAGTCATC-3 ' (SEQIDNO.6), goal gene size is about 973bp(SEQIDNO.15).
(2) gather the PBS that cherry valley duck spleen is placed in 10 times of volumes, carry out tissue homogenate with beater.Draw 200 μ L tissue homogenates and add TRIzolReagent1mL, extract cell total rna according to TRIzol method recommendation step, remove genomic pollution in RNA with DNase I, purity detecting and is quantitatively carried out to the RNA extracted.
(3) RandomPrimer(is adopted to be made up of strand six aggressiveness to the RNA removing genome pollution, the random combine of six bases, purchased from Promega company) as primer, the method provided with reference to MMLV ThermoScript II (Promega company) specification sheets carries out reverse transcription.Adopt 20 μ L reverse transcription reaction systems: total serum IgE 2 ~ 4 μ g, OligodT (25 μm of ol/L) 1 μ L, RandomPrimer (25 μm of ol/L) 1 μ L, M-MLV (200U/ μ L) 1 μ L, 5 × M-MLV damping fluid 5 μ L, dNTP (10mmol/L) 4 μ L, RRI (40U/ μ L) 1 μ L, finally adds without RNase water to 20 μ L.
(4) take cDNA as template, MAPK1-AF/MAPK1-AR is primer, pcr amplification MAPK1 gene, and reaction system is 20 μ L, reaction conditions:
Denaturation: 94 DEG C, 4min;
Major cycle: 94 DEG C, 40s; 50 DEG C, 40s; 72 DEG C, 90s; Cycle number: 30;
Rear extension: 72 DEG C, 10min;
PCR carries out on eppendorf thermal cycler.
Carry out PCR by above-mentioned condition, amplified production 1% agarose gel electrophoresis is identified, the results are shown in Figure 1.PCR primer is about 973bp, conforms to theoretical value size, and reclaim test kit with Thermo company glue and reclaim this fragment, operation is carried out to specifications.
The PCR primer reclaimed is connected with pMD18-Tsimple, connection product is proceeded in DH5 α competence, choose doubtful positive colony and check order, sequencing result 973bp(SEQIDNO.15).Use DNAstar software analysis with chicken MAPK1 sequence, homology 98.4%, determine that clone obtains duck MAPK1 partial sequence fragment, plasmid called after pMD18T-MAPK1.
(5) Takara company 3 ' fullRACEKit and 5 ' fullRACEKit is used, according to the requirement of RACE operation, at zone design 3 ' end upstream primer MAPK1-3GSP1 and MAPK1-3GSP2 that order-checking is correct, correspond respectively to test kit middle and lower reaches Auele Specific Primer 3 ' RACEOuterPrimer and 3 ' RACEInnerPrimer, product size is estimated to be about 500bp and 300bp respectively; 5 ' end downstream primer MAPK1-5GSP1 and MAPK1-5GSP2, corresponds respectively to upstream specific primer 5 ' RACEouterPrimer and 5 ' RACEInnerPrimer, and product size is estimated to be about 550bp and 350bp respectively.
MAPK1-3GSP1:5’TTCTAAGGGTTACACCAAGTC3’(SEQIDNO.7)
3’RACEOuterPrimer:5’TACCGTCGTTCCACTAGTGATTT3’(SEQIDNO.9)
MAPK1-3GSP2:5’CTATTTGCTTTCCCTACCAC3’(SEQIDNO.8)
3’RACEInnerPrimer:5’CGCGGATCCTCCACTAGTGATTTCACTATAGG3’(SEQIDNO.10)
MAPK1-5GSP1:5’GTGGTCGTTGCTGAGGTGTTGAG3’(SEQIDNO.11)
5’RACEouterPrimer:5’CATGGCTACATGCTGACAGCCTA3’(SEQIDNO.13)
MAPK1-5GSP2:5’CTGGCAGTACGTCTGATGCTCAA3’(SEQIDNO.12)
5’RACEInnerPrimer:5’CGCGGATCCACAGCCTACTGATGATCAGTCGATG3’(SEQIDNO.14)
(6) gather the PBS that cherry valley duck spleen is placed in 10 times of volumes, carry out tissue homogenate with beater.Draw 200 μ L tissue homogenates and add TRIzolReagent1mL, extract cell total rna according to TRIzol method recommendation step, remove genomic pollution in RNA with DNase I.The total serum IgE extracted is detected with 1% agarose gel electrophoresis.28srRNA and 18srRNA two band complete display in the RNA obtained, substantially without hangover, illustrates that the RNA that this experiment obtains is more complete, nothing degraded.Carry out purity detecting and quantitatively to the RNA extracted, result shows its A260/A280 ratio 1.928, and concentration is 1,244 μ g/mL, illustrates that the content of RNA and purity can meet follow-up test requirement.
(7) carry out 3 ' fullRACE experiment according to 3 ' fullRACEKit test kit specification sheets step, use MAPK1-3GSP1 and 3 ' RACEOuterPrimer to carry out OutPCR reaction.
Reaction conditions is:
Denaturation: 94 DEG C, 3min;
Major cycle: 94 DEG C, 30s; 55 DEG C, 30s; 72 DEG C, 60s; Cycle number: 20;
Rear extension: 72 DEG C, 10min;
Using above-mentioned OuterPCR reaction solution as template, MAPK1-3GSP2 and 3 ' RACEInnerPrimer is used to carry out InnerPCR reaction.
Reaction conditions is:
Denaturation: 94 DEG C, 3min;
Major cycle: 94 DEG C, 30s; 55 DEG C, 30s; 72 DEG C, 60s; Cycle number: 25;
Rear extension: 72 DEG C, 10min;
PCR carries out on eppendorf thermal cycler.
After reaction terminates, agarose gel electrophoresis, confirms pcr amplification product, recovery, the results are shown in Figure 2.No. 1 swimming lane is 3 ' InnerPCR product, and electrophoresis result is not single band, and analyzing reason is the connecting method that mRNA is different, and the gene of amplification is that multigene family member causes.Reclaim three bands from big to small respectively, the PCR primer reclaimed is connected with pMD18-Tsimple, connection product is proceeded in DH5 α competence, choose doubtful positive colony to check order, sequencing result and chicken MAPK1 sequence compare, homology is 97.7%, plasmid called after 3 '-pMD18-MAPK1.Sequencing result 693bp, sequence is shown in SEQIDNO.16, and wherein the sequence of 1-298bp is part ORF region.
8) 5 ' fullRACE experiment is carried out according to 5 ' fullRACEKit test kit specification sheets.
Mainly through following step:
A) dephosphorylation process is carried out to 5 ' phosphate group exposed in TotalRNA.
B) remove 5 ' cap sequence, retain a phosphoric acid group.
C) 5 ' RACEAdaptor connects.
D) reverse transcription reaction.
OuterPCR reaction is carried out according to MAPK1-5GSP1 and 5 ' RACEOuterPrimer.
A. reaction system:
B. reaction conditions:
Denaturation: 95 DEG C, 3min;
Major cycle: 95 DEG C, 30s; 60 DEG C, 30s; 72 DEG C, 60s; Cycle number: 25;
Rear extension: 72 DEG C, 10min;
Using above-mentioned OuterPCR reaction solution as template, MAPK1-5GSP2 and 5 ' RACEInnerPrimer carries out InnerPCR reaction.
A. reaction system:
B. reaction conditions:
Denaturation: 95 DEG C, 3min;
Major cycle: 95 DEG C, 40s; 65 DEG C, 40s; 72 DEG C, 60s; Cycle number: 30;
Rear extension: 72 DEG C, 10min;
After reaction terminates, amplified production agarose gel electrophoresis is carried out confirming and reclaiming, the results are shown in Figure 3.No. 1 swimming lane is 5 ' InnerPCR product.The PCR primer reclaimed be connected with pMD18-T, proceeded to by connection product in DH5 α competence, choose doubtful positive colony and check order, sequencing result and chicken MAPK1 sequence compare, plasmid the called after 5 '-pMD18-MAPK1 checking order correct.Sequencing sequence 277bp, is shown in shown in SEQIDNO.17, and the sequence wherein between 56-277bp is part ORF region.
9) sequencing result of pMD18-MAPK1,3 '-pMD18-MAPK1 and 5 '-pMD18-MAPK1 plasmid is spliced, obtain the complete genome sequence of duck MAPK1, length is 1,557bp, is respectively 85.4%, 84.5% and 97.3% with the homology of people, mouse and chicken MAPK1.Duck MAPK1 gene order (1557bp) is shown in shown in SEQIDNO.1.By carrying out sequence analysis and sequential analysis with chicken MAPK1 gene, determine that in duck MAPK1 gene order, 56-1,162bp are its ORF region.
The functional verification of MAPK1 in the ill duck of embodiment 2
Experimental group 1: injecting riemerella anatipestifer Yb2 strain bacterium liquid 0.5ml(bacteria containing amount to the healthy cherry valley duck of the experimental group (10) of 8 ages in days is 2 × 10
5cFU, 2LD
50, China Agriculture Academe Shanghai Veterinary Institute preserves.Method is shown in document king little Lan, Hu Qinghai, Han Xiangan etc., the screening of serum 2 type riemerella anatipestifer seedling bacterial strain and the development of oil-emulsion bacterin.China's zoonosis journal 2012,20 (1): 54-58), bring out Riemerella anatipestifer disease, show as acute sepsis, detect its spleen and lung MAPK1 expression level (testing 12 days).First day after infecting, MAPK1 expression level significantly raises; Within 3rd day, reach peak value, subsequently gradually decline (dead 1 of first day, the 3rd day dead one, its expression level is higher).
Experimental group 2: injecting riemerella anatipestifer Yb2 strain bacterium liquid 0.5ml(bacteria containing amount to the healthy cherry valley duck of the experimental group (10) of 8 ages in days is 2 × 10
5cFU, 2LD
50, China Agriculture Academe Shanghai Veterinary Institute preserves, and method is the same), bring out Riemerella anatipestifer disease, give 2 μm of ol/LSAHA(suberoylanilidehydroxamicacid simultaneously) process, this reagent is MAPK1 blocker; Detect its spleen and lung MAPK1 expression level.Result display infect after 1-3 days, MAPK1 expression level slightly raise, but compared with non-seeded control group duck no significant difference, without duck death.Result shows, after giving blocker, MAPK signal path is subject to obvious suppression.
Experimental group 3: injecting riemerella anatipestifer Yb2 strain bacterium liquid 0.5ml(bacteria containing amount to the healthy cherry valley duck of the experimental group (10) of 8 ages in days is 2 × 10
5cFU, 2LD
50, China Agriculture Academe Shanghai Veterinary Institute preserves, and infection method is the same), bring out Riemerella anatipestifer disease, within the 1st day, give 2 μm of ol/LSAHA process in infection, this reagent is MAPK1 blocker simultaneously; And the albumen 1ml(of the duck MAPK1 genes encoding obtained in infection the 2nd day intramuscular injection embodiment of the present invention 1 is by conventional gene engineering method, the full genome obtaining duck MAPK1 is carried out abduction delivering, obtain duck MAPK1 albumen, after ni-sepharose purification, concentration is 1.085ng/ml, and molecular weight is about 42KD).Detect its spleen and lung MAPK1 expression level.Result display infect after the 4th day, MAPK1 expression level raises, no significant difference compared with the duck of experimental group 1, and 1-2 days are dead without duck, the 3rd day dead 1, the 4th day dead 1.Result shows, after giving blocker, MAPK signal path is subject to obvious suppression, after the albumen that the duck MAPK1 genetic expression again giving the embodiment of the present invention 1 obtains, MAPK signal path is started, and illustrates that duck MAPK1 gene that the embodiment of the present invention 1 obtains has the intracellular signaling in inflammation generating process and adjusting function that MAPK1 gene possesses.
Control group (10): the healthy duck of 8 ages in days, detect its spleen and lung MAPK1 expression level, expression level is starkly lower than ill duck, and its numerical value is close to the experimental group numerical value of the 12nd day.
By order-checking, find the MAPK1 gene order that experimental group 1 expression level raises and the gene order (the 550bp-762bp position of ORF, size is 213bp) that the embodiment of the present invention 1 obtains unanimously, homogeny reaches 100%.
Known MAPK1 has very many functions, such as prior art report MAPK1 passage is very effective in the damage preventing heart from inducing at ischemia-reperfusion, there is good prospect, in addition, MAPK1 passage is in stress reaction, also very important effect is served in antiinflammatory processes, be expected in many animal epidemics even other application by blocking or activate this process thus playing therapeutic action, the present embodiment is by the application of an aspect, confirm this point, but certainly the function of MAPK1 is not limited to these that prior art reported, greater functionality will be had to be proved, and be applied in the near future in industry.
Embodiment 3 fluorescence quantitative RT-RCR detects the foundation of duck MAPK1 method
(1) design of fluorescence quantifying PCR method primer.The duck MAPK1 gene order obtained is cloned with reference to embodiment 1, select the sequence of wherein one section of high conservative as target sequence, synthesize pair of primers MAPK1-RT-F:5 '-CCAGACCATGATCACACAGG-3 ' (SEQIDNO.3) by PrimeExpress3.0 software design; MAPK1-RT-R:5 '-GGATCCAAGTATGCCAAGGA-3 ' (SEQIDNO.4), object fragment is positioned at the 550bp-762bp position of duck MAPK1 gene ORF, and size is shown in 213bp(SEQIDNO.2).
(2) preparation of positive criteria product.Extract duck spleen total serum IgE according to TRIzolReagent specification sheets, remove genome pollution, use Takara company
rTMasterMix carries out reverse transcription.
A) reaction system is:
B) reverse transcription reaction condition: 37 DEG C, 15min; 85 DEG C, 5s; 4 DEG C
Using the cDNA that records of reversing as template, with MAPK1-RT-F, MAPK1-RT-R for primer, regular-PCR amplification MAPK1.After reaction terminates, get 10 μ LPCR product 1% agarose gel electrophoresis and identify, amplified production is the fragment that a size is about 213bp, and feminine gender, then without amplification, reclaims object band.Be connected with pMD18-Tsimple carrier after purifying, connection product proceeded in DH5 α competence, order-checking qualification.The bacterium liquid correct to qualification result extracts plasmid DNA as positive criteria product, and-40 DEG C save backup.
(3) optimization of fluorescence quantitative RT-RCR reaction conditions.Respectively the reaction annealing temperature of fluorescence quantitative RT-PCR detecting method is optimized, quantitative real time PCR Instrument sets annealing temperature gradient scope 55 DEG C to 65 DEG C, according to reaction amplification curve and CT value size determination optimum reaction condition be: 95 DEG C, 10min; 95 DEG C, 15s; 60 DEG C, 1min, 40 circulations, after total elongation terminates, add melt curve analysis analytical procedure, see Fig. 4.
(4) use the cherry valley duck spleen total serum IgE extracted to carry out reverse transcription, the cDNA recorded reversing, as template, with MAPK1-RT-F, MAPK1-RT-R for primer carries out quantitative fluorescent PCR, is used as negative control using deionized water as template.As Fig. 5, solubility curve display has single peak value, and show in the present invention, this primer specificity is strong.
A) reaction system:
B) reaction conditions: by the conditioned response of above-mentioned optimization.
(5) measure the concentration of plasmid and the ratio of A260/280 thereof, the ratio of A260/280 can be used for Criterion curve at the plasmid of 1.8-2.0, detects the ratio of plasmid A260/280 and the concentration of plasmid.Plasmid pMD18-MAPK1 is made 10 times of doubling dilutions, get 6 dilution plasmids continuously and be used as template, each extent of dilution does 3 repetitions, and utilization carries analysis software and calculates typical curve, the results are shown in Figure 6.Typical curve efficiency value is 0.85, and its slope is-3.730, and intercept is 16.17, and relation conefficient is 0.996.
(6) specific test: according to present patent application embodiment 3(2) the middle method described TRIzolReagent extraction duck spleen total serum IgE, use Takara company after removing genome pollution
rTMasterMix carries out reverse transcription.The cDNA recorded with reversing is as template, respectively with IL2-F/IL2-R primer pair (5'-ATGGCACCTCTATCAGAGAAAG-3'/5'-TTATTTTAGCATAGATCTCAGG-3'), IL-1 β-F/IL-1 β-R primer pair (5'-GAGGAGCAGGGACTTTGCTGA-3'/5'-CTTGTAGGTGGCGATGTTGAC-3') and IFN γ-F/IFN γ-R primer pair (5 '-ATGACTTGCCAGACCTACTGCTTGT-3 '/5 '-TTAACATCTGCATCTCTTTGGAGAC-3 ') carry out pcr amplification DuIL-2 (gene accession number: DQ666278.1), duck IL-1 β (gene accession number: DQ393268.1) and DuIFN-γ (gene accession number: AJ012254.1) gene.After reaction terminates, get 10 μ LPCR product 1% agarose gel electrophoresis and identify, amplified production is respectively a size and is about 363bp, the fragment of 571bp and 495bp, and feminine gender, then without amplification, reclaims object band.Be connected with pMD18-Tsimple carrier after purifying, connection product proceeded in DH5 α competence, DuIL-2, duck IL-1 β and DuIFN-γ plasmid that order-checking qualification builds.With the DuIL-2 of purifying, duck IL-1 β and DuIFN-γ plasmid as template, with MAPK1-RT-F, MAPK1-RT-R for primer carries out the specific test of quantitative fluorescent PCR, be used as positive control using MAPK1 plasmid as template, deionized water is used as negative control as template.The results are shown in Figure 7, the single peak value of solubility curve display MAPK1 plasmid, to DuIL-2, IL-1 β and IFN-γ plasmid template and deionized water have no amplification peak value, show detection system high specificity of the present invention.
(7) sensitivity test: by recombinant plasmid through 10 times of doubling dilutions, and with it for template, carry out fluorescent quantitative PCR with MAPK1-RT-F, MAPK1-RT-R for primer, establish negative control simultaneously.Result criterion is: have amplification curve and CT value < 35 is judged to be the positive.The present invention is diluted to 10 to template
3still can obtain specific amplification after individual copy number/μ L, and there is good amplification curve, see Fig. 8.
(8) replica test: repetition and the interior revision test of group between 3 groups are done respectively to duck MAPK1 with fluorescence quantitative RT-RCR.The variation coefficient is calculated according to CT arithmetical av.Result show group in and between-group variation coefficient all below 5%, show that detection system of the present invention is stablized, there is good repeatability, in table 1.
Table 1 fluorescence quantitative RT-RCR replica test
Embodiment 4 fluorescence quantitative RT-RCR bacterial detection infects the expression amount of MAPK1mRNA in disease duck spleen tissue
1) 6 healthy cherry valley ducks of 15 ages in days are divided into 2 groups at random, are respectively bacterial infections and Normal group, often organize 3, and isolated rearing is in experiment fowl cage.Bacterial infections duck every leg muscle injection riemerella anatipestifer Yb2 Jun Ye 0.5mL(China Agriculture Academe Shanghai Veterinary Institute preserves, method is shown in document king little Lan, Hu Qinghai, Han Xiangan etc., the screening of serum 2 type riemerella anatipestifer seedling bacterial strain and the development of oil-emulsion bacterin. Chinese zoonosis journal 2012,20 (1): 54-58), bacteria containing amount is 1.07 × 10
6cFU(10LD
50); Normal group duck every leg muscle injection PBS0.5mL in contrast.
2) get infected group and control group duck spleen respectively at 6h, 12h, 24h and 48h after infection, extract total serum IgE according to TRIzolReagent specification sheets, after removing genome pollution, use Takara company
rTMasterMix carries out reverse transcription.Reaction system and reaction conditions perform by embodiment 3.
3) basic protein (Arbp) gene is correlated with as reference gene with duck apoptosis, take MAPK1-RT-F/MAPK1-RT-R as primer, carry out detection by quantitative to the MAPK1mRNA relative expression quantity in 6h, 12h, 24h and 48h spleen tissue after bacteriological infection, control group duck is got spleen simultaneously and carries out MAPK1mRNA mensuration.The fluorescent quantitative RT-PCR method that reaction system and reaction conditions are set up by embodiment 2.The Auele Specific Primer Arbp-RT-F of design duck Arbp gene (5 '-CGACCTGGAAGTCCAACTAC-3 ') and Arbp-RT-R(5 '-ATCTGCTGCATCTGCTTG-3 ') for this test.Gene expression analysis adopts 2
-△ △ CTmethod.
4) result to show to infect in pest of duck 6h, 12h, 24h and 48h after Mo Shi bacillus, and in duck spleen tissue, MAPK1mRNA relative expression quantity raises 224 times, 604 times, 480 times and 449 times respectively, and with control group significant difference, P < 0.01, is shown in Fig. 9.
Scope of the present invention is not by the restriction of described specific embodiments, and described embodiment, only as the single example of illustrating all respects of the present invention, also comprises method and the component of functional equivalent in the scope of the invention.In fact, except content as herein described, those skilled in the art can easily grasp multiple improvement of the present invention with reference to description above and accompanying drawing.Described improvement also falls within the scope of appended claims.
Claims (6)
1. for the primer of the genetic marker of augmentation detection duck MAPK1 gene, it is characterized in that, the nucleotide sequence of its upstream primer MAPK1-TR-F and downstream primer MAPK1-TR-R is respectively as shown in SEQIDNO.3 and 4, and the nucleotide sequence of described genetic marker has the sequence shown in SEQIDNO.2.
2. detect a method for duck MAPK1 gene, it is characterized in that, extract duck total tissue RNA, reverse transcription obtains cDNA, with it for template, utilizes the primer shown in SEQIDNO.3 and 4 to carry out quantitative fluorescent PCR, according to amplification curve result of determination.
3. the method detecting duck MAPK1 gene as claimed in claim 2, it is characterized in that, the reaction system of quantitative fluorescent PCR is: the specific configuration of 20 μ L reaction systems is: 2 × Go
qPCRMasterMix10 μ L, each 0.5 μ L, cDNA1 μ L, the stoning sour water 8 μ l of primer shown in primer and SEQIDNO.4 shown in SEQIDNO.3.
4. according to the method in claim 2 or 3, it is characterized in that, the response procedures of described quantitative fluorescent PCR is: 95 DEG C of 10min; 95 DEG C of sex change 15s, 60 DEG C of annealing 1min, 40 circulations.
5. the test kit containing primer described in claim 1.
6. test kit according to claim 5 is detecting the application in duck MAPK1 gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310435432.0A CN103882039B (en) | 2013-09-23 | 2013-09-23 | Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310435432.0A CN103882039B (en) | 2013-09-23 | 2013-09-23 | Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103882039A CN103882039A (en) | 2014-06-25 |
CN103882039B true CN103882039B (en) | 2016-04-20 |
Family
ID=50951162
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310435432.0A Active CN103882039B (en) | 2013-09-23 | 2013-09-23 | Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103882039B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6033910A (en) * | 1999-07-19 | 2000-03-07 | Isis Pharmaceuticals Inc. | Antisense inhibition of MAP kinase kinase 6 expression |
WO2009063249A2 (en) * | 2007-11-16 | 2009-05-22 | Secretary Of State For Defence | Early detection of sepsis |
US20100092961A1 (en) * | 2008-07-25 | 2010-04-15 | The Cleveland Clinic Foundation | Methods and compositions for detection of Cowden Syndrome (CS) and CS-like syndrome |
-
2013
- 2013-09-23 CN CN201310435432.0A patent/CN103882039B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6033910A (en) * | 1999-07-19 | 2000-03-07 | Isis Pharmaceuticals Inc. | Antisense inhibition of MAP kinase kinase 6 expression |
WO2009063249A2 (en) * | 2007-11-16 | 2009-05-22 | Secretary Of State For Defence | Early detection of sepsis |
US20100092961A1 (en) * | 2008-07-25 | 2010-04-15 | The Cleveland Clinic Foundation | Methods and compositions for detection of Cowden Syndrome (CS) and CS-like syndrome |
Non-Patent Citations (6)
Title |
---|
Mitogen-activated protein kinase-signaling stimulates Müller glia to proliferate in acutely damaged chicken retina;Andy J. Fischer等;《Glia》;20090115;第57卷(第2期);166-181 * |
Molecular cloning and in silico analysis of the duck (Anas platyrhynchos) MEF2A gene cDNA and its expression profile in muscle tissues during fetal development;Hehe Liu等;《Genetics and Molecular Biology》;20121231;第35卷(第1期);182-190 * |
Molecular cloning of the duck mitogen-activated protein kinase 1 (MAPK1) gene and the development of a quantitative real-time PCR assay to detect its expression;Shoulin Cao等;《POULTRY SCIENCE》;20141231;2158-2167 * |
The duck genome and transcriptome provide insight into an avian influenza virus reservoir species;Yinhua Huang等;《Nature Genetics》;20130731;第45卷(第7期);776-784 * |
XM_005021178.1;NCBI Reference Sequence;《GenBank》;20130626;核酸序列和氨基酸序列 * |
鸭MAPK1蛋白的原核表达和单克隆抗体的制备;曹守林 等;《中国兽医科学》;20141231;第44卷(第11期);1150-1155 * |
Also Published As
Publication number | Publication date |
---|---|
CN103882039A (en) | 2014-06-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ecco et al. | In vivo transcriptional cytokine responses and association with clinical and pathological outcomes in chickens infected with different Newcastle disease virus isolates using formalin-fixed paraffin-embedded samples | |
Withanage et al. | Rapid expression of chemokines and proinflammatory cytokines in newly hatched chickens infected with Salmonella enterica serovar typhimurium | |
Ioannidis et al. | Plasticity and virus specificity of the airway epithelial cell immune response during respiratory virus infection | |
Liu et al. | The different expression of immune-related cytokine genes in response to velogenic and lentogenic Newcastle disease viruses infection in chicken peripheral blood | |
CN105132589B (en) | A kind of the PCR-RFLP primers and method of difference 1 type of duck hepatitis virus and new serotype | |
CN104531867B (en) | Clostridium perfringens enterotoxin positive bacteria double fluorescent quantitative PCR quick detection kit | |
CN103131784A (en) | Multiple PCR (polymerase chain reaction) method for identifying salmonella enteritidis, salmonella typhimurium, salmonella pullorum and salmonella gallinarum | |
CN104694533A (en) | Non-coding RNA (ribonucleic acid) of salmonella as well as identification and application of non-coding RNA | |
Vinkler et al. | Differing house finch cytokine expression responses to original and evolved isolates of Mycoplasma gallisepticum | |
Zhang et al. | Effects of intranasal pseudorabies virus AH02LA infection on microbial community and immune status in the ileum and colon of piglets | |
CN103882039B (en) | Detect the fluorescent quantitative RT-PCR method of duck MAPK1 gene | |
CN103667271B (en) | The primer of detection by quantitative Candida albicans bacterium and probe and application thereof | |
CN106048070A (en) | Quantitative detection kit for lily WRKY33 gene and detection method thereof | |
CN104946645A (en) | Specific primers for amplifying plecoptera insect mitochondrion COI (cytochrome c oxidase I) gene | |
Duong et al. | Assessing potential pathogenicity of novel highly pathogenic avian influenza (H5N6) viruses isolated from Mongolian wild duck feces using a mouse model | |
CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
CN103805720B (en) | H9 subtype avian influenza virus and avian pneumovirus duplex RT-PCR test kit and application thereof | |
Girard-Misguich et al. | Porcine colon explants in the study of innate immune response to Entamoeba histolytica | |
CN105695629A (en) | Primers and method for identifying genotype I and genotype II DRVs (duck reoviruses) | |
Cheng et al. | Effects of Huangqi Maxingshigan decoction on infectious laryngotracheitis in chickens | |
CN107299154A (en) | A kind of sheep Theileria luwenshuni and Anaplasma phagocytophilum double PCR primer special and dual PCR detection method | |
CN103642940B (en) | Detection method for antigen serotype of pentavalent rotavirus vaccine | |
CN101363064B (en) | Standard substance for detecting influenza a virus load and detection method thereof | |
Abd-Ellatieff et al. | Th1 and Th2 cytokines activity during transformation and lymphoma formation stage in chicken naturally infected with Marek’s disease virus | |
CN110468216A (en) | Digital pcr detects the primer and probe of long oyster interleukins 17-5 gene expression amount |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |