CN103834744B - The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things - Google Patents
The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things Download PDFInfo
- Publication number
- CN103834744B CN103834744B CN201410119217.4A CN201410119217A CN103834744B CN 103834744 B CN103834744 B CN 103834744B CN 201410119217 A CN201410119217 A CN 201410119217A CN 103834744 B CN103834744 B CN 103834744B
- Authority
- CN
- China
- Prior art keywords
- clostridium
- methanobacteria
- acid bacteria
- milk
- genus bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/06—Quantitative determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to technical field of bioengineering, be specifically related to the quantitative analysis method of storing clostridium, milk-acid bacteria, genus bacillus, methanobacteria in mud.The technical problem to be solved in the present invention is in the mud of analysis cellar for storing things, clostridium, milk-acid bacteria, genus bacillus, methanobacteria provide a kind of new selection.Technical scheme of the present invention is the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, comprises the steps: the preparation of a, typical curve; B, extraction genomic dna; C, amplification; D, quantitative analysis.The inventive method can be used for analyzing the variation tendency of the clostridium of storing in mud, milk-acid bacteria, genus bacillus, methanobacteria.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to the quantitative analysis method of storing clostridium, milk-acid bacteria, genus bacillus, methanobacteria in mud.
Background technology
Jiao Chi is in liquor production process, the multiple wine brewing containers reacting on one such as collection saccharification, wine, esterification.As the saying goes " always storing out good wine ", in liquor production practice, often find the poor unstrained spirits near the end, cellar for storing things, Jiao Bi, the strong fragrance of its wine, its basic reason is to store the metabolism with raw fragrant relevant functional flora in mud.The carrier of Jiao Chi inherently multiple-microorganism, carries out along with fermentation is long-continued, and the functional microorganism in the mud of cellar for storing things is constantly tamed and enrichment, finally forms its distinctive microflora.Therefore, the kind of Jiao Nizhong microflora and quantity are formed with important impact to liquor flavor material.Investigator adopts the methods such as tradition cultivation and modern molecular biology technique, biological community structure in the mud of cellar for storing things is analyzed and studied, find that clostridium (Clostridium), milk-acid bacteria (Lactobacillus), genus bacillus (Bacillus), methanobacteria (Methanobacterium) etc. are the major function microorganism species in the mud of cellar for storing things, but functional microorganism majority is anaerobion in the mud of cellar for storing things, and not easily pure culture, can not accurately to the detection that the functional microorganism in the mud of cellar for storing things carries out.Therefore, illustrate the changing conditions of the biomass of the functional microorganism such as clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, the exploitation of artificial distiller's yeast, the cellar for storing things quality control of mud and the formation of liquor flavor material are all had great importance.
At present the screening of Selective agar medium and the method for isolation of pure culture counting are still adopted to microorganism detection by quantitative in the mud of cellar for storing things, be vulnerable to outside environmental elements, the impacts such as strain properties, detected result deficient in stability and reliability, and time and effort consuming.Fluorescent quantitative PCR technique refers to and add fluorophor in PCR reaction system, utilizes the whole PCR process of fluorescent signal accumulation Real-Time Monitoring, carries out quantitative analysis finally by typical curve to unknown template.This technology not only achieves the quantitative of DNA profiling, and have high specificity, highly sensitive, high-throughput, reaction totally-enclosed, quantitatively accurately, the fast and level of automation advantages of higher of speed, become quantivative approach important in molecular biology and microorganism field.
Summary of the invention
The technical problem to be solved in the present invention is in the mud of analysis cellar for storing things, clostridium, milk-acid bacteria, genus bacillus, methanobacteria provide a kind of new selection.
Technical scheme of the present invention is the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, comprises the steps:
The preparation of a, typical curve: the Auele Specific Primer designing the normal bacterial for clostridium, milk-acid bacteria, genus bacillus and methanobacteria, then carries out quantitative fluorescent PCR, according to the typical curve that copy number and CT value build;
B, extract genomic dna: utilize wash-out, method that enzymic digestion combines extracts the grand genome of Jiao Ni microflora;
C, amplification: the Auele Specific Primer adopting clostridium, milk-acid bacteria, genus bacillus and methanobacteria, increase to the specific fragment of clostridium in the grand genome of cellar for storing things mud microorganism, milk-acid bacteria, genus bacillus and methanobacteria;
D, quantitative analysis: quantitative analysis is carried out to clostridium, milk-acid bacteria, genus bacillus and methanobacteria in Jiao Ni microflora by the CT value of typical curve and testing sample.
Concrete, the Auele Specific Primer of clostridium of increasing in step a and c is as shown in SEQIDNo.1 and SEQIDNo.2.
Concrete, the Auele Specific Primer of milk-acid bacteria of increasing in step a and c is as shown in SEQIDNo.3 and SEQIDNo.4.
