CN103834656A - Application of SCWBC11 protein in culture of male sterility line of rice - Google Patents
Application of SCWBC11 protein in culture of male sterility line of rice Download PDFInfo
- Publication number
- CN103834656A CN103834656A CN201210488325.XA CN201210488325A CN103834656A CN 103834656 A CN103834656 A CN 103834656A CN 201210488325 A CN201210488325 A CN 201210488325A CN 103834656 A CN103834656 A CN 103834656A
- Authority
- CN
- China
- Prior art keywords
- sequence
- oswbc11
- plant
- rice
- dna molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses an application of a SCWBC11 protein in culture of a male sterility line of rice, and provides an application of a substance which is expressed by an OSWBC11 protein coding gene in a silent or inactivated target plant to culture of a male sterile plant. In the application, the amino acid sequence of the OSWBC11 protein is the sequence 2 in the sequence table. The target plant is dicotyledon or monocotyledon and monocotyledon is specifically rice. Experiments verify that by adopting an RNA (Ribonucleic Acid) interference method, OSWBC11 protein expression interference is carried out on wild rice Nipponbare, so that the protein function is lost and rice cannot produce pollen, thereby forming the male sterility line. Therefore, the protein has an important application value to the forming mechanism of pollen of rice and the application of the protein to crossbreeding of rice can be explored.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of OSWBC11 albumen in the application of cultivating in male sterible series of rice.
Background technology
Paddy rice is one of world's Three major grain crops, approximately has in the world the population of half taking rice as main food.China rice accounts for global 23% as area, rice yield accounts for global 37% left and right.The rice growing area of China accounts for 30% of national food crop sown area, and ultimate production accounts for the more than 42% of food crop output, yield per unit on average exceeds 45.7% than whole food crop, and one of them important reason is exactly heterotic widespread use.Hybrid vigour is a kind of universal phenomenon of organic sphere, refers to two parent's hybridization that heredity is different, and first generation of hybrid the Characters has stronger vitality, growth potential, resistance, adaptability and yielding ability than parents.Hybrid rice shows significant hybrid vigour in many proterties, and general performance is at aspects such as nutritional advantages, Reproductive heterosis, resistance advantage and quality heterosis.Applying of hybrid rice, for the increases in grain production in China and even the world make a great contribution.
The basis that rice heterosis can effectively utilize is male sterility of rice.Plants male sterility is can not produce the phenomenon with normal function pollen in plant sexual reproduction process, and this phenomenon ubiquity in higher plant is effectively to utilize hybrid vigour, improves prerequisite and the basis of crop yield.Divide from genotype composition angle, the male sterile of paddy rice is divided into: nuclear male sterility (Genie Male Sterility, and nucleo-cytoplasmic interreaction male sterility (that is cytoplasmic male sterility, Cytoplasmic Male Sterility, CMS) GMS).Nuclear male sterility is by the control of nucleus sterile gene, without positive and negative friendship hereditary effect.According to the aobvious recessive relation between sterile gene and corresponding educated gene, can be divided into again recessive cytoblast sterile and dominant genic male sterile, the male nuclear sterile of most plants belongs to recessive cytoblast sterile, accounts for 88%.Dominant genic male sterile paddy rice can educate and sterile separating than for 1:1 because of its F1 generation, conventionally not only without restorer but also without maintenance line, can not be directly used in production; Single-gene recessive cytoblast sterile, dual-gene recessive cytoblast sterile and polygene recessive cytoblast sterile, these a few class sterile lines, because be difficult to find corresponding maintenance line on producing, can not be realized three series mating, have limited its application in heterosis utilization.So far comparatively successfully applying recessive cytoblast sterile is that rice photo-thermo-sensitive core is sterile.In paddy rice, find that there is the responsive male sterility line of light (temperature), be divided into temperature sensitive type, Photosensitive and warm light interaction type.
Summary of the invention
An object of the present invention is to provide the material of OSWBC11 protein coding gene expression in silence or inactivation object plant in the application of cultivating in male sterile plants.
The invention provides the material of OSWBC11 protein coding gene expression in silence or inactivation object plant in the application of cultivating in male sterile plants; The aminoacid sequence of described OSWBC11 albumen is the sequence 2 in sequence table.
In above-mentioned application: the nucleotides sequence of described OSWBC11 protein coding gene is classified the sequence 1 in sequence table as; Described object plant is dicotyledons or monocotyledons; Described monocotyledons is specially paddy rice.
In above-mentioned application, in described silence or inactivation object plant OSWBC11 protein coding gene express material be following 1)-3) and at least one:
1) RNA molecule, it is from the DNA molecule encode RNA shown in 5 ' end 9-1057 position Nucleotide by the sequence 3 in sequence table;
2) DNA molecular, its nucleotides sequence is classified sequence 3 in sequence table as from the DNA molecular shown in 5 ' end 9-1057 position Nucleotide;
3) recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain described DNA molecular.
Above-mentioned recombinant vectors is the carrier that the sequence in sequence table 3 is obtained from the Pst I site of 5 ' end 9-1057 position Nucleotide insertion pCAMBIA2300-Actin.
Another object of the present invention is to provide a kind of DNA molecular.
DNA molecular provided by the invention, is made up of forward fragment, intron and reverse fragment; Described forward fragment is any one fragment in OSWBC11 protein coding gene; The nucleotides sequence of described reverse fragment is classified the reverse complementary sequence of described forward fragment as; The aminoacid sequence of described OSWBC11 albumen is the sequence 2 in sequence table;
The nucleotides sequence of described OSWBC11 protein coding gene is classified the sequence 1 in sequence table as;
The nucleotides sequence of described forward fragment is classified sequence 1 in the sequence table sequence 3 in 5 ' end 739-1157 position Nucleotide or sequence table as from 5 ' end 9-427 position Nucleotide.
The nucleotides sequence of above-mentioned DNA molecular is classified sequence 3 in sequence 3 or the sequence table in sequence table as from 5 ' end 9-1057 position Nucleotide.
Also be the scope of protection of the invention by the RNA of above-mentioned DNA molecule encode.
The recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain above-mentