CN103834733A - Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time - Google Patents
Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time Download PDFInfo
- Publication number
- CN103834733A CN103834733A CN201410067910.1A CN201410067910A CN103834733A CN 103834733 A CN103834733 A CN 103834733A CN 201410067910 A CN201410067910 A CN 201410067910A CN 103834733 A CN103834733 A CN 103834733A
- Authority
- CN
- China
- Prior art keywords
- reagent
- primer
- pyromark
- tetra
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of a single tube at the same time and belongs to the field of molecular biology test. The kit comprises a whole blood genome DNA (deoxyribonucleic acid) extraction reagent, a multiple PCR (polymerase chain reaction) amplification primer, a multiple PCR amplification reaction reagent, a single-strained DNA separation and purification reagent, a pyrosequencing primer, a pyrosequencing reagent and a kit body. The method comprises the following steps: extracting human whole blood genome DNA, carrying out multiple PCR amplification reaction, separating and purifying a single-strained DNA sample, pyrosequencing and analyzing results. The kit can be used by a person subjected to physical examination and hope to know individual ethyl alcohol and folic acid metabolic capability, can be used for predicting individual nitroglycerin metabolic capability and curative effect and guiding a patient suffering from myocardial infarction to reasonably select and prepare vasodilatation first-aid medicaments and can also be used for predicting the individual folic acid metabolic capability and guiding pregnant and lying-in women to supplement the right dosage of folic acid supplements.
Description
Technical field
The invention belongs to molecular biology inspection field, especially relate to a kind of test kit and the method for single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site.This technology may be used on clinical detection, the research of EPDML examination and population genome difference.Especially it can be applicable to clinical health check-up and pharmacogenomics detection.
Background technology
Along with completing of the universal and Human Genome Project of high-flux sequence, individuation Clinics just progressively march toward daily clinical diagnosis and treatment work, and affect just gradually the mode that clinic diagnosis thinking and personal health are managed.Single nucleotide polymorphism analysis (SNP) is the important component part of individuation diagnosis and treatment, is mainly used at present in patient's pharmacogenomics detection, and the dosage to patient and medication cycle are instructed.In fact, snp analysis not only can be served as effective pharmacogenomics mark, and it also can be used as a kind of good disorder in screening and applies in health check-up with control mark.
1, the clinical progress of ALDH2 gene
Acetaldehyde dehydrogenase ALDH is the key enzyme that in alcohol metabolism, acetaldehyde is converted into acetic acid, the main code gene that to be positioned at No. 12 chromosomal ALDH2 genes be plastosome acetaldehyde dehydrogenase.In the time that wrong meaning SNP sudden change occurs ALDH2 gene, its ALDH enzymic activity of encoding synthetic is by the reduction occurring in various degree.The reduction of ALDH enzymic activity will cause the decline of body to acetaldehyde metabolic capacity, causes taking in a large number the sharply rising of serum acetaldehyde concentration after alcohol, finally causes the acute lesion to liver function, and relevant to the generation of the cancer in digestive system such as liver, stomach, oesophagus
[1-4].Meanwhile, ALDH enzyme has been proved to be at important acute cardiovascular medicine---and in the metabolism activation path of pannonit, playing the part of important role, the curative effect that causes pannonit is reduced even complete failure by the reduction of its activity and even forfeiture
[5].According to the data of the state-run biology information technology of U.S. center ncbi database, Glu504Lys sudden change proportion in Chinese population of ALDH2 gene, up to 30%, is the modal ALDH2 point mutation of Chinese population.Recent study
[6,7]also show, this sudden change may be relevant to the morbidity of type-II diabetes in Chinese Han Population and coronary heart disease.
2, the clinical progress of mthfr gene
Methylene tetrahydrofolate reductase MTHFR is one of key enzyme in folic acid metabolism, the relevant 5,10-CH2-THFA of DPNH (NADPH) can be reduced to 5-methyltetrahydrofolate.The former biological action is the carrier of a carbon-based group in cell, participates in the synthetic and DNA repair process of purine and pyrimidine; And 5-methyltetrahydrofolate is as methyl donor, methyl group is offered to homocysteine under the catalysis of methionine synthetase and generates methionine(Met), and further again methyl turn to S-adenosylmethionine, and participate in body methylation reaction widely.In the time that SNP missense mutation occurs mthfr gene, thereby its active lower general who has surrendered causes folic acid metabolism process obstacle in body to cause various diseases, comprise cause mongolism increased risk and neonatal development abnormal
[8-10], the obstructive cerebral apoplexy of companion's hyperhomocysteinemiainjury
[11], also closely related with the generation of deep venous thrombosis
[12].According to the data of the state-run biology information technology of U.S. center ncbi database, the C677T mononucleotide SNP polymorphism of mthfr gene is the most general in Chinese population, and Han nationality's population carrier ratio is about 27%-46%.
3, the advantage that tetra-sodium sequence measurement is learned
At present, mainly comprise the Taqman probe technique based on allele-specific hybridization, molecular beacons technology etc. for the detection technique of single nucleotide polymorphism SNP; Based on the restricted length polymorphism technology of endonuclease, primer Intrusion analysis technology etc.; Oligonucleotide linking parsing technology based on high degree of specificity DNA ligase; Direct sequencing based on primer extension and allele-specific extension method etc.But the most complicated operation of these methods, cost costliness, thereby in extensive SNP detects, be not applied.Tetra-sodium sequencing is due to its good quantitative performance, and without electrophoresis or fluorescent mark, being easy to the advantages such as automatization has become SNP and detect topmost method.But, because the amplified reaction in each site in tetra-sodium order-checking in the past need to carry out separately, this means and need the project detecting to have several mutational sites, need the amplified reaction of respective numbers.This has virtually improved greatly tetra-sodium order-checking and has detected the cost and price as clinical detection, passively the patient that need to carry out in a large number this detection is kept outside of the door.The multidigit point amplified reaction that ALDH2 gene and two catastrophe points of mthfr gene are carried out single tube by the present invention carries out the detection of tetra-sodium order-checking, reduce the cost detecting, simplified techniqueflow, thereby reduce the expense and the cost that detect, reduced the threshold of individuality medicine.
Reference:
1, the vertical beautiful Wu Mei tinkling of pieces of jade of Wang Hong of Zhu Yan Ming hole tin Meng Fan. the relation of acetaldehyde dehydrogenase gene polymorphism and alcoholic liver disease. Chinese Journal of Hepatology, 2003,11(11): 654-656.
2, fourth Jian Hua, Li Suping, Wu Jianzhong, Zhou Jiannong, high kept burning day and night, Zhou Xuefu, Ding Baoguo, Wang Ruhong. aldehyde dehydrogenase 2 with drink and HBsAg causes liver cancer interaction. Chinese public health, 2003,19 (3): 260-262.
3, Yang Yufeng, Shen Xiaobing, Zhang Jiao. aldehyde dehydrogenase 2 gene pleiomorphism and environmental exposure and gastric cancer susceptibility. Chinese public health, 2006,22 (4): 435-436.
4、Brooks?PJ,Enoch?MA,Goldman?D,Li?TK,Yokoyama?A.The?alcohol?flushing?response:an?unrecognized?risk?factor?for?esophageal?cancer?from?alcohol?consumption.PLoS?Med.2009;6(3):e50,0258-0263。
5、Li?Y,Zhang?D,Jin?W,Shao?C,Yan?P,Xu?C,Sheng?H,Liu?Y,Yu?J,Xie?Y,Zhao?Y,Lu?D,?Nebert?DW,Harrison?DC,Huang?W,Jin?L.Mitochondrial?aldehyde?dehydrogenase-2(ALDH2)Glu504Lys?polymorphism?contributes?to?the?variation?in?efficacy?of?sublingual?nitroglycerin.J?Clin?Invest.2006;116(2):506-511。
6, Xue Li, Chen Yuguo, Xu Feng, Zhang He, Jiang Chunxiao, Zhang Yun. the correlation research of China Han patients with coronary heart disease aldehyde dehydrogenase 2 gene pleiomorphism and myocardial infarction. journal of Shandong university (medicine), 2007,45 (8): 808-812.
7, Jiang Chunxiao, Chen Yuguo, Zhang Yun, Xu Feng, Zhang He, Xue Li. the relation of China Han patients with coronary heart disease aldehyde dehydrogenase 2 gene pleiomorphism and diabetes B. Aged in China is learned magazine, 2007,27(4): 349-350.
8、James?SJ,Pogribna?M,Pogribny?IP,Melnyk?S,Hine?RJ,Gibson?JB,Yi?P,Tafoya?DL,Swenson?DH,Wilson?VL,Gaylor?DW.Abnormal?folate?metabolism?and?mutation?in?the?methylenetetrahydrofolatereductase?gene?may?be?maternal?risk?factors?for?Down?syndrome.Am?J?ClinNutr.1999;70(4):495-501。
9、Hobbs?CA,Sherman?SL,Yi?P,Hopkins?SE,Torfs?CP,Hine?RJ,Pogribna?M,Rozen?R,James?SJ.Polymorphisms?in?genes?involved?in?folate?metabolism?as?maternal?risk?factors?for?Down?syndrome.Am?J?Hum?Genet.2000;67(3):623-630。
10、van?Rooij?IA,Vermeij-Keers?C,Kluijtmans?LA,OckéMC,Zielhuis?GA,Goorhuis-Brouwer?SM,van?der?Biezen?JJ,Kuijpers-Jagtman?AM,Steegers-Theunissen?RP.Does?the?interaction?between?maternal?folate?intake?and?the?methylenetetrahydrofolatereductase?polymorphisms?affect?the?risk?of?cleft?lip?with?or?without?cleft?palate?Am?J?Epidemiol.2003;157(7):583-591。
11、Li?Z,Sun?L,Zhang?H,Liao?Y,Wang?D,Zhao?B,Zhu?Z,Zhao?J,Ma?A,Han?Y,Wang?Y,Shi?Y,Ye?J,Hui?R;Multicenter?Case-Control?Study?in?China.Elevated?plasma?homocysteine?was?associated?with?hemorrhagic?and?ischemic?stroke,but?methylenetetrahydrofolatereductase?gene?C677T?polymorphism?was?a?risk?factor?for?thrombotic?stroke:a?Multicenter?Case-Control?Study?in?China.Stroke.2003;34(9):2085-2090。
12, Yu Haidong, Zheng Hong, Qi Hua, connects Jian Hua, He Ying, Dong Ziming. the correlation research of Homocysteine metabolic enzymes gene pleiomorphism and deep venous thrombosis. Chinese Journal of Medical Genetics, 2006,23(6): 635-639.
Summary of the invention
The first object of the present invention is to provide the test kit of a kind of single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site.
The second object of the present invention is to provide a kind of method of single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site.
The test kit of described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site comprises:
(1) Whole Blood Genomic DNA is extracted reagent: described Whole Blood Genomic DNA is extracted reagent source and extracted test kit in commercial poba gene group, purchased from TIANGEN Biotech (Beijing) Co., Ltd., main component has damping fluid GD, damping fluid GB, Proteinase K, adsorption column CB3, rinsing liquid PW and elution buffer TB etc.
(2) multiplex PCR amplimer: described multiplex PCR amplimer comprises:
PCR primer 1(Seq NO1):
ALDH2Glu504Lys(rs671) upstream primer 5 '-CAGTCACCCTTTGGTGGCTACA-3 ';
PCR primer 2 (Seq NO2):
ALDH2Glu504Lys(rs671) downstream primer 5 '-CCAGCAGGTCCCACACTCAC-3 ';
PCR primer 3(Seq NO3):
MTHFR C677T(rs1801133) upstream primer 5 '-GGCTGACCTGAAGCACTTGAA-3 ';
PCR primer 4(Seq NO4):
MTHFR C677T(rs1801133) downstream primer 5 '-CAAGTGATGCCCATGTCGGT-3 '.
Wherein 5 ' of primer 1 and primer 3 end all carries out biotin labeling.
(3) multiplex PCR amplification reaction reagent: described multiplex PCR amplification reaction reagent is called " 2X PyroMark PCR Master Mix ", from the PyroMark PCR Kit test kit of German QIAGEN company.Concrete composition mainly comprises warm start TaqDNA polysaccharase, deoxyribonucleoside triphosphate dNTPs, magnesium ion Mg
2+, sodium ion Na
+and amplified reaction specificity toughener Q-Solution.
(4) single stranded DNA separates and purified reagent: described single stranded DNA separates and purified reagent, mainly comprises purchased from the high-performance Streptavidin agarose of the AM General health GE Healthcare of company with purchased from PyroMark binding buffer liquid, PyroMark denaturing soln and the PyroMark elution buffer 10X concentrated solution of German QIAGEN company.
(5) tetra-sodium sequencing primer: described tetra-sodium sequencing primer comprises:
Sequencing primer 1(Seq NO5):
ALDH2Glu504Lys(rs671) sequencing primer 5 '-CACACTCACAGTTTTCACTT-3 ';
Sequencing primer 2(Seq NO6):
MTHFR C677T(rs1801133) sequencing primer 5 '-TGCGTGATGATGAAAT-3 '.
(6) tetra-sodium sequencing reagent: described tetra-sodium sequencing reagent is the conventional reagent of DNA tetra-sodium order-checking, purchased from German QIAGEN company, mainly comprise PyroMark annealing buffer, enzyme complex, substrate complex and deoxyribonucleoside triphosphate mixture dNTP, wherein dATP is manually modified α-sulfo-deoxyadenosine triphosphate, all the other deoxycytidine triphosphates, deoxyguanosine triphosphate, deoxythymidine triphosphate unmodified; Described enzyme complex comprises the check order enzyme of all needs of tetra-sodium, i.e. archaeal dna polymerase, ATP sulfurylase, luciferase, apyrase; Described substrate complex is 5'-AMP sulphuric anhydride.
(7) box body: Whole Blood Genomic DNA is extracted reagent, multiplex PCR amplimer, multiplex PCR amplification reaction reagent, single stranded DNA separation and purified reagent, tetra-sodium sequencing primer, tetra-sodium sequencing reagent and is located in box body.
The method of described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site, the test kit that adopts described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site, comprises the steps:
(1) human whole blood extracting genome DNA: the Whole Blood Genomic DNA Extraction parts reagent that adopts described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit, comprise and utilize damping fluid GB and Proteinase K to dissolve peripheral blood leucocyte, damping fluid GD and rinsing liquid PW remove protein ingredient, finally obtain DNA composition with elutriant TB wash-out, whole abstraction reaction is taking adsorption column CB3 as DNA and the medium of cell debris and DNA and protein separation.
(2) multiplex PCR amplified reaction: adopt multiple PCR primer and the multiplex PCR amplification reaction reagent of described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit, concrete reaction system and reaction conditions are as shown in Table 1 and Table 2.
Table 1 multiplex PCR amplification reaction system
Table 2 multiplex PCR amplification reaction condition
(3) single stranded DNA sample separation and purifying: adopt described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene to separate and purified reagent with the single stranded DNA of Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit, be included in the combination of high-performance Streptavidin agarose under PyroMark binding buffer liquid condition and the PCR product with vitamin H, and isolate single stranded DNA product, then obtain respectively the single stranded DNA sample of purifying through 70% ethanol, PyroMark denaturing soln and PyroMark elution buffer.
(4) tetra-sodium order-checking and interpretation of result: the tetra-sodium sequencing primer and the tetra-sodium sequencing reagent that adopt described single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit, concrete operations are to be diluted in the sequencing primer 1 of 0.3 μ mol/L and sequencing primer 2 and to put into the single stranded DNA product of purifying at 25 μ L PyroMark annealing buffers respectively, after 80 DEG C of continuous heating 2min, the lower cooling at least 5min of room temperature (15～25 DEG C), in PyroMark Q24 agent bin, add the enzyme complex of system-computed gained simultaneously, the volume separately of substrate complex and four kinds of deoxyribonucleoside triphosphates, then on PyroMark Q24 instrument, move order-checking program, after finishing, finally order-checking carries out interpretation of result in PyroMark Q24 analysis software operation AQ pattern.
Test kit of the present invention is integrated all reagent compositions of four steps of order-checking from DNA extraction to tetra-sodium, is beneficial to commercialization production and clinical application and promotes.PCR primer 1-4 and sequencing primer 1-2 are the crucial composition of the test kit of invention, can ensure multi-PRC reaction time, without cross interference, generate 2 kinds of specific amplified products simultaneously, are respectively ALDH2 gene amplification product 107bp, mthfr gene amplified production 126bp; Order-checking can be to the Glu504Lys(rs671 of ALDH2) C677T(rs1801133 of wild-type sequence (Seq NO7) CGAGTACGGGCTGCAGGCATACACTG and saltant type sequence (Seq NO8) CGAGTACGGGCTGCAGGCATACACTA and MTHFR) wild-type sequence (Seq NO9) TTGAAGGAGAAGGTGTCTGCGGGAGCCG and saltant type sequence (Seq NO10) TTGAAGGAGAAGGTGTCTGCGGGAGTCG analyze.
The test kit of single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene of the present invention and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site is mainly by having the Glu504Lys(rs671 of ALDH2 gene of higher mutant proportion in joint-detection Chinese population) and the C677T(rs1801133 of mthfr gene) single nucleotide polymorphism mutational site, the former not only with alcoholic liver disease, type-II diabetes, the risk of the diseases such as coronary heart disease is relevant, also relevant to the curative effect of pannonit, the latter directly has influence on metabolism and the absorption of folic acid, thereby the cerebral apoplexy and the newborn infant's defect that cause hyperhomocysteinemiainjury to cause.Therefore practical use of the present invention at least comprises: (1) wishes to understand the individual physical examination of healthy population to ethanol and folic acid metabolism ability situation; (2) prediction is individual to pannonit metabolic capacity and curative effect, instructs heart stalk patient's choose reasonable and vasorelaxation first aid medicine for subsequent use; (3) the individual metabolic capacity to folic acid of prediction, instructs pregnant and lying-in women and children to supplement the folic acid supplement that is applicable to dosage.
Brief description of the drawings
Fig. 1 is the structure composition schematic diagram of the test kit embodiment of single tube simultaneous determination aldehyde dehydrogenase 2 gene of the present invention and Methylene tetrahydrofolate reductase gene mutation site.
Fig. 2 is ALDH2 gene amplification product melting curve figure of the present invention.
Fig. 3 is mthfr gene amplified production melting curve figure of the present invention.
Fig. 4 is ALDH2Glu504Lys(rs671 of the present invention) heterozygous mutation tetra-sodium sequencing result figure.
Fig. 5 is ALDH2Glu504Lys(rs671 of the present invention) wild-type tetra-sodium sequencing result figure.
Fig. 6 is MTHFR C677T(rs1801133 of the present invention) heterozygous mutation tetra-sodium sequencing result figure.
Fig. 7 is MTHFR C677T(rs1801133 of the present invention) wild-type tetra-sodium sequencing result figure.
Fig. 8 is MTHFR C677T(rs1801133 of the present invention) no mutant homozygote was tetra-sodium sequencing result figure.
Embodiment
Below in conjunction with drawings and Examples, the present invention is described further.
Referring to Fig. 1, the test kit embodiment of single tube simultaneous determination aldehyde dehydrogenase 2 gene of the present invention and Methylene tetrahydrofolate reductase gene mutation site is provided with box body 1, Whole Blood Genomic DNA is extracted reagent 2, multiplex PCR amplimer 3, multiplex PCR amplification reaction reagent 4, single stranded DNA separates and purified reagent 5, tetra-sodium sequencing primer 6, tetra-sodium sequencing reagent 7, Whole Blood Genomic DNA is extracted reagent 2, multiplex PCR amplimer 3, multiplex PCR amplification reaction reagent 4, single stranded DNA separates and purified reagent 5, tetra-sodium sequencing primer 6, tetra-sodium sequencing reagent 7 is located in box body 1.
embodiment 1
Primer composition and the sequence of test kit key are as follows:
PCR primer 1(Seq NO1):
ALDH2Glu504Lys(rs671) upstream primer 5 '-CAGTCACCCTTTGGTGGCTACA-3 ';
PCR primer 2 (Seq NO2):
ALDH2Glu504Lys(rs671) downstream primer 5 '-CCAGCAGGTCCCACACTCAC-3 ';
PCR primer 3(Seq NO3):
MTHFR C677T(rs1801133) upstream primer 5 '-GGCTGACCTGAAGCACTTGAA-3 ';
PCR primer 4(Seq NO4):
MTHFR C677T(rs1801133) downstream primer 5 '-CAAGTGATGCCCATGTCGGT-3 '.
Sequencing primer 1(Seq NO5):
ALDH2Glu504Lys(rs671) sequencing primer 5 '-CACACTCACAGTTTTCACTT-3 ';
Sequencing primer 2(Seq NO6):
MTHFR C677T(rs1801133) sequencing primer 5 '-TGCGTGATGATGAAAT-3 '.
Get wish and understand self physical examination of healthy population A peripheric venous blood 2mL to ethanol and folic acid metabolism ability situation, apply test kit of the present invention and method and carry out the joint-detection of aldehyde dehydrogenase 2 (ALDH2) gene and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site.
1, human whole blood extracting genome DNA: use the Whole Blood Genomic DNA of single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene of the present invention and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit to extract reagent.
1.1 reagent configurations: add dehydrated alcohol in damping fluid GD and rinsing liquid PW, add volume with reference to label on bottle.
1.2 extraction steps:
1) get 200 μ L whole blood samples and add in 1.5mL centrifuge tube, add 20 μ L Proteinase Ks, mix.
2) add 200 μ L damping fluid GB, fully put upside down and mix, 10min is placed in 56 DEG C of water-baths, puts upside down during this time and mixes for several times, and solution strain is limpid, limpid if solution does not become, and should extend pyrolysis time until solution is limpid.
3) add 200 μ L dehydrated alcohols, fully put upside down and mix, now may occur flocks.
4) previous step gained solution and flocks are proceeded in adsorption column CB3, adsorption column CB3 puts into collection tube, and the centrifugal 30s of 12,000r/min, outwells the waste liquid in collection tube, and adsorption column CB3 is put into collection tube.
5) in adsorption column CB3, add 500 μ L damping fluid GD, the centrifugal 30s of 12,000r/min, outwells the waste liquid in collection tube, and adsorption column CB3 is put into collection tube.
6) in adsorption column CB3, add 600 μ L rinsing liquid PW, the centrifugal 30s of 12,000r/min, outwells the waste liquid in collection tube, and adsorption column CB3 is put into collection tube.
7) repeating step 6).
8) 12, the centrifugal 2min of 000r/min, outwells waste liquid, adsorption column CB3 is placed in to room temperature and places number min, thoroughly to dry rinsing liquid remaining in sorbing material.
9) adsorption column CB3 is proceeded to 1.5mL centrifuge tube, the unsettled dropping 100 μ L elution buffer TB to adsorption film mid-way, room temperature is placed 5min, the centrifugal 2min of 12,000r/min.
10) solution after centrifugal wash-out is added to adsorption column CB3 again, room temperature is placed 5min, and the centrifugal 2min of 12,000r/min, collects solution in centrifuge tube.
2, multiplex PCR amplified reaction
2.1 reagent are prepared: from-20 DEG C of refrigerators, take out multiplex PCR amplifing reagent and the multiple PCR primer of single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene of the present invention and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit, after it thaws naturally, can use.
2.2 amplification systems build:
1) reagent that every increment originally need to add is as follows, the total reaction system configuring is divided and is installed in each PCR reaction tubes, then add respectively DNA masterplate, specifically in table 3.
Table 3 multiplex PCR amplification system
2) the pcr amplification system having added is put into rich day GenePro TC-E-48D gene-amplificative instrament, screwed lid, use table 4 program increases:
Table 4 multiplex PCR amplification reaction condition
Multi-PRC reaction system obtains ALDH2 and mthfr gene amplified production, amplified production melting curve analysis result is as Fig. 2 and Fig. 3, the melting curve analysis peak of two object amplified fragments is single, represent that multi-PRC reaction system and condition reach experiment expection, obtain two purer object amplified productions after multiplex PCR amplified reaction.
3, single stranded DNA sample separation and purifying: use single tube simultaneous determination aldehyde dehydrogenase 2 of the present invention (ALDH2) gene to separate and purified reagent with the single stranded DNA of Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit.
3.1PyroMark Q24 vacuum work station testing experiment: before using PyroMark Q24 vacuum work station, carry out following testing experiment, to check whether filter probe normally works:
1) add 100 μ L high-purity waters in eight unions.
2) fill reagent trough with 70mL high-purity water.
3) start vacuum pump.
4) open vacuum switch, in vacuum preparation facilities, apply vacuum.
5) filtration probe is down in reagent trough.20s does not alter an agreement in holding position.Guarantee that water is transferred in waste container, applied vacuum.As do not shifted, check that pipeline connects.
6) filtration probe is down in eight unions, checks whether all pipes are drawn water equably, and emptying in 10s.
7) if eight unions are not emptying after 10s, start repetition from the first step.If functional verification failure twice, needs to change filtration probe.
3.2 microballons are fixed PCR product: biotin labeled PCR product is fixed on high-performance Streptavidin agarose.
1) jog high-performance Streptavidin agarose, until obtain homogeneous solution.
2) in a test tube, mix high-performance Streptavidin agarose (2 μ L/ sample) and binding buffer liquid (40 μ L/ sample).Then add high-purity water 23 μ L.
3) solution preparing is added in eight unions to each sample 65 μ L.
4), according to orifice plate setting, add the biotin labeled PCR product of 15 μ L to corresponding eight unions.
5) sealing eight unions, guarantee without leaking.
6) use vibrator (1400r/min) vibration 10min, allow high-performance Streptavidin agarose be combined completely with biotin labeled PCR product.
3.3 DNA isolation strands are also discharged into sample in PyroMark Q24 orifice plate
1) guarantee that PyroMark Q24 vacuum work station is correct and assemble securely.Power connection should be as for holding accessible place, in order to rapidly vacuum pump being disconnected from power supply.
2) in reagent trough, add following material
EtOH groove adds 50mL70% ethanolic soln;
DS groove adds 40mLPyroMark denaturing soln;
WB groove adds 50mL1xPyroMark elution buffer;
H
2o groove 1 adds 50mL high-purity water;
H
2o groove 2 adds 70mL high-purity water.
3) open vacuum pump.
4) open vacuum switch, in vacuum unit, apply vacuum.
5) fall probe to high-purity water (reagent trough 5), cleaning and filtering probe.With 70mL high-purity water flushing probe.Guarantee that water is transferred to waste fluid container.
6) close the vacuum switch on vacuum unit, and be placed on rest position.
7) refill reagent trough 5 with 70mL high-purity water.
8) use PyroMark annealing buffer to dilute respectively sequencing primer 1 and sequencing primer 2 to 0.3 μ mol/L.Add sequencing primer that 25 μ L have diluted to each reacting hole of PyroMark Q24 orifice plate to be used.
9) after fixing, immediately eight unions and PyroMark Q24 orifice plate are placed on worktable.Position consistency while guaranteeing orifice plate position and sample loading.
10) open vacuum switch, in vacuum unit, apply vacuum.
11) carefully fall and filter in probe to eight union, to catch the microballon that contains fixed die plate.Keep probe location 15s.The careful vacuum unit that takes out.
12) guarantee that liquid in all eight unions is sucked out and all microballons have been captured to filtration tips of probes.
13) vacuum unit is moved to washing and filtering probe 5s in the EtOH groove that contains 70% ethanol.
14) vacuum unit is moved to washing and filtering probe 5s in the DS groove that contains PyroMark denaturing soln.
15) vacuum unit is moved to washing and filtering probe 10s in the WB groove that contains 1xPyroMark elution buffer.
16) raise vacuum unit and exceed 90 ° of vertical line 5s, discharge opeing from filter probe.
17) grip vacuum unit on PyroMark Q24 orifice plate time, answer the vacuum switch on stopping device.
18), by left and right jog vacuum unit, discharge microballon to containing in the orifice plate of primer to be measured.
19), in the time that vacuum switch is closed, vacuum unit is transferred to the H containing high-purity water
2in O groove 1 and the 10s that vibrates.
20) put down probe to the H containing high-purity water
2in O groove 2 and apply vacuum, clean probe.With 70mL high-purity water washing and filtering probe.
21) raise vacuum unit and exceed 90 ° of vertical line 5s, discharge opeing from filter probe.
22) close the vacuum switch on vacuum unit, and be placed on rest position.
23) if once preparation exceedes an orifice plate, refill reagent trough and since the 8th step repetition.
24) close vacuum pump.
25), in the time of end-of-job, should abandon liquid debris and any surplus solution.Check that there are free from dust and leakage in PyroMark Q24 vacuum work station simultaneously.
3.4 sequencing primer annealing
1) heat with PyroMark Q24 orifice plate base and a heating module PyroMark Q24 orifice plate to the 80 DEG C lasting 2min that contains sample.
2) take off orifice plate from orifice plate seat, make sample at the lower cooling at least 5min of room temperature (15～25 DEG C).Now orifice plate can be processed in PyroMark Q24 instrument.
4, tetra-sodium order-checking and interpretation of result: the tetra-sodium sequencing reagent and the tetra-sodium sequencing primer that use single tube simultaneous determination aldehyde dehydrogenase 2 (ALDH2) gene of the present invention and Methylene tetrahydrofolate reductase (MTHFR) gene mutation site test kit.
The preparation of 4.1 reagent
1) open test kit and take out enzyme complex and the bottle of substrate complex lyophilized powder, pressing sign volume lytic enzyme and the substrate of reagent bottle with high-purity water.
2) add respectively enzyme complex, substrate complex and α-sulfo-deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, deoxythymidine triphosphate according to the reagent volume of PyroMark Q24 computed in software gained to corresponding position in PyroMark Q24 agent bin.
4.2 move order-checking program on PyroMark Q24 instrument
4.2.1 start instrument
1), before opening instrument switch, guarantee that attaching plug is connected to suitable ground connection and have in the supply socket of correct voltage and frequency, and attaching plug easily touches, by the needing from power supply disconnection by instrument rapidly.
2) open instrument switch.Power switch is positioned at the instrument back side.
4.2.2 loaded reagent storehouse and orifice plate:
1) in the time of instrument standby, open instrument lid.
2) open agent bin valve and insert the agent bin of populated reagent, label is outside.After first pushing agent bin completely, pressed down again.
3) guarantee that agent bin suitably inserts, it is visible that the line before agent bin keeps, and then closes valve.
4) open orifice plate mounting, and orifice plate is placed on the heating module in instrument.
5) close orifice plate mounting and instrument lid.
4.2.3 select operating file and start operation
1) by the USB port before the USB flash disk inserting instrument that contains operating file.
2) use ▲ and
button screen, in master menu, select " Run(operation) " and by " OK ".
3) use ▲ and
button screen is selected operating file.Want the content of browse through folders, select File presss from both sides and presses " Select(selection) ".Return to last view, by " Back(retreats) ".
4) while selecting operating file, by " Select(selection) " start and move.
4.2.4 monitoring operation
When divider pressure, mixer speed, heating module temperature, processing storehouse lid and cooling fluid reach preset level, instrument will start to distribute reagent.
4.2.5 after operation
1) when instrument confirms that operating file has been saved to USB flash disk, by " Close(closes) ".
2) take out USB flash disk.
3) open instrument lid.
4) open the valve of agent bin, mention and pull out agent bin.
5) close valve.
6) open orifice plate mounting, take off soon orifice plate from heating.
7) close orifice plate mounting and instrument lid.
8) discarded orifice plate.
9) cleaning agents storehouse.
Remaining any solution in A scavenger reagent storehouse
The compartment in B employing high-purity water wash reagent storehouse 4 times.
C uses high-purity water to spray syringe needle outside.
D agent bin is thoroughly filled compartment drip washing syringe needle with high-purity water.Grip agent bin above reagent trough or beaker, be both with a finger tightly by being pressed in each compartment top (wearing powder-free gloves).
E checks that whether syringe needle is clean.Water bundle will directly be penetrated from the top of each syringe needle.If syringe needle blocks, if syringe needle blocks, use high-purity water filling compartment, then agent bin is immersed in the beaker of enough high-purity waters, cover syringe needle.Agent bin is positioned over to 1h in beaker, cleans, and repeat D.
F checks whether water bundle directly penetrates from syringe needle direction.If its angled outflow, water refills compartment and repeats.If it is angled outflow still, abandoned reagents storehouse.
G when all syringe needles all through drip washing and test after, outwell water, agent bin side is come to be placed on without drying on art printing paper.
After H agent bin dries, be kept at dustless place.
4.2.6 analyze operation
1) operating file is moved to the computer of operation PyroMark Q24 software from USB flash disk.
2) double-click the operating file of opening in quick browser.If comprised several type of detection, the analytical model in the dialog box of selecting to open.
3), in " Overview(general introduction) " label, adopt effective analysis setting of present analysis pattern to analyze all reacting holes or a group reaction hole.
4) between pattern, switch, in toolbar, select " AQ ", " CpG " or " SQA ".
Examinee A detected result is as Fig. 4, ALDH2(rs671) be G/A genotype, and Fig. 6, MTHFR(rs1801133) be G/A genotype, this individuality is all poor to the metabolic capacity of ethanol and folic acid, and suggestion is controlled Ethanol intake and increased the occurrence risk to reduce relative disease of supplementing of folic acid.
Pregnant woman B and C wish are understood self impact on fetation with assessment on folic acid metabolism ability, also wish understanding self alcohol metabolism ability situation of pregnant woman C simultaneously, utilize test kit of the present invention and method to detect assessment, both testing processes are identical with embodiment 1.The MTHFR(rs1801133 of pregnant woman B) detected result is all as Fig. 7, is G/G genotype; The MTHFR(rs1801133 of pregnant woman C) detected result is all as Fig. 8, is A/A genotype, the ALDH2(rs671 of pregnant woman C) detected result as Fig. 5 be G/G genotype; Therefore pregnant woman B has normal folic acid metabolism ability, normal amount Supplement of folic acid, pregnant woman B alcohol metabolism ability is normal, the risk of the abnormal relative disease of ALDH2 genotype is lower, but its folic acid metabolism ability is poor, need to supplement the detrimentally affect that more folic acid of volume brings fetation with prevention folic acid deficiency.
Have the whether suitable selection pannonit of patient D wish understanding self of heart infarct medical history as quick-acting expansion blood vessel first aid medicines, utilize test kit of the present invention and method to detect assessment, testing process is identical with embodiment 1.The ALDH2(rs671 of result patient D) detected result as Fig. 5 be G/G genotype, this patient has normal metabolic capacity to pannonit, pannonit should be actively effective for this patient's expansion blood vessel first aid.
The routine examinee of table 531 uses test kit of the present invention and method to detect ALDH2(rs671) and MTHFR(rs1801133) single nucleotide polymorphism result
31 routine physical examination of healthy populations use test kit of the present invention and method joint-detection ALDH2(rs671) and MTHFR(rs1801133) single nucleotide polymorphism sudden change, all operations is all with embodiment 1, and result is as table 5.
15 examples intend using pannonit patient to utilize test kit of the present invention and method joint-detection ALDH2(rs671) single nucleotide polymorphism sudden change, all operations is all with embodiment 1, and result is as table 6.
Table 615 example intends using pannonit patient to use test kit of the present invention and method to detect ALDH2(rs671) result
The routine pregnant woman of table 712 uses test kit of the present invention and method to detect ALDH2(rs671) and MTHFR(rs1801133) single nucleotide polymorphism result
12 routine pregnant woman use test kit of the present invention and method joint-detection ALDH2(rs671) and MTHFR(rs1801133) single nucleotide polymorphism sudden change, all operations is all with embodiment 1, and result is as table 7.
Claims (2)
1. the test kit of single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutation site, is characterized in that comprising:
(1) Whole Blood Genomic DNA is extracted reagent: described Whole Blood Genomic DNA is extracted reagent source and extracted test kit in commercial poba gene group, and main component has damping fluid GD, damping fluid GB, Proteinase K, adsorption column CB3, rinsing liquid PW and elution buffer TB;
(2) multiplex PCR amplimer: described multiplex PCR amplimer comprises:
PCR primer 1(Seq NO1):
ALDH2Glu504Lys(rs671) upstream primer 5 '-CAGTCACCCTTTGGTGGCTACA-3 ';
PCR primer 2 (Seq NO2):
ALDH2Glu504Lys(rs671) downstream primer 5 '-CCAGCAGGTCCCACACTCAC-3 ';
PCR primer 3(Seq NO3):
MTHFR C677T(rs1801133) upstream primer 5 '-GGCTGACCTGAAGCACTTGAA-3 ';
PCR primer 4(Seq NO4):
MTHFR C677T(rs1801133) downstream primer 5 '-CAAGTGATGCCCATGTCGGT-3 ';
Wherein 5 ' of primer 1 and primer 3 end all carries out biotin labeling;
(3) multiplex PCR amplification reaction reagent: described multiplex PCR amplification reaction reagent is called " 2X PyroMark PCR Master Mix ", concrete composition comprises warm start TaqDNA polysaccharase, deoxyribonucleoside triphosphate dNTPs, magnesium ion Mg
2+, sodium ion Na
+and amplified reaction specificity toughener Q-Solution;
(4) single stranded DNA separates and purified reagent: described single stranded DNA separates and purified reagent, comprises Streptavidin agarose, PyroMark binding buffer liquid, PyroMark denaturing soln and PyroMark elution buffer 10X concentrated solution;
(5) tetra-sodium sequencing primer: described tetra-sodium sequencing primer comprises:
Sequencing primer 1(Seq NO5):
ALDH2Glu504Lys(rs671) sequencing primer 5 '-CACACTCACAGTTTTCACTT-3 ';
Sequencing primer 2(Seq NO6):
MTHFR C677T(rs1801133) sequencing primer 5 '-TGCGTGATGATGAAAT-3 ';
(6) tetra-sodium sequencing reagent: described tetra-sodium sequencing reagent is the conventional reagent of DNA tetra-sodium order-checking, comprise PyroMark annealing buffer, enzyme complex, substrate complex and deoxyribonucleoside triphosphate mixture dNTP, wherein dATP is manually modified α-sulfo-deoxyadenosine triphosphate, all the other deoxycytidine triphosphates, deoxyguanosine triphosphate, deoxythymidine triphosphate unmodified; Described enzyme complex comprises the check order enzyme of all needs of tetra-sodium, i.e. archaeal dna polymerase, ATP sulfurylase, luciferase, apyrase; Described substrate complex is 5'-AMP sulphuric anhydride;
(7) box body: Whole Blood Genomic DNA is extracted reagent, multiplex PCR amplimer, multiplex PCR amplification reaction reagent, single stranded DNA separation and purified reagent, tetra-sodium sequencing primer, tetra-sodium sequencing reagent and is located in box body.
2. the method for single tube simultaneous determination aldehyde dehydrogenase 2 and Methylene tetrahydrofolate reductase gene mutation site, it is characterized in that adopting the test kit of single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutation site as claimed in claim 1, comprise the steps:
(1) human whole blood extracting genome DNA: the Whole Blood Genomic DNA Extraction parts reagent that adopts described single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutation site test kit, comprise and utilize damping fluid GB and Proteinase K to dissolve peripheral blood leucocyte, damping fluid GD and rinsing liquid PW remove protein ingredient, finally obtain DNA composition with elutriant TB wash-out, whole abstraction reaction is taking adsorption column CB3 as DNA and the medium of cell debris and DNA and protein separation;
(2) multiplex PCR amplified reaction: adopt multiple PCR primer and the multiplex PCR amplification reaction reagent of described single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutation site test kit, concrete reaction system and reaction conditions are as shown in Table 1 and Table 2;
Table 1 multiplex PCR amplification reaction system
Table 2 multiplex PCR amplification reaction condition
(3) single stranded DNA sample separation and purifying: adopt described single tube simultaneous determination aldehyde dehydrogenase 2 gene to separate and purified reagent with the single stranded DNA of Methylene tetrahydrofolate reductase gene mutation site test kit, be included in the combination of high-performance Streptavidin agarose under PyroMark binding buffer liquid condition and the PCR product with vitamin H, and isolate single stranded DNA product, then obtain respectively the single stranded DNA sample of purifying through 70% ethanol, PyroMark denaturing soln and PyroMark elution buffer;
(4) tetra-sodium order-checking and interpretation of result: the tetra-sodium sequencing primer and the tetra-sodium sequencing reagent that adopt described single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutation site test kit, concrete operations are to be diluted in the sequencing primer 1 of 0.3 μ mol/L and sequencing primer 2 and to put into the single stranded DNA product of purifying at 25 μ L PyroMark annealing buffers respectively, after 80 DEG C of continuous heating 2min, cooling at least 5min at 15～25 DEG C, in PyroMark Q24 agent bin, add the enzyme complex of system-computed gained simultaneously, the volume separately of substrate complex and four kinds of deoxyribonucleoside triphosphates, then on PyroMark Q24 instrument, move order-checking program, after finishing, finally order-checking carries out interpretation of result in PyroMark Q24 analysis software operation AQ pattern.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410067910.1A CN103834733A (en) | 2014-02-27 | 2014-02-27 | Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410067910.1A CN103834733A (en) | 2014-02-27 | 2014-02-27 | Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103834733A true CN103834733A (en) | 2014-06-04 |
Family
ID=50798625
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410067910.1A Pending CN103834733A (en) | 2014-02-27 | 2014-02-27 | Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834733A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177159A (en) * | 2015-05-14 | 2015-12-23 | 长沙三济生物科技有限公司 | Primer pair and kit for detecting ALDH2 (Aldehyde Dehydrogenase 2) genotype with pyrosequencing method |
| CN106987623A (en) * | 2017-03-20 | 2017-07-28 | 杭州迪安医学检验中心有限公司 | A kind of primer of pyrosequencing joint PCR sequencing PCR detection alcohol metabolism gene and its application |
| CN113528629A (en) * | 2021-06-15 | 2021-10-22 | 湖南菲思特精准医疗科技有限公司 | Detection kit for methotrexate metabolic marker, detection method and application thereof |
| CN113584143A (en) * | 2021-06-09 | 2021-11-02 | 湖南菲思特精准医疗科技有限公司 | Detection kit for nitroglycerin metabolism marker and detection method and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1563421A (en) * | 2004-04-21 | 2005-01-12 | 浙江大学 | Polymorphism detection chip for gene of enzyme relevant to ethanol metabolism, preparation method of usage |
| CN101354342A (en) * | 2007-07-27 | 2009-01-28 | 上海主健生物工程有限公司 | Reagent kit for detecting cigarette and wine damnification genetic susceptibility |
| CN101760530A (en) * | 2008-12-26 | 2010-06-30 | 上海基康生物技术有限公司 | Method for detecting stroke related locus |
| CN102146438A (en) * | 2010-12-22 | 2011-08-10 | 协和干细胞基因工程有限公司 | Kit for detecting alcoholic liver disease susceptibility |
| CN102533991A (en) * | 2011-12-27 | 2012-07-04 | 盛司潼 | Method and kit for detecting drinking gene |
| CN102876782A (en) * | 2012-09-13 | 2013-01-16 | 周宏灏 | Kit for detecting acetaldehyde dehydrogenase 2 (ALDH2) gene polymorphism by pyro-sequencing method and method |
| CN103184268A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | Kit for detecting aldehyde dehydrogenase 2 gene polymorphism and amplification method and detection method thereof |
| CN103525904A (en) * | 2013-07-11 | 2014-01-22 | 上海中优医药高科技有限公司 | Method for detecting genetic types of mitochondria acetaldehyde dehydrogenase by utilizing high-resolution melting curve analysis technology |
-
2014
- 2014-02-27 CN CN201410067910.1A patent/CN103834733A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1563421A (en) * | 2004-04-21 | 2005-01-12 | 浙江大学 | Polymorphism detection chip for gene of enzyme relevant to ethanol metabolism, preparation method of usage |
| CN101354342A (en) * | 2007-07-27 | 2009-01-28 | 上海主健生物工程有限公司 | Reagent kit for detecting cigarette and wine damnification genetic susceptibility |
| CN101760530A (en) * | 2008-12-26 | 2010-06-30 | 上海基康生物技术有限公司 | Method for detecting stroke related locus |
| CN102146438A (en) * | 2010-12-22 | 2011-08-10 | 协和干细胞基因工程有限公司 | Kit for detecting alcoholic liver disease susceptibility |
| CN102533991A (en) * | 2011-12-27 | 2012-07-04 | 盛司潼 | Method and kit for detecting drinking gene |
| CN103184268A (en) * | 2011-12-28 | 2013-07-03 | 协和干细胞基因工程有限公司 | Kit for detecting aldehyde dehydrogenase 2 gene polymorphism and amplification method and detection method thereof |
| CN102876782A (en) * | 2012-09-13 | 2013-01-16 | 周宏灏 | Kit for detecting acetaldehyde dehydrogenase 2 (ALDH2) gene polymorphism by pyro-sequencing method and method |
| CN103525904A (en) * | 2013-07-11 | 2014-01-22 | 上海中优医药高科技有限公司 | Method for detecting genetic types of mitochondria acetaldehyde dehydrogenase by utilizing high-resolution melting curve analysis technology |
Non-Patent Citations (1)
| Title |
|---|
| MAHO HIROSE ET AL: "Genetic polymorphisms of methylenetetrahydrofolate reductase and aldehyde dehydrogenase 2, alcohol use and risk of colorectal adenomas:Self-Defense Forces Health Study", 《 JAPANESE CANCER ASSOCIATION》, vol. 96, no. 8, 31 August 2005 (2005-08-31) * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177159A (en) * | 2015-05-14 | 2015-12-23 | 长沙三济生物科技有限公司 | Primer pair and kit for detecting ALDH2 (Aldehyde Dehydrogenase 2) genotype with pyrosequencing method |
| CN106987623A (en) * | 2017-03-20 | 2017-07-28 | 杭州迪安医学检验中心有限公司 | A kind of primer of pyrosequencing joint PCR sequencing PCR detection alcohol metabolism gene and its application |
| CN106987623B (en) * | 2017-03-20 | 2021-01-26 | 杭州迪安医学检验中心有限公司 | Primer for detecting alcohol metabolism gene by pyrosequencing combined sequencing method and application thereof |
| CN113584143A (en) * | 2021-06-09 | 2021-11-02 | 湖南菲思特精准医疗科技有限公司 | Detection kit for nitroglycerin metabolism marker and detection method and application thereof |
| CN113528629A (en) * | 2021-06-15 | 2021-10-22 | 湖南菲思特精准医疗科技有限公司 | Detection kit for methotrexate metabolic marker, detection method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103820553B (en) | Be used to guide multiplex PCR associating Manganic pyrophosphate complex initiation test kit and the detection method thereof of warfarin personalized medicine | |
| CN103789446B (en) | Manganic pyrophosphate complex initiation clopidogrel personalized medicine genetic polymorphism detection test kit and detection method thereof | |
| CN103834733A (en) | Kit and method for determining mutation sites of genes of acetaldehyde dehydrogenase 2 and methylene tetrahydrofolic acid reductase by virtue of single tube at the same time | |
| Farkas et al. | Epigenetic alterations in folate transport genes in placental tissue from fetuses with neural tube defects and in leukocytes from subjects with hyperhomocysteinemia | |
| CN109136365B (en) | Detection method for children personalized medication analysis based on SNP (Single nucleotide polymorphism) locus and application thereof | |
| Li et al. | CCL2 promoter hypomethylation is associated with gout risk in Chinese Han male population | |
| CN106636337A (en) | Clopidogrel drug-resistant gene detection method based on multiple HRM analysis | |
| TWI694152B (en) | Gene marker for detecting liver cancer and its use | |
| CN102586473B (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN204162727U (en) | The test kit in single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutational site | |
| CN102816839A (en) | Kit for detecting hot spot mutation sites in colorectal cancer PIK3CA gene | |
| CN105886606A (en) | Kit for rapid detection of polymorphism of Warfarin metabolic enzyme gene by virtue of pyrosequencing method and application of kit | |
| CN109097459B (en) | Detection method for adult common anti-infective drug administration analysis based on SNP locus and application thereof | |
| CN107523646A (en) | Method based on nucleic acid mass-spectrometric technique detection early diagnosing mammary cancer related gene | |
| CN104328200A (en) | Detection kit and detection method for auxiliary diagnosis of Alzheimer's disease | |
| CN105648082A (en) | Primer-probe combination and kit for detecting associated genotyping of warfarin medication | |
| CN108165615A (en) | A kind of method and kit with the relevant Genotyping of folic acid metabolism | |
| CN111471757A (en) | Method for detecting MTHFR methylene tetrahydrofolate reductase SNP mutation based on KASP technology | |
| CN103695534B (en) | Detect primer and the method for the C829T single nucleotide polymorphism of DHFR | |
| CN109486940A (en) | A kind of primer sets and detection kit expanding entocranial artery tumor-related gene | |
| CN105274197A (en) | Quality control method and kit used for biological sample nucleic acid detection | |
| CN106947815B (en) | Method and special primer for detecting accurate medication of aspirin and nitroglycerin | |
| CN104946735A (en) | Kit and method for determining genotype of predetermined SNP site of DNA sample to be tested | |
| Zidan et al. | Methylenetetrahydrofolate reductase C677T gene polymorphism and diabetic nephropathy susceptibility in patients with type 2 diabetes mellitus | |
| CN106702497B (en) | Kit for detecting free DNA in peripheral blood of pregnant woman and library building method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140604 |