Concrete, the Auele Specific Primer of genus bacillus of increasing in step a and c is as shown in SEQIDNo.5 and SEQIDNo.6.
Concrete, the Auele Specific Primer of the methanobacteria that increases in step a and c is as shown in SEQIDNo.7 and SEQIDNo.8.
Clostridium specific primer sequence (5 ' → 3 '):
Clost-F：AAAGGRAGATTAATACCGCATAA（SEQIDNo.1）；
Clost-R：TTCTTCCTAATCTCTACGCA（SEQIDNo.2）。
Milk-acid bacteria specific primer sequence (5 ' → 3 '):
Lacto-F：AGAACACCAGTGGCGAAGG（SEQIDNo.3）；
Lacto-R：CAGGCGGAGTGCTTAATGC（SEQIDNo.4）。
Genus bacillus specific primer sequence (5 ' → 3 '):
Bacil-F：ATGGCTGTCGTCAGCT（SEQIDNo.5）；
Bacil-R：ACGGGCGGTGTGTAC（SEQIDNo.6）。
Methanobacteria specific primer sequence (5 ' → 3 '):
Metha-F：GGTGGTGTMGGATTCACACARTAYGCWACAGC（SEQIDNo.7）；
Metha-R：TTCATTGCRTAGTTWGGRTAGTT（SEQIDNo.8）。
R in above-mentioned primer is A or G; W is A or T; M is A or C; Y is T or C.
Concrete, the operation of step a is as follows: the 1 strain clostridium (Clostridiumbutyricum) that extraction separation and purification obtains from Jiao Ni microflora, 1 strains of lactic acid bacteria (Lactobacilluscrustorum), 1 bacillus (Bacillusamyloliquefaciens), the genome of 1 strain methanobacteria (Methanobacteriumbryantii), then utilize Auele Specific Primer to carry out PCR respectively and obtain specificity object fragment, again object fragment is connected with TA cloning vector, obtain recombinant plasmid, again by recombinant plasmid transformed competent escherichia coli cell, select positive colony transformant, extraction obtains high density plasmid, so this high density plasmid is done 10 doubling dilutions, as the standard model of quantitative fluorescent PCR, thus carry out quantitative fluorescent PCR acquisition typical curve.
Concrete, the PCR response procedures of the clostridium specificity that increases in step a and c object fragment is: after 95 DEG C of denaturation 4min, enters 30 circulations, 95 DEG C of 1min; 57 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min; The PCR response procedures of amplification milk-acid bacteria, genus bacillus and methanobacteria specificity object fragment is: after 95 DEG C of denaturation 4min, enter 30 circulations, 95 DEG C of 1min; 55 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min.
Concrete, the concrete operations of the method that the wash-out described in step b, enzymic digestion combine are as follows: take 1g and store mud sample in 50mL centrifuge tube, 5mLPBS pH of buffer 7.64 and 8 ~ 9 sterilizing granulated glass spherees are added to centrifuge tube, whirlpool concussion 5min, the centrifugal 5min of 200 × g, at Aspirate supernatant on ice; In precipitation, add 5mLPBS damping fluid repeated washing twice, merge three supernatant liquors, the centrifugal 5min of 12000rpm, gets precipitation; Add 1mLCTAB extract (Tris-HCl, 0.5mol/LEDTA of 2%CTAB, 5mol/LNaCl, 1mol/LpH8.0) and 20 μ L mercaptoethanols in centrifuge tube, 65 DEG C of constant temperature blending instrument vibration 30min, add 5 μ L20mg/mL proteolytic enzyme k, 37 DEG C of 220r/min30min, the centrifugal 10min of room temperature 6000 × g, collects 1mL supernatant; Add the saturated phenol-chloroform-primary isoamyl alcohol of equal-volume Tris-, once, the centrifugal 10min of 12000rpm, gets supernatant and adds the centrifugal 10min of equal-volume chloroform-isoamyl alcohol 12000rpm, get supernatant, repeat twice in extracting; Supernatant liquor adds the Virahol of 0.6 times of volume precooling, and-20 DEG C of centrifugal 10min of precipitation 1h, 12000rpm, outwell liquid; Precipitation uses 70% washing with alcohol, the centrifugal 10min of 12000r/min; DNA after washing dries up rear TE and dissolves, and-20 DEG C of Refrigerator stores are for subsequent use; Wherein said CTAB extract formula is Tris-HCl, 0.5mol/LEDTA of 2%CTAB, 5mol/LNaCl, 1mol/LpH8.0; Volume ratio 25 ︰ 24 ︰ 1 of the saturated phenol-chloroform-primary isoamyl alcohol of Tris-; Volume ratio 24 ︰ 1 of chloroform-isoamyl alcohol.
The present invention is simple to operate, can carry out quantitative analysis, sensitivity and reproducible to the microorganism in the mud of cellar for storing things.Adopt clostridium, milk-acid bacteria, genus bacillus, methanobacteria Auele Specific Primer and fluorescent quantitative PCR technique, set up gradual change, store the quantitative detecting method of major function microorganism in mud fast and accurately, the trace routine of functional microorganism in the mud of cellar for storing things can be simplified, improve detection efficiency, strengthen the monitoring to major microorganisms in the mud of cellar for storing things, for the formation mechenism of liquor fermentation process flavor substances provides technical support.Successful utilization of the present invention fluorescent quantitative PCR technique carries out quantitative analysis to the major microorganisms-clostridium in the mud of cellar for storing things, milk-acid bacteria, genus bacillus, methanobacteria, and the biomass obtaining 4 quasi-microorganisms to store the change in mud age at difference cellar for storing things.
Accompanying drawing explanation
The change curve of clostridium copy number in mud is stored at Fig. 1 difference cellar for storing things age
The change curve of milk-acid bacteria copy number in mud is stored at Fig. 2 difference cellar for storing things age
The change curve of genus bacillus copy number in mud is stored at Fig. 3 difference cellar for storing things age
The changing conditions of methanobacteria copy number in mud is stored at Fig. 4 difference cellar for storing things age
In Fig. 1 ~ 4, transverse axis represents that cellar for storing things mud stores age
Embodiment
In the present invention, quantitative fluorescent PCR adopts Bio-Rad special quantitative PCR reagent SsoFastEvaGreen premixed liquid, and this premixed liquid uses the Sso7d fusion protein technology of patent, in quantitative PCR application widely, have remarkable performance.Combined the damping fluid and ROX inertia reference dyestuff optimized by novel warm start engineered fusion polysaccharase, repeatability can be obtained at short notice better, the quantitative PCR result that sensitivity is higher.Saturated fluorescence dye EvaGreen effectively can strengthen its intensity be combined with double-stranded DNA and reaction sensitivity, ensure that best amplification efficiency, susceptibility and repeatability, and fluorescence intensity is higher compared to SYBRGreen simultaneously.
The preparation of embodiment 1 typical curve
1, synthesize the special primer for clostridium, milk-acid bacteria, genus bacillus and methanobacteria, and specific amplification is carried out to the clostridium of screening, milk-acid bacteria, genus bacillus and methanobacteria
Clostridium specific primer sequence (5 ' → 3 '):
Clost-F：AAAGGRAGATTAATACCGCATAA；
Clost-R：TTCTTCCTAATCTCTACGCA。
Milk-acid bacteria specific primer sequence (5 ' → 3 '):
Lacto-F：AGAACACCAGTGGCGAAGG；
Lacto-R：CAGGCGGAGTGCTTAATGC。
Genus bacillus specific primer sequence (5 ' → 3 '):
Bacil-F：ATGGCTGTCGTCAGCT；
Bacil-R：ACGGGCGGTGTGTAC。
Methanobacteria specific primer sequence (5 ' → 3 '):
Metha-F：GGTGGTGTMGGATTCACACARTAYGCWACAGC；
Metha-R：TTCATTGCRTAGTTWGGRTAGTT。
R in above-mentioned primer is A or G; W is A or T; M is A or C; Y is T or C.
2, clostridium, milk-acid bacteria, genus bacillus and the screening of methanobacteria and the determination of reference culture in mud is stored
The screening of a, clostridium:
Clostridium screening culture medium: ammonium sulfate 0.05%w/w, sodium acetate 0.5%w/w, dipotassium hydrogen phosphate 0.04%w/w, magnesium sulfate 0.02%w/w, yeast extract paste 0.1%w/w, agar 1.5%w/w, 121 DEG C, 30min sterilizing, ethanol 2%(v/v), sterilizing CaCO
3solution 2%v/v, ethanol, calcium carbonate all after sterilization, is cooled to about 70 DEG C and adds.
Get 1g cellar for storing things mud sample and make bacteria suspension, 80 DEG C of water-bath 10min, gradient dilution to 10
-3, dilution spread, 37 DEG C of Anaerobic culturel 72h, select the bacterium colony producing molten calcium circle, separating for several times purifying, microscopy obtains purebred, and 16SrDNA identifies ,-20 DEG C of glycerine pipes are preserved.
The screening of b, milk-acid bacteria:
The screening culture medium of milk-acid bacteria: glucose 2%w/w, peptone 1%w/w, extractum carnis 1%w/w, yeast extract 0.5%w/w, K
2hPO
40.2%w/w, Triammonium citrate 0.2%w/w, sodium acetate 0.5%w/w, tween 80 0.1%v/v, MgSO
47H
2o0.05%w/w, MnSO
44H
2o0.025%w/w, pH6.2 ~ 6.4, agar 1.5%w/w, is cooled to the CaCO that about 70 DEG C add sterilizing by 121 DEG C after 20min sterilizing
3solution 2%v/v.
Get 1g cellar for storing things mud sample gradient and be diluted to 10
-6, dilution spread, cultivate 48h for 37 DEG C, select the bacterium colony producing molten calcium circle, separating for several times purifying, microscopy obtains purebred, and 16SrDNA identifies ,-20 DEG C of glycerine pipes are preserved.
The screening of c, genus bacillus:
Genus bacillus screening culture medium: Tryptones 1%w/w, yeast extract 0.5%w/w, sodium-chlor 1%w/w, agar 1.5%w/w, pH7.2 ~ 7.4,121 DEG C, 20min sterilizing.
Get 1g cellar for storing things mud sample and make bacteria suspension, 80 DEG C of water-bath 10min, gradient dilution to 10
-5, dilution spread, cultivate 48h for 37 DEG C, select growth bacterium colony, separating for several times purifying, microscopy obtains purebred, and 16SrDNA identifies ,-20 DEG C of glycerine pipes are preserved.
The screening of d, methanobacteria:
Methanobacteria screening culture medium: the mother liquor that configuration concentration is following: the potassium primary phosphate of the sodium-acetate of 1.11%w/w, the magnesium chloride of 0.02%w/w, 0.05%w/w, the ammonium chloride of 0.075%w/w, the sodium sulphite of 1%w/w, the volatile salt of 5%w/w, after according to mother liquid concentration 3% dilute use, pH7.0, agar 1.5%w/w, 21 DEG C, 20min sterilizing, ethanol 2%(v/v), after sterilization, be cooled to about 70 DEG C to add.
Get 1g cellar for storing things mud sample and make bacteria suspension, gradient dilution to 10
-3, dilution spread, 37 DEG C of Anaerobic culturel 5d, select growth bacterium colony, separating for several times purifying, and microscopy obtains purebred, and 16SrDNA identifies ,-20 DEG C of glycerine pipes are preserved.
Choose 1 strain clostridium (Clostridiumbutyricum) of screening, 1 strains of lactic acid bacteria (Lactobacilluscrustorum), 1 bacillus (Bacillusamyloliquefaciens), 1 strain methanobacteria (Methanobacteriumbryantii) as reference culture.
3, specific amplification object fragment is obtained
Respectively with the DNA of the pure bacterium of 4 strain for template, with Clost-F/Clost-R, Lacto-F/Lacto-R, Bacil-F/Bacil-R and Metha-F/Metha-R for primer carries out pcr amplification, PCR amplification system: cumulative volume 25 μ L, system comprises 2.5 μ L10 × Buffer(and contains Mg
2+), 2 μ L25mmol/LdNTP mixtures, 0.2 μ L1UTaqDNA polysaccharase, 1 μ L10 μm ol/L primer (forward, oppositely), DNA profiling consumption is 1 μ L, uses ddH
2o complements to 25 μ L.
PCR response procedures is (clostridium): after 95 DEG C of denaturation 4min, enters 30 circulations, 95 DEG C of 1min; 57 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min.
PCR response procedures is (milk-acid bacteria, genus bacillus and methanobacteria): after 95 DEG C of denaturation 4min, enters 30 circulations, 95 DEG C of 1min; 55 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min.
Amplified production 2.0% agarose gel electrophoresis detects, the object fragment of clostridium is approximately 540bp, milk-acid bacteria object clip size is 170bp, the object fragment of genus bacillus is approximately 300bp, and the object fragment of methanobacteria is approximately 460bp and PCR primer rubber tapping is reclaimed.
4, the preparation of escherichia coli jm109 competent cell
On picking JM109 flat board, single bacterium colony is in 5mLLB substratum, 37 DEG C, 220rpm overnight incubation; By the seed liquor of incubated overnight with 2% inoculum size transfer in 15mLLB substratum, 37 DEG C, 220rpm cultivate about 1.5h to OD600 be between 0.3 ~ 0.5; Packing 1mL bacterium liquid in 1.5mL centrifuge tube, Quick spin after ice bath 20min, 4 DEG C, the centrifugal 10min of 5000rpm; Thorough supernatant discarded, adds the CaCl of 400 μ L0.1mol/L precoolings
2the resuspended thalline of solution, then ice bath 30min; 4 DEG C, the centrifugal 10min of 5000rpm, abandoning supernatant, is inverted 1min; With the CaCl of 80 μ L0.1mol/L precoolings
2the resuspended thalline of solution, places 30min on ice.
5, the structure of recombinant plasmid
PMD19-TVector is connected with 1 ︰ 3 ratio with object fragment, 16 DEG C of connections are spent the night, then product conversion JM109 competence Bacillus coli cells will be connected, then the competence Bacillus coli cells transformed is coated on the LB flat board containing acillin (100 μ g/mL), cultivate 12 ~ 16h for 37 DEG C, the positive bacterium colony of picking, in the LB liquid medium containing penbritin (100 μ g/mL), concussion is cultivated, 37 DEG C, 8 ~ 10h.Plasmid is extracted with the bacterium liquid cultivated, the primer of design is utilized to carry out plasmid amplification checking at this, if sepharose has visible object band at about 540bp, 170bp, 300bp, 460bp, can determine that object fragment successfully inserts pMD19-TVector, the plasmid extracted does 10 doubling dilutions, measure OD value, calculating copy number of averaging, specific formula for calculation is as follows:
Wherein: C Biao – DNA profiling concentration (copies/ μ L);
A – 0.05, reduction factor, i.e. 1OD
260nm=0.05 μ g/ (μ L double-stranded DNA);
N – extension rate;
6.02 × 10
23– Avogadro constant number.
6, quantitative fluorescent PCR
The reaction system of quantitative fluorescent PCR: SsoFastEvaGreen premixed liquid 10 μ L, forward primer 1 μ L, reverse primer 1 μ L, template DNA 10ng, interpolation ddH
2o to 20 μ L.
The reaction conditions of clostridium quantitative fluorescent PCR: 95 DEG C of denaturation 30s; 95 DEG C of sex change 5s; 57 DEG C of annealing 15s; 57 DEG C are read fluorescent signal data, altogether cyclic amplification 40 times.
The reaction conditions of milk-acid bacteria, genus bacillus, methanobacteria quantitative fluorescent PCR: 95 DEG C of denaturation 30s; 95 DEG C of sex change 5s; 55 DEG C of annealing 15s; 55 DEG C are read fluorescent signal data, altogether cyclic amplification 40 times.
Melting curve is drawn, and is warming up to 95 DEG C, reads a plate every 0.5 DEG C from 65 DEG C, maintains 0.05s.
The copy number of according to standard sample and CT value build the typical curve of quantitative fluorescent PCR.
, there is single melting peak, without primer dimer and nonspecific products at about 87.5 DEG C in clostridium Real-timePCR melting curve, curve is steady, and peak is sharp and narrow, illustrates that the melting temperature (Tm) of each concentration plasmid is homogeneous, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of clostridium, detect copy number 3.01 × 10
4~ 3.01 × 10
11during copies/ μ L scope, the amplification curve of clostridium Real-timePCR is one group and typically falls S curve, and this group amplification curve baseline is smooth, and exponential region is compared with obviously and steepness is large, and platform area can be compiled in together substantially, and linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3303x+13.137, linearly dependent coefficient is 0.9978, there is good linear relationship, according to formula E=10-k-1 (slope of k-typical curve), calculate the amplification efficiency of Real-timePCR is 1.14, between 0.8 ~ 1.2, amplification efficiency is desirable.
, there is single melting peak, without primer dimer and nonspecific products at about 84 DEG C in milk-acid bacteria Real-timePCR melting curve, curve is steady, and peak is sharp and narrow, illustrates that the melting temperature (Tm) of each concentration plasmid is homogeneous, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of milk-acid bacteria, detect copy number 2.44 × 10
4~ 2.44 × 10
11during copies/ μ L scope, the amplification curve of milk-acid bacteria Real-timePCR is one group and typically falls S curve, and amplification curve baseline is smooth, and exponential region is compared with obviously and steepness is large, and platform area can be compiled in together, and linearity range is wider.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3411x+14.07, and linearly dependent coefficient is 0.9978, has good linear relationship, according to formula E=10
-k-1 (slope of k-typical curve), calculates the amplification efficiency of Real-timePCR is 1.19, and between 0.8 ~ 1.2, amplification efficiency is desirable.
, there is single melting peak, without primer dimer and nonspecific products at about 88 DEG C in genus bacillus Real-timePCR melting curve, curve is steady, and peak is sharp and narrow, illustrates that the melting temperature (Tm) of each concentration plasmid is homogeneous, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of genus bacillus, detect copy number 2.18 × 10
4~ 2.18 × 10
11during copies/ μ L scope, the amplification curve of genus bacillus Real-timePCR is one group and typically falls S curve, and this group amplification curve baseline is smooth, and exponential region is compared with obviously and steepness is large, and platform area can be compiled in together substantially, and linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3387x+13.152, and linearly dependent coefficient is 0.9974, has good linear relationship, according to formula E=10
-k-1 (slope of k-typical curve), calculates the amplification efficiency of Real-timePCR is 1.18, and between 0.8 ~ 1.2, amplification efficiency is desirable.
, there is single melting peak, without primer dimer and nonspecific products at about 82.5 DEG C in methanobacteria Real-timePCR melting curve, curve is steady, and peak is sharp and narrow, illustrates that the melting temperature (Tm) of each concentration plasmid is homogeneous, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of methanobacteria, detect copy number 6.73 × 10
3~ 6.73 × 10
10during copies/ μ L scope, the amplification curve of methanobacteria Real-timePCR is one group and typically falls S curve, and this group amplification curve baseline is smooth, and exponential region is compared with obviously and steepness is large, and platform area can be compiled in together substantially, and linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3202x+13.616, linearly dependent coefficient is 0.9974, there is good linear relationship, according to formula E=10-k-1 (slope of k-typical curve), calculate the amplification efficiency of Real-timePCR is 1.09, between 0.8 ~ .2, amplification efficiency is desirable.
The preparation of embodiment 2 standard model
1, the collection of mud sample is stored
Gather cellar for storing things mud sample (acquiring the cellar for storing things mud that age is stored at age, the 200 years cellar for storing things, 100 years cellars for storing things determining the age in age, 300 years respectively), after sample collecting ,-80 DEG C of Refrigerator stores should be put into immediately as DNA can not be extracted in time.
2, microorganism total DNA extracting method in mud is stored
Take 1g and store mud sample in 50mL centrifuge tube, add 5mLPBS pH of buffer 7.64 and 8 ~ 9 sterilizing granulated glass spherees to centrifuge tube, the centrifugal 5min of whirlpool concussion 5min, 200 × g, Aspirate supernatant.In precipitation, add 5mLPBS damping fluid repeated washing twice, merge three supernatant liquors (operating) on ice, the centrifugal 5min of 12000rpm, gets precipitation.Add 1mLCTAB extract (2%CTAB, 5mol/LNaCl, 1mol/LTris-HCl (pH8.0), 0.5mol/LEDTA) and 20 μ L mercaptoethanols in centrifuge tube, 65 DEG C of constant temperature blending instrument vibration 30min, add 5 μ L proteolytic enzyme k(20mg/mL), 37 DEG C of 220r/min30min, the centrifugal 10min of room temperature 6000 × g, collects supernatant (1mL).
Add the saturated phenol of equal-volume Tris-(500 μ L) and chloroform-isoamyl alcohol (volume ratio 24 ︰ 1) (500 μ L), once, the centrifugal 10min of 12000rpm, gets supernatant and adds equal-volume chloroform-isoamyl alcohol (24 ︰ 1) the centrifugal 10min of 12000rpm in extracting, get supernatant, repeat twice.Supernatant liquor adds the centrifugal 10min of Virahol-20 DEG C precipitation 1h, 12000rpm of 0.6 volume precooling, carefully outwells liquid.Precipitate with 70% washing with alcohol several, 12000r/min10min.DNA blowing after washing dries up rear TE and dissolves, the effect extracted with 1.5% agarose gel electrophoresis validating DNA, if there is band at about 10kb, then DNA extraction success, is placed in-20 DEG C of Refrigerator stores by the DNA solution that success is extracted for subsequent use.
The quantitative analysis of clostridium in embodiment 3 Jiao Ni microflora, milk-acid bacteria, genus bacillus and methanobacteria
Clostridium in the mud sample of cellar for storing things, milk-acid bacteria, genus bacillus and methanobacteria quantitative: use the cellar for storing things mud STb gene obtained in embodiment 2, use the Auele Specific Primer of clostridium in embodiment 1, milk-acid bacteria, genus bacillus and methanobacteria.The analysis of Daqu quantitative fluorescent PCR is carried out according to the quantitative fluorescent PCR reaction system in embodiment 1 and PCR program.
In the mud sample of cellar for storing things, clostridium is quantitative: according to the linear equation y=-0.3303x+13.137 (R obtained by clostridium standard fluorescent sample quantitative PCR
2=0.9978) calculate the copy number of clostridium in various years cellar for storing things mud sample, thus different variation tendency (as shown in Figure 1) of storing clostridium biomass in age can be obtained.
In the mud sample of cellar for storing things, milk-acid bacteria is quantitative: according to the linear equation y=-0.3411x+14.07 (R obtained by milk-acid bacteria standard fluorescent sample quantitative PCR
2=0.9978) calculate the copy number of milk-acid bacteria in various years cellar for storing things mud sample, thus different variation tendency (as shown in Figure 2) of storing lactic acid bacteria biological amount in age can be obtained.
In the mud sample of cellar for storing things, genus bacillus is quantitative: according to the linear equation y=-0.3387x+13.152 (R obtained by genus bacillus standard fluorescent sample quantitative PCR
2=0.9974) calculate the copy number of total genus bacillus in various years cellar for storing things mud sample, thus different variation tendency (as shown in Figure 3) of storing genus bacillus biomass in age can be obtained.
In the mud sample of cellar for storing things, methanobacteria is quantitative: according to the linear equation y=-0.3202x+13.616 (R obtained by methanobacteria standard fluorescent sample quantitative PCR
2=0.9974) calculate the copy number of methanobacteria in various years cellar for storing things mud sample, thus different variation tendency (as shown in Figure 4) of storing methanobacteria biomass in age can be obtained.
Claims (3)
1. store the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in mud, it is characterized in that: comprise the steps:
The preparation of a, typical curve: the Auele Specific Primer designing the normal bacterial for clostridium, milk-acid bacteria, genus bacillus and methanobacteria, then carries out quantitative fluorescent PCR, according to the typical curve that copy number and CT value build;
B, extract genomic dna: utilize wash-out, method that enzymic digestion combines extracts the grand genome of Jiao Ni microflora;
Method specific as follows that described wash-out, enzymic digestion combine: take 1g and store mud sample in 50mL centrifuge tube, 5mLPBS pH of buffer 7.64 and 8 ~ 9 sterilizing granulated glass spherees are added to centrifuge tube, whirlpool concussion 5min, 200 × g centrifugal 5min, at Aspirate supernatant on ice; In precipitation, add 5mLPBS damping fluid repeated washing twice, merge three supernatant liquors, the centrifugal 5min of 12000rpm, gets precipitation; Add 1mLCTAB extract and 20 μ L mercaptoethanols in centrifuge tube, 65 DEG C of constant temperature blending instruments vibration 30min, add 5 μ L20mg/mL proteolytic enzyme k, the centrifugal 10min of 37 DEG C of 220r/min30min, room temperature 6000 × g, collect 1mL supernatant; Add the saturated phenol-chloroform-primary isoamyl alcohol of equal-volume Tris-, once, the centrifugal 10min of 12000rpm, gets supernatant and adds the centrifugal 10min of equal-volume chloroform-isoamyl alcohol 12000rpm, get supernatant, repeat twice in extracting; Supernatant liquor adds the Virahol of 0.6 times of volume precooling, and-20 DEG C of centrifugal 10min of precipitation 1h, 12000rpm, outwell liquid; Precipitation uses 70% washing with alcohol, the centrifugal 10min of 12000r/min; DNA after washing dries up rear TE and dissolves, and-20 DEG C of Refrigerator stores are for subsequent use; Described CTAB extract formula is Tris-HCl, 0.5mol/LEDTA of 2%CTAB, 5mol/LNaCl, 1mol/LpH8.0; Volume ratio 25 ︰ 24 ︰ 1 of the saturated phenol-chloroform-primary isoamyl alcohol of Tris-; Volume ratio 24 ︰ 1 of chloroform-isoamyl alcohol;
C, amplification: the Auele Specific Primer adopting clostridium, milk-acid bacteria, genus bacillus and methanobacteria, increase to the specific fragment of clostridium in the grand genome of cellar for storing things mud microorganism, milk-acid bacteria, genus bacillus and methanobacteria;
D, quantitative analysis: quantitative analysis is carried out to clostridium, milk-acid bacteria, genus bacillus and methanobacteria in Jiao Ni microflora by the CT value of typical curve and testing sample;
Increase the Auele Specific Primer of clostridium as shown in SEQIDNo.1 and SEQIDNo.2 in described step a and c;
Increase the Auele Specific Primer of milk-acid bacteria as shown in SEQIDNo.3 and SEQIDNo.4 in described step a and c;
Increase the Auele Specific Primer of genus bacillus as shown in SEQIDNo.5 and SEQIDNo.6 in described step a and c;
Increase the Auele Specific Primer of methanobacteria as shown in SEQIDNo.7 and SEQIDNo.8 in described step a and c.
2. clostridium in the mud of cellar for storing things as claimed in claim 1, milk-acid bacteria, genus bacillus, the quantitative analysis method of methanobacteria, it is characterized in that: the operation of step a is as follows: the 1 strain clostridium that extraction separation and purification obtains from Jiao Ni microflora, 1 strains of lactic acid bacteria, 1 bacillus, the genome of 1 strain methanobacteria, then utilize Auele Specific Primer to carry out PCR respectively and obtain specificity object fragment, again object fragment is connected with TA cloning vector, obtain recombinant plasmid, again by recombinant plasmid transformed competent escherichia coli cell, select positive colony transformant, extraction obtains high density plasmid, so this high density plasmid is done 10 doubling dilutions, as the standard model of quantitative fluorescent PCR, thus carry out quantitative fluorescent PCR acquisition typical curve.
3. quantitative analysis method of storing clostridium, milk-acid bacteria, genus bacillus, methanobacteria in mud as claimed in claim 1 or 2, it is characterized in that: the PCR response procedures of the clostridium specificity that increases in step a and c object fragment is: after 95 DEG C of denaturation 4min, enter 30 circulations, 95 DEG C of 1min; 57 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min; The PCR response procedures of amplification milk-acid bacteria, genus bacillus and methanobacteria specificity object fragment is: after 95 DEG C of denaturation 4min, enter 30 circulations, 95 DEG C of 1min; 55 DEG C of 1min; 72 DEG C of 1min, last 72 DEG C extend 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119217.4A CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119217.4A CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834744A CN103834744A (en) | 2014-06-04 |
| CN103834744B true CN103834744B (en) | 2016-03-23 |
Family
ID=50798636
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410119217.4A Active CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834744B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107523625B (en) * | 2017-09-20 | 2020-06-26 | 贵州茅台酒股份有限公司 | Quantitative analysis method for key microorganisms producing ethanol and lactic acid in multi-microorganism solid state fermentation |
| CN109337836B (en) * | 2018-10-26 | 2021-11-26 | 贵州茅台酒股份有限公司 | Lactobacillus isolation medium, preparation method thereof and lactobacillus screening method |
| CN109251989A (en) * | 2018-11-23 | 2019-01-22 | 哈尔滨工业大学（威海） | A kind of method of methane bacterial content in quantitative detection pit mud |
| CN112831546A (en) * | 2019-11-25 | 2021-05-25 | 中国食品发酵工业研究院有限公司 | Quantitative detection method for key functional microorganisms in yeast for making hard liquor |
| CN111500507A (en) * | 2020-05-28 | 2020-08-07 | 江南大学 | Pit mud flora enrichment method based on oligoculture and application thereof |
| CN113151422B (en) * | 2021-01-25 | 2023-11-21 | 江南大学 | Absolute quantification method for analyzing pit mud microbial community structure |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102719541A (en) * | 2012-06-13 | 2012-10-10 | 江南大学 | Method for analyzing Bacillus community structure in white spirit fermentation system |
| CN103131785A (en) * | 2013-03-11 | 2013-06-05 | 江南大学 | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102912025A (en) * | 2012-11-05 | 2013-02-06 | 四川大学 | Rapid and effective cellar mud archaea community analysis method |
-
2014
- 2014-03-27 CN CN201410119217.4A patent/CN103834744B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102719541A (en) * | 2012-06-13 | 2012-10-10 | 江南大学 | Method for analyzing Bacillus community structure in white spirit fermentation system |
| CN103131785A (en) * | 2013-03-11 | 2013-06-05 | 江南大学 | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) |
Non-Patent Citations (3)
| Title |
|---|
| Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane;Stuart E.Denman et al;《FEMS Microbiol Ecol》;20071231;第62卷;第313-322页 * |
| Turnover of Carbohydrate-Rich Vegetal Matter During Microaerobic Composting and After Amendment in Soil;Terrence R.Green.Radu Popa;《Appl Biochem Biotechnol》;20111231;第165卷;第270-278页 * |
| 泸酒老窖资源对泸型酒发展的影响——纪念泸州大曲荣获巴拿马金奖90周年;吴衍庸;《酿酒科技》;20051231(第10期);第110-112页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834744A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103834744B (en) | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things | |
| Zhang et al. | Analysis of the bacterial community in Zaopei during production of Chinese Luzhou‐flavor liquor | |
| CN103993071B (en) | The quantitative analysis method of milk-acid bacteria, clostridium, genus bacillus in Jiu Pei microflora | |
| Dai et al. | Microbial diversity and physicochemical characteristics of the Maotai-flavored liquor fermentation process | |
| Kang et al. | Insights into the bacterial, fungal, and phage communities and volatile profiles in different types of Daqu | |
| CN103834745B (en) | The quantitative analysis method of milk-acid bacteria and genus bacillus in Daqu microflora | |
| CN103497911A (en) | Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate | |
| CN111635950A (en) | Kit and method for rapidly detecting bordetella pertussis | |
| CN103131785A (en) | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN108588246A (en) | A kind of primer, probe, method and the kit of detection lower respiratory tract bacterium specific gene | |
| CN107881140A (en) | The Leuconostoc mesenteroides mutant strain of one plant height production mannitol and its application process | |
| CN104328175A (en) | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae | |
| CN103160574A (en) | Klebsiella pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) | |
| WO2020136595A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN102329877A (en) | Multi-PCR (polymerase chain reaction) rapid detection method for pathogenic bacteria in water | |
| CN102344953A (en) | Primer for detecting peach-derived component in sample, method and kit | |
| CN101974523B (en) | Primer, probe, kit and method for real-time fluorescence PCR identification of shark's fin | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN104328174A (en) | LAMP (loop-mediated isothermal amplification) primers, kit and method for detecting murine klebsiella pneumoniae | |
| CN104745544B (en) | A kind of D LOs and its application in D lactate detections | |
| CN110511987A (en) | A kind of PCR detection method of the Listeria monocytogenes based on specific gene target lmo1341 | |
| CN102181567A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for detecting candida glabrata | |
| CN101974519A (en) | Primer for amplifying molecules of microbes in pit mud of Luzhou-flavor liquor and detection method | |
| CN105039516A (en) | Fluorescent PCR detection method for clostridium difficile toxin genes, as well as primer and kit of fluorescent PCR detection method | |
| CN102344952B (en) | Primer, method and kit for detecting apple-derived materials in sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |