CN103834744A - Method for quantitatively analyzing clostridia, lactobacilli, bacilli and methanobacteria in pit mud - Google Patents
Method for quantitatively analyzing clostridia, lactobacilli, bacilli and methanobacteria in pit mud Download PDFInfo
- Publication number
- CN103834744A CN103834744A CN201410119217.4A CN201410119217A CN103834744A CN 103834744 A CN103834744 A CN 103834744A CN 201410119217 A CN201410119217 A CN 201410119217A CN 103834744 A CN103834744 A CN 103834744A
- Authority
- CN
- China
- Prior art keywords
- methanobacteria
- clostridium
- acid bacteria
- milk
- genus bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/06—Quantitative determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention belongs to the technical field of bioengineering, and in particular relates to a method for quantitatively analyzing clostridia, lactobacilli, bacilli and methanobacteria in pit mud. The technical problem to be solved by the invention is to provide a new choice for analyzing the clostridia, lactobacilli, bacilli and methanobacteria in the pit mud. The technical scheme of the invention is as follows: the method for quantitatively analyzing the clostridia, lactobacilli, bacilli and methanobacteria in the pit mud comprises the steps of a, preparation of a standard curve; b, extraction of genome DNA; c, amplification; d, quantitative analysis. The method disclosed by the invention can be used for analyzing the change trend of the clostridia, lactobacilli, bacilli and methanobacteria in the pit mud.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to store the quantitative analysis method of clostridium in mud, milk-acid bacteria, genus bacillus, methanobacteria.
Background technology
Jiao Chi is in white wine production process, the multiple wine brewing containers that react on one such as collection saccharification, wine, esterification.As the saying goes " always storing out good wine ", in white wine production practice, often find the poor unstrained spirits near the end, cellar for storing things, Jiao Bi, the strong fragrance of its wine, its basic reason is to store the metabolism of functional flora relevant with raw perfume in mud.Pond, cellar for storing things itself is exactly the carrier of multiple-microorganism, and along with long-continued the carrying out of fermentation, the functional microorganism in the mud of cellar for storing things is constantly tamed and enrichment, finally forms its distinctive microflora.Therefore, the kind of Jiao Nizhong microflora and the quantity impact important on being formed with of liquor flavor material.Investigator adopts the methods such as tradition cultivation and modern molecular biology technique, biological community structure in the mud of cellar for storing things is analyzed and studied, find that clostridium (Clostridium), milk-acid bacteria (Lactobacillus), genus bacillus (Bacillus), methanobacteria (Methanobacterium) etc. are the major function microorganism species in the mud of cellar for storing things, but in the mud of cellar for storing things, functional microorganism majority is anaerobion, and be difficult for pure culture, the detection that can not accurately carry out the functional microorganism in the mud of cellar for storing things.Therefore, illustrate the changing conditions of the biomass of the functional microorganisms such as clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, exploitation, the cellar for storing things quality control of mud and the formation of liquor flavor material to artificial distiller's yeast all have great importance.
At present microorganism detection by quantitative in the mud of cellar for storing things is still adopted and selects the screening of substratum and the method for isolation of pure culture counting, be vulnerable to external environment factor, the impacts such as strain properties, detected result deficient in stability and reliability, and time and effort consuming.Fluorescent quantitative PCR technique refers in PCR reaction system and adds fluorophor, utilizes the whole PCR process of fluorescent signal accumulation Real-Time Monitoring, finally by typical curve, unknown template is carried out to quantitative analysis.This technology has not only realized the quantitative of DNA profiling, and have high specificity, highly sensitive, high-throughput, reaction totally-enclosed, quantitatively accurately, the fast and level of automation advantages of higher of speed, become quantivative approach important in molecular biology and microorganism field.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of new selection for analyzing clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things.
Technical scheme of the present invention is the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, comprises the steps:
The preparation of a, typical curve: design, for the Auele Specific Primer of the standard bacterium of clostridium, milk-acid bacteria, genus bacillus and methanobacteria, is then carried out quantitative fluorescent PCR, according to the typical curve of copy number and CT value structure;
B, extraction genomic dna: utilize the method for wash-out, enzymic digestion combination to extract the grand genome of Jiao Ni microflora;
C, amplification: adopt the Auele Specific Primer of clostridium, milk-acid bacteria, genus bacillus and methanobacteria, the specific fragment of clostridium, milk-acid bacteria, genus bacillus and methanobacteria in the grand genome of cellar for storing things mud microorganism is increased;
D, quantitative analysis: the CT value by typical curve and testing sample is carried out quantitative analysis to clostridium, milk-acid bacteria, genus bacillus and methanobacteria in Jiao Ni microflora.
Concrete, the Auele Specific Primer of the clostridium of increasing in step a and c is as shown in SEQ ID No.1 and SEQ ID No.2.
Concrete, the Auele Specific Primer of the milk-acid bacteria of increasing in step a and c is as shown in SEQ ID No.3 and SEQ ID No.4.
Concrete, the Auele Specific Primer of the genus bacillus of increasing in step a and c is as shown in SEQ ID No.5 and SEQ ID No.6.
Concrete, the Auele Specific Primer of the methanobacteria that increases in step a and c is as shown in SEQ ID No.7 and SEQ ID No.8.
Clostridium specific primer sequence (5 ' → 3 '):
Clost-F：AAAGGRAGATTAATACCGCATAA（SEQ?ID?No.1）；
Clost-R：TTCTTCCTAATCTCTACGCA（SEQ?ID?No.2）。
Milk-acid bacteria specific primer sequence (5 ' → 3 '):
Lacto-F：AGAACACCAGTGGCGAAGG（SEQ?ID?No.3）；
Lacto-R：CAGGCGGAGTGCTTAATGC（SEQ?ID?No.4）。
Genus bacillus specific primer sequence (5 ' → 3 '):
Bacil-F：ATGGCTGTCGTCAGCT（SEQ?ID?No.5）；
Bacil-R：ACGGGCGGTGTGTAC（SEQ?ID?No.6）。
Methanobacteria specific primer sequence (5 ' → 3 '):
Metha-F：GGTGGTGTMGGATTCACACARTAYGCWACAGC（SEQ?ID?No.7）；
Metha-R：TTCATTGCRTAGTTWGGRTAGTT（SEQ?ID?No.8）。
R in above-mentioned primer is A or G; W is A or T; M is A or C; Y is T or C.
Concrete, the operation of step a is as follows: the 1 strain clostridium (Clostridium butyricum) that extraction separation and purification obtains from Jiao Ni microflora, 1 strains of lactic acid bacteria (Lactobacillus crustorum), 1 bacillus (Bacillus amyloliquefaciens), the genome of 1 strain methanobacteria (Methanobacterium bryantii), then utilize respectively Auele Specific Primer to carry out PCR and obtain specificity object fragment, again object fragment is connected with TA cloning vector, obtain recombinant plasmid, again by recombinant plasmid transformed competent escherichia coli cell, select positive colony transformant, extraction obtains high density plasmid, so this high density plasmid is done to 10 doubling dilutions, as the standard model of quantitative fluorescent PCR, thereby carry out quantitative fluorescent PCR and obtain typical curve.
Concrete, the PCR response procedures of the clostridium specificity that increases in step a and c object fragment is: after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 57 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min; The PCR response procedures of amplification milk-acid bacteria, genus bacillus and methanobacteria specificity object fragment is: after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 55 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min.
Concrete, the concrete operations of the method for the wash-out described in step b, enzymic digestion combination are as follows: take 1g cellar for storing things mud sample in 50mL centrifuge tube, add 7.64 and 8～9 sterilizing granulated glass spherees of 5mL PBS pH of buffer to centrifuge tube, whirlpool concussion 5min, the centrifugal 5min of 200 × g, draws supernatant liquor on ice; In precipitation, add 5mL PBS damping fluid repeated washing twice, merge three times supernatant liquor, the centrifugal 5min of 12000rpm, gets precipitation; Add 1mL CTAB extract (Tris-HCl, the 0.5mol/L EDTA of 2%CTAB, 5mol/LNaCl, 1mol/L pH8.0) and 20 μ L mercaptoethanols to centrifuge tube, 65 ℃ of constant temperature blending instrument vibration 30min, add 5 μ L20mg/mL proteolytic enzyme k, 37 ℃ of 220r/min30min, the centrifugal 10min of room temperature 6000 × g, collects 1mL supernatant; Add the saturated phenol-chloroform-primary isoamyl alcohol of equal-volume Tris-, once, the centrifugal 10min of 12000rpm, gets supernatant and adds the centrifugal 10min of equal-volume chloroform-primary isoamyl alcohol 12000rpm, gets supernatant, repeats twice in extracting; Supernatant liquor adds the Virahol of 0.6 times of volume precooling ,-20 ℃ of precipitation 1h, and the centrifugal 10min of 12000rpm, outwells liquid; Precipitation 70% washing with alcohol, the centrifugal 10min of 12000r/min; DNA after washing dries up rear TE and dissolves, and-20 ℃ of Refrigerator stores are for subsequent use; Wherein said CTAB extract formula is Tris-HCl, the 0.5mol/L EDTA of 2%CTAB, 5mol/L NaCl, 1mol/L pH8.0; Volume ratio 25 ︰ 24 ︰ 1 of the saturated phenol-chloroform-primary isoamyl alcohol of Tris-; Volume ratio 24 ︰ 1 of chloroform-primary isoamyl alcohol.
The present invention is simple to operate, can carry out quantitative analysis, sensitivity and reproducible to the microorganism in the mud of cellar for storing things.Adopt clostridium, milk-acid bacteria, genus bacillus, methanobacteria Auele Specific Primer and fluorescent quantitative PCR technique, set up gradual change, store fast and accurately the quantitative detecting method of major function microorganism in mud, can simplify trace routine, the raising detection efficiency of functional microorganism in the mud of cellar for storing things, strengthen the monitoring to major microorganisms in the mud of cellar for storing things, for the formation mechanism of liquor fermentation process flavor substances provides technical support.The present invention has successfully used fluorescent quantitative PCR technique to carry out quantitative analysis to major microorganisms-clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, and the biomass that obtains 4 quasi-microorganisms is stored the variation in mud age at difference cellar for storing things.
Accompanying drawing explanation
Fig. 1 stores at different cellars for storing things the change curve of clostridium copy number in mud age
Fig. 2 stores at different cellars for storing things the change curve of milk-acid bacteria copy number in mud age
Fig. 3 stores at different cellars for storing things the change curve of genus bacillus copy number in mud age
Fig. 4 stores at different cellars for storing things the changing conditions of methanobacteria copy number in mud age
In Fig. 1～4, transverse axis represents to store mud cellar for storing things age
Embodiment
In the present invention, quantitative fluorescent PCR adopts the special quantitative PCR reagent of Bio-Rad SsoFast EvaGreen premixed liquid, and this premixed liquid uses the Sso7d fusion protein technology of patent, in quantitative PCR application widely, has remarkable performance.By novel warm start engineering merge polysaccharase in conjunction with the damping fluid of optimizing and ROX inertia with reference to dyestuff, can obtain at short notice repeatability better, the quantitative PCR result that sensitivity is higher.Saturated fluorescence dye EvaGreen can effectively strengthen its intensity of being combined with double-stranded DNA and reaction sensitivity, has guaranteed best amplification efficiency, susceptibility and repeatability, and fluorescence intensity is higher compared to SYBR Green simultaneously.
The preparation of embodiment 1 typical curve
1, the synthetic special primer for clostridium, milk-acid bacteria, genus bacillus and methanobacteria, and clostridium, milk-acid bacteria, genus bacillus and the methanobacteria of screening are carried out to specific amplification
Clostridium specific primer sequence (5 ' → 3 '):
Clost-F：AAAGGRAGATTAATACCGCATAA；
Clost-R：TTCTTCCTAATCTCTACGCA。
Milk-acid bacteria specific primer sequence (5 ' → 3 '):
Lacto-F：AGAACACCAGTGGCGAAGG；
Lacto-R：CAGGCGGAGTGCTTAATGC。
Genus bacillus specific primer sequence (5 ' → 3 '):
Bacil-F：ATGGCTGTCGTCAGCT；
Bacil-R：ACGGGCGGTGTGTAC。
Methanobacteria specific primer sequence (5 ' → 3 '):
Metha-F：GGTGGTGTMGGATTCACACARTAYGCWACAGC；
Metha-R：TTCATTGCRTAGTTWGGRTAGTT。
R in above-mentioned primer is A or G; W is A or T; M is A or C; Y is T or C.
2, clostridium, milk-acid bacteria, genus bacillus and the screening of methanobacteria and determining of reference culture in the mud of cellar for storing things
The screening of a, clostridium:
Clostridium screening culture medium: ammonium sulfate 0.05%w/w, sodium acetate 0.5%w/w, dipotassium hydrogen phosphate 0.04%w/w, magnesium sulfate 0.02%w/w, yeast extract paste 0.1%w/w, agar 1.5%w/w, 121 ℃, 30min sterilizing, ethanol 2%(v/v), sterilizing CaCO
3solution 2%v/v, ethanol, calcium carbonate all, after sterilizing, is cooled to 70 ℃ of left and right and adds.
Get 1g cellar for storing things mud sample and make bacteria suspension, 80 ℃ of water-bath 10min, gradient dilution to 10
-3, dilution spread, 37 ℃ of anaerobism are cultivated 72h, select the bacterium colony that produces molten calcium circle, separating for several times purifying, microscopy obtains purebred, and 16S rDNA identifies ,-20 ℃ of glycerine pipes preservations.
The screening of b, milk-acid bacteria:
The screening culture medium of milk-acid bacteria: glucose 2%w/w, peptone 1%w/w, extractum carnis 1%w/w, yeast extract 0.5%w/w, K
2hPO
40.2%w/w, Triammonium citrate 0.2%w/w, sodium acetate 0.5%w/w, tween 80 0.1%v/v, MgSO
47H
2o0.05%w/w, MnSO
44H
2o0.025%w/w, pH6.2～6.4, agar 1.5%w/w,, is cooled to the CaCO that 70 ℃ of left and right add sterilizing by 121 ℃ after 20min sterilizing
3solution 2%v/v.
Get 1g cellar for storing things mud sample gradient dilution to 10
-6, dilution spread, cultivates 48h for 37 ℃, selects the bacterium colony that produces molten calcium circle, separating for several times purifying, and microscopy obtains purebred, and 16S rDNA identifies ,-20 ℃ of glycerine pipes preservations.
The screening of c, genus bacillus:
Genus bacillus screening culture medium: Tryptones 1%w/w, yeast extract 0.5%w/w, sodium-chlor 1%w/w, agar 1.5%w/w, pH7.2～7.4,121 ℃, 20min sterilizing.
Get 1g cellar for storing things mud sample and make bacteria suspension, 80 ℃ of water-bath 10min, gradient dilution to 10
-5, dilution spread, cultivates 48h for 37 ℃, selects growth bacterium colony, separating for several times purifying, and microscopy obtains purebred, and 16S rDNA identifies ,-20 ℃ of glycerine pipes preservations.
The screening of d, methanobacteria:
Methanobacteria screening culture medium: the potassium primary phosphate of the sodium-acetate of the mother liquor that configuration concentration is following: 1.11%w/w, the magnesium chloride of 0.02%w/w, 0.05%w/w, the ammonium chloride of 0.075%w/w, the sodium sulphite of 1%w/w, the volatile salt of 5%w/w, after use according to mother liquid concentration 3% dilution, pH7.0, agar 1.5%w/w, 21 ℃, 20min sterilizing, ethanol 2%(v/v), after sterilizing, be cooled to 70 ℃ of left and right and add.
Get 1g cellar for storing things mud sample and make bacteria suspension, gradient dilution to 10
-3, dilution spread, 37 ℃ of anaerobism are cultivated 5d, select growth bacterium colony, separating for several times purifying, microscopy obtains purebred, and 16S rDNA identifies ,-20 ℃ of glycerine pipes preservations.
Choose the 1 strain clostridium (Clostridium butyricum), 1 strains of lactic acid bacteria (Lactobacillus crustorum), 1 bacillus (Bacillus amyloliquefaciens), 1 strain methanobacteria (Methanobacterium bryantii) of screening as reference culture.
3, obtain specific amplification object fragment
Respectively take the DNA of the pure bacterium of 4 strain as template, carry out pcr amplification take Clost-F/Clost-R, Lacto-F/Lacto-R, Bacil-F/Bacil-R and Metha-F/Metha-R as primer, pcr amplification system: cumulative volume 25 μ L, system comprises that 2.5 μ L10 × Buffer(contain Mg
2+), 2 μ L25mmol/L dNTP mixtures, 0.2 μ L1U Taq archaeal dna polymerase, 1 μ L10 μ mol/L primer (forward, reverse), DNA profiling consumption is 1 μ L, uses ddH
2o complements to 25 μ L.
PCR response procedures is (clostridium): after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 57 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min.
PCR response procedures is (milk-acid bacteria, genus bacillus and methanobacteria): after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 55 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min.
Amplified production detects with 2.0% agarose gel electrophoresis, the object fragment of clostridium is approximately 540bp, milk-acid bacteria object clip size is that the object fragment of 170bp, genus bacillus is approximately 300bp, and the object fragment of methanobacteria is approximately 460bp and the rubber tapping of PCR product is reclaimed.
4, the preparation of escherichia coli jm109 competent cell
On picking JM109 flat board, single bacterium colony is to 5mL LB substratum, 37 ℃, 220rpm overnight incubation; The seed liquor of incubated overnight is transferred in 15mL LB substratum with 2% inoculum size, 37 ℃, 220rpm cultivate 1.5h left and right to OD600 be between 0.3～0.5; Packing 1mL bacterium liquid is to 1.5mL centrifuge tube, centrifugal rapidly after ice bath 20min, 4 ℃, the centrifugal 10min of 5000rpm; Thoroughly supernatant discarded, adds the CaCl of 400 μ L0.1mol/L precoolings
2the resuspended thalline of solution, then ice bath 30min; 4 ℃, the centrifugal 10min of 5000rpm, abandoning supernatant, is inverted 1min; With the CaCl of 80 μ L0.1mol/L precoolings
2the resuspended thalline of solution, places 30min on ice.
5, the structure of recombinant plasmid
PMD19-T Vector is connected with 1 ︰ 3 ratios with object fragment, 16 ℃ of connections are spent the night, then will connect product and transform JM109 competence Bacillus coli cells, then the competence Bacillus coli cells having transformed is coated on the LB flat board that contains acillin (100 μ g/mL), cultivate 12～16h for 37 ℃, the positive bacterium colony of picking, in the liquid LB substratum that contains penbritin (100 μ g/mL), concussion is cultivated, 37 ℃, 8～10h.With the bacterium liquid extraction plasmid of cultivating, utilize the primer of design to carry out plasmid amplification checking at this, if sepharose has visible object band in 540bp, 170bp, 300bp, 460bp left and right, can determine that object fragment successfully inserts pMD19-T Vector, the plasmid of its extraction is done to 10 doubling dilutions, measure OD value, the calculating copy number of averaging, specific formula for calculation is as follows:
Wherein: C Biao – DNA profiling concentration (copies/ μ L);
A – 0.05, reduction factor, i.e. 1OD
260nm=0.05 μ g/ (μ L double-stranded DNA);
N – extension rate;
6.02 × 10
23– Avogadro constant number.
6, quantitative fluorescent PCR
The reaction system of quantitative fluorescent PCR: SsoFast EvaGreen premixed liquid 10 μ L, forward primer 1 μ L, reverse primer 1 μ L, template DNA 10ng, interpolation ddH
2o to 20 μ L.
The reaction conditions of clostridium quantitative fluorescent PCR: 95 ℃ of denaturation 30s; 95 ℃ of sex change 5s; 57 ℃ of annealing 15s; 57 ℃ are read fluorescent signal data, altogether cyclic amplification 40 times.
The reaction conditions of milk-acid bacteria, genus bacillus, methanobacteria quantitative fluorescent PCR: 95 ℃ of denaturation 30s; 95 ℃ of sex change 5s; 55 ℃ of annealing 15s; 55 ℃ are read fluorescent signal data, altogether cyclic amplification 40 times.
Melting curve is drawn, and is warming up to 95 ℃ from 65 ℃, reads plate one time every 0.5 ℃, maintains 0.05s.
The copy number of according to standard sample and CT value build the typical curve of quantitative fluorescent PCR.
, there is single melting peak at about 87.5 ℃, without primer dimer and non-specific product in clostridium Real-time PCR melting curve, curve is steady, and peak is sharp and narrow, and the melting temperature (Tm) homogeneous of each concentration plasmid is described, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of clostridium, detect copy number 3.01 × 10
4～3.01 × 10
11when copies/ μ L scope, the amplification curve of clostridium Real-time PCR is one group of typically curve of falling S, and this group amplification curve baseline is smooth, exponential region compared with obviously and steepness large, platform area can be compiled in together substantially, linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3303x+13.137, linearly dependent coefficient is 0.9978, there is good linear relationship, according to formula E=10-k-1 (slope of k-typical curve), calculate to such an extent that the amplification efficiency of Real-time PCR is 1.14, between 0.8～1.2, amplification efficiency ideal.
, there is single melting peak at about 84 ℃, without primer dimer and non-specific product in milk-acid bacteria Real-time PCR melting curve, curve is steady, and peak is sharp and narrow, and the melting temperature (Tm) homogeneous of each concentration plasmid is described, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of milk-acid bacteria, detect copy number 2.44 × 10
4～2.44 × 10
11when copies/ μ L scope, the amplification curve of milk-acid bacteria Real-time PCR is one group of typically curve of falling S, and amplification curve baseline is smooth, exponential region compared with obviously and steepness large, platform area can be compiled in together, linearity range is wider.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3411x+14.07, and linearly dependent coefficient is 0.9978, has good linear relationship, according to formula E=10
-k-1 (slope of k-typical curve), calculates to such an extent that the amplification efficiency of Real-time PCR is 1.19, between 0.8～1.2, and amplification efficiency ideal.
, there is single melting peak at about 88 ℃, without primer dimer and non-specific product in genus bacillus Real-time PCR melting curve, curve is steady, and peak is sharp and narrow, and the melting temperature (Tm) homogeneous of each concentration plasmid is described, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of genus bacillus, detect copy number 2.18 × 10
4～2.18 × 10
11when copies/ μ L scope, the amplification curve of genus bacillus Real-time PCR is one group of typically curve of falling S, and this group amplification curve baseline is smooth, exponential region compared with obviously and steepness large, platform area can be compiled in together substantially, linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3387x+13.152, and linearly dependent coefficient is 0.9974, has good linear relationship, according to formula E=10
-k-1 (slope of k-typical curve), calculates to such an extent that the amplification efficiency of Real-time PCR is 1.18, between 0.8～1.2, and amplification efficiency ideal.
, there is single melting peak at about 82.5 ℃, without primer dimer and non-specific product in methanobacteria Real-time PCR melting curve, curve is steady, and peak is sharp and narrow, and the melting temperature (Tm) homogeneous of each concentration plasmid is described, amplified production specificity is good, is quantitatively reliable based on this.For the fluorescence quantifying PCR method of methanobacteria, detect copy number 6.73 × 10
3～6.73 × 10
10when copies/ μ L scope, the amplification curve of methanobacteria Real-time PCR is one group of typically curve of falling S, and this group amplification curve baseline is smooth, exponential region compared with obviously and steepness large, platform area can be compiled in together substantially, linearity range is also very wide.The concentration of plasmid standard is higher, and cycle threshold CT is lower.The linear equation of this typical curve is y=-0.3202x+13.616, linearly dependent coefficient is 0.9974, there is good linear relationship, according to formula E=10-k-1 (slope of k-typical curve), calculate to such an extent that the amplification efficiency of Real-time PCR is 1.09, between 0.8～.2, amplification efficiency ideal.
The preparation of embodiment 2 standard models
1, the collection of cellar for storing things mud sample
Collection cellar for storing things mud sample (gathered respectively storing for 100 years of definite age and have stored the cellar for storing things mud of storing age in age, 300 years in age, 200 years), should put into-80 ℃ of Refrigerator stores immediately as do not extracted in time DNA after sample collecting.
2, microorganism total DNA extracting method in the mud of cellar for storing things
Take 1g cellar for storing things mud sample in 50mL centrifuge tube, add 7.64 and 8～9 sterilizing granulated glass spherees of 5mL PBS pH of buffer to centrifuge tube, whirlpool concussion 5min, the centrifugal 5min of 200 × g, draws supernatant liquor.In precipitation, add 5mL PBS damping fluid repeated washing twice, merge three supernatant liquors (in operation on ice), the centrifugal 5min of 12000rpm, gets precipitation.Add 1mL CTAB extract (2%CTAB, 5mol/L NaCl, 1mol/LTris-HCl (pH8.0), 0.5mol/L EDTA) and 20 μ L mercaptoethanols to centrifuge tube, 65 ℃ of constant temperature blending instrument vibration 30min, add 5 μ L proteolytic enzyme k(20mg/mL), 37 ℃ of 220r/min30min, the centrifugal 10min of room temperature 6000 × g, collects supernatant (1mL).
Add the saturated phenol of equal-volume Tris-(500 μ L) and chloroform-primary isoamyl alcohol (volume ratio 24 ︰ 1) (500 μ L), once, the centrifugal 10min of 12000rpm, gets supernatant and adds equal-volume chloroform-primary isoamyl alcohol (24 ︰ 1) centrifugal 10min of 12000rpm in extracting, get supernatant, repeat twice.Supernatant liquor adds the Virahol-20 ℃ precipitation 1h of 0.6 volume precooling, and the centrifugal 10min of 12000rpm, carefully outwells liquid.70% washing with alcohol several for precipitation, 12000r/min10min.DNA after washing dissolves with drying up rear TE, the effect of extracting with 1.5% agarose gel electrophoresis validating DNA, if there is band in 10kb left and right, and DNA extraction success, it is for subsequent use that the DNA solution that success is extracted is placed in-20 ℃ of Refrigerator stores.
The quantitative analysis of clostridium, milk-acid bacteria, genus bacillus and methanobacteria in embodiment 3 Jiao Ni microfloras
In the mud sample of cellar for storing things, clostridium, milk-acid bacteria, genus bacillus and methanobacteria is quantitative: use the total DNA of cellar for storing things mud obtaining in embodiment 2, use the Auele Specific Primer of clostridium, milk-acid bacteria, genus bacillus and methanobacteria in embodiment 1.Carry out the analysis of Daqu quantitative fluorescent PCR according to the quantitative fluorescent PCR reaction system in embodiment 1 and PCR program.
In the mud sample of cellar for storing things, clostridium is quantitative: according to the linear equation y=-0.3303x+13.137 (R being obtained by clostridium standard fluorescent sample quantitative PCR
2=0.9978) calculate the copy number of clostridium in various years cellar for storing things mud sample, thereby can obtain different variation tendencies (as shown in Figure 1) of storing clostridium biomass in age.
In the mud sample of cellar for storing things, milk-acid bacteria is quantitative: according to the linear equation y=-0.3411x+14.07 (R being obtained by milk-acid bacteria standard fluorescent sample quantitative PCR
2=0.9978) calculate the copy number of milk-acid bacteria in various years cellar for storing things mud sample, thereby can obtain different variation tendencies (as shown in Figure 2) of storing lactic acid bacteria biological amount in age.
In the mud sample of cellar for storing things, genus bacillus is quantitative: according to the linear equation y=-0.3387x+13.152 (R being obtained by genus bacillus standard fluorescent sample quantitative PCR
2=0.9974) calculate the copy number of total genus bacillus in various years cellar for storing things mud sample, thereby can obtain different variation tendencies (as shown in Figure 3) of storing genus bacillus biomass in age.
In the mud sample of cellar for storing things, methanobacteria is quantitative: according to the linear equation y=-0.3202x+13.616 (R being obtained by methanobacteria standard fluorescent sample quantitative PCR
2=0.9974) calculate the copy number of methanobacteria in various years cellar for storing things mud sample, thereby can obtain different variation tendencies (as shown in Figure 4) of storing methanobacteria biomass in age.
Claims (7)
1. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things, is characterized in that: comprise the steps:
The preparation of a, typical curve: design, for the Auele Specific Primer of the standard bacterium of clostridium, milk-acid bacteria, genus bacillus and methanobacteria, is then carried out quantitative fluorescent PCR, according to the typical curve of copy number and CT value structure;
B, extraction genomic dna: utilize the method for wash-out, enzymic digestion combination to extract the grand genome of Jiao Ni microflora;
C, amplification: adopt the Auele Specific Primer of clostridium, milk-acid bacteria, genus bacillus and methanobacteria, the specific fragment of clostridium, milk-acid bacteria, genus bacillus and methanobacteria in the grand genome of cellar for storing things mud microorganism is increased;
D, quantitative analysis: the CT value by typical curve and testing sample is carried out quantitative analysis to clostridium, milk-acid bacteria, genus bacillus and methanobacteria in Jiao Ni microflora.
2. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things as claimed in claim 1, is characterized in that: the Auele Specific Primer of the clostridium of increasing in step a and c is as shown in SEQ ID No.1 and SEQ ID No.2.
3. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things as claimed in claim 1 or 2, is characterized in that: the Auele Specific Primer of the milk-acid bacteria of increasing in step a and c is as shown in SEQ ID No.3 and SEQ ID No.4.
4. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the cellar for storing things mud as described in claim 1～3 any one, is characterized in that: the Auele Specific Primer of the genus bacillus of increasing in step a and c is as shown in SEQ ID No.5 and SEQ ID No.6.
5. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the cellar for storing things mud as described in claim 1～4 any one, is characterized in that: the Auele Specific Primer of the methanobacteria that increases in step a and c is as shown in SEQ ID No.7 and SEQ ID No.8.
6. clostridium in the cellar for storing things mud as described in claim 1～5 any one, milk-acid bacteria, genus bacillus, the quantitative analysis method of methanobacteria, it is characterized in that: the operation of step a is as follows: the 1 strain clostridium that extraction separation and purification obtains from Jiao Ni microflora, 1 strains of lactic acid bacteria, 1 bacillus, the genome of 1 strain methanobacteria, then utilize respectively Auele Specific Primer to carry out PCR and obtain specificity object fragment, again object fragment is connected with TA cloning vector, obtain recombinant plasmid, again by recombinant plasmid transformed competent escherichia coli cell, select positive colony transformant, extraction obtains high density plasmid, so this high density plasmid is done to 10 doubling dilutions, as the standard model of quantitative fluorescent PCR, thereby carry out quantitative fluorescent PCR and obtain typical curve.
7. the quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the cellar for storing things mud as described in claim 1～6 any one, it is characterized in that: the PCR response procedures of the clostridium specificity that increases in step a and c object fragment is: after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 57 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min; The PCR response procedures of amplification milk-acid bacteria, genus bacillus and methanobacteria specificity object fragment is: after 95 ℃ of denaturation 4min, enter 30 circulations, 95 ℃ of 1min; 55 ℃ of 1min; 72 ℃ of 1min, last 72 ℃ are extended 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119217.4A CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410119217.4A CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834744A true CN103834744A (en) | 2014-06-04 |
| CN103834744B CN103834744B (en) | 2016-03-23 |
Family
ID=50798636
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410119217.4A Active CN103834744B (en) | 2014-03-27 | 2014-03-27 | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834744B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107523625A (en) * | 2017-09-20 | 2017-12-29 | 贵州茅台酒股份有限公司 | The quantitative analysis method of producing and ethanol and lactic acid producing key microorganisms in more micro- solid state fermentation |
| CN109251989A (en) * | 2018-11-23 | 2019-01-22 | 哈尔滨工业大学（威海） | A kind of method of methane bacterial content in quantitative detection pit mud |
| CN109337836A (en) * | 2018-10-26 | 2019-02-15 | 贵州茅台酒股份有限公司 | A kind of lactic acid bacteria isolation medium and preparation method thereof and lactic acid bacterial screening method |
| CN111500507A (en) * | 2020-05-28 | 2020-08-07 | 江南大学 | Pit mud flora enrichment method based on oligoculture and application thereof |
| CN112831546A (en) * | 2019-11-25 | 2021-05-25 | 中国食品发酵工业研究院有限公司 | Quantitative detection method for key functional microorganisms in yeast for making hard liquor |
| CN113151422A (en) * | 2021-01-25 | 2021-07-23 | 江南大学 | Absolute quantitative method for analyzing pit mud microbial community structure |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102719541A (en) * | 2012-06-13 | 2012-10-10 | 江南大学 | Method for analyzing Bacillus community structure in white spirit fermentation system |
| CN102912025A (en) * | 2012-11-05 | 2013-02-06 | 四川大学 | Rapid and effective cellar mud archaea community analysis method |
| CN103131785A (en) * | 2013-03-11 | 2013-06-05 | 江南大学 | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) |
-
2014
- 2014-03-27 CN CN201410119217.4A patent/CN103834744B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102719541A (en) * | 2012-06-13 | 2012-10-10 | 江南大学 | Method for analyzing Bacillus community structure in white spirit fermentation system |
| CN102912025A (en) * | 2012-11-05 | 2013-02-06 | 四川大学 | Rapid and effective cellar mud archaea community analysis method |
| CN103131785A (en) * | 2013-03-11 | 2013-06-05 | 江南大学 | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) |
Non-Patent Citations (3)
| Title |
|---|
| STUART E.DENMAN ET AL: "Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane", 《FEMS MICROBIOL ECOL》 * |
| TERRENCE R.GREEN.RADU POPA: "Turnover of Carbohydrate-Rich Vegetal Matter During Microaerobic Composting and After Amendment in Soil", 《APPL BIOCHEM BIOTECHNOL》 * |
| 吴衍庸: "泸酒老窖资源对泸型酒发展的影响——纪念泸州大曲荣获巴拿马金奖90周年", 《酿酒科技》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107523625A (en) * | 2017-09-20 | 2017-12-29 | 贵州茅台酒股份有限公司 | The quantitative analysis method of producing and ethanol and lactic acid producing key microorganisms in more micro- solid state fermentation |
| CN107523625B (en) * | 2017-09-20 | 2020-06-26 | 贵州茅台酒股份有限公司 | Quantitative analysis method for key microorganisms producing ethanol and lactic acid in multi-microorganism solid state fermentation |
| CN109337836A (en) * | 2018-10-26 | 2019-02-15 | 贵州茅台酒股份有限公司 | A kind of lactic acid bacteria isolation medium and preparation method thereof and lactic acid bacterial screening method |
| CN109337836B (en) * | 2018-10-26 | 2021-11-26 | 贵州茅台酒股份有限公司 | Lactobacillus isolation medium, preparation method thereof and lactobacillus screening method |
| CN109251989A (en) * | 2018-11-23 | 2019-01-22 | 哈尔滨工业大学（威海） | A kind of method of methane bacterial content in quantitative detection pit mud |
| CN112831546A (en) * | 2019-11-25 | 2021-05-25 | 中国食品发酵工业研究院有限公司 | Quantitative detection method for key functional microorganisms in yeast for making hard liquor |
| CN111500507A (en) * | 2020-05-28 | 2020-08-07 | 江南大学 | Pit mud flora enrichment method based on oligoculture and application thereof |
| CN113151422A (en) * | 2021-01-25 | 2021-07-23 | 江南大学 | Absolute quantitative method for analyzing pit mud microbial community structure |
| CN113151422B (en) * | 2021-01-25 | 2023-11-21 | 江南大学 | Absolute quantification method for analyzing pit mud microbial community structure |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834744B (en) | 2016-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103834744B (en) | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things | |
| Zhang et al. | Analysis of the bacterial community in Zaopei during production of Chinese Luzhou‐flavor liquor | |
| CN103993071B (en) | The quantitative analysis method of milk-acid bacteria, clostridium, genus bacillus in Jiu Pei microflora | |
| CN112980980B (en) | Molecular marker and kit for specific quantification of Jin Shancu lactobacillus and application | |
| CN107523625A (en) | The quantitative analysis method of producing and ethanol and lactic acid producing key microorganisms in more micro- solid state fermentation | |
| CN102382877A (en) | Method for studying structural diversity of daqu bacterial community | |
| CN103834745B (en) | The quantitative analysis method of milk-acid bacteria and genus bacillus in Daqu microflora | |
| CN103184289A (en) | Method for detecting five bacteria in vinegar grains by fluorogenic quantitative PCR (polymerase chain reaction) | |
| CN103642910A (en) | Primer and probe for quantitative determination of klebsiella pneumonia, and application of primer and probe | |
| CN103131785A (en) | Method for detecting acetic bacteria and lactic acid bacteria in vinegar culture by using fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN111485028A (en) | Fluorescent quantitative PCR method for detecting tilapia streptococcus agalactiae and corresponding kit | |
| CN104561284A (en) | Molecular identification method for zero-type fruit branch genes of cotton | |
| CN102344953B (en) | Primer for detecting peach-derived component in sample, method and kit | |
| CN101974523B (en) | Primer, probe, kit and method for real-time fluorescence PCR identification of shark's fin | |
| CN108048582A (en) | The Pseudomonas fluorescens method of thermophilic protease is produced in a kind of quantitative quick detection raw milk using LAMP primer group | |
| Yang et al. | Effect of Bacillus subtilis fortified inoculation on the microbial communities in different niches of Daqu | |
| CN104328175A (en) | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae | |
| CN102329877A (en) | Multi-PCR (polymerase chain reaction) rapid detection method for pathogenic bacteria in water | |
| CN102344951B (en) | Primer, method and kit for detecting pear-derived components in sample | |
| Santos et al. | Probiotic cell cultivation | |
| CN104017877A (en) | Vibrio parahaemolyticus molecule detection method and primer pair used by same | |
| CN107012222A (en) | It is a kind of that preparation method is oriented based on the pickle starter that 16S rDNA are sequenced | |
| CN110511987A (en) | A kind of PCR detection method of the Listeria monocytogenes based on specific gene target lmo1341 | |
| CN105039516B (en) | The fluorescence PCR detecting method and its primer and kit of a kind of clostridium difficile toxin gene | |
| CN103866030B (en) | The LAMP detection primer of Escherichia coli O 157: H7 and detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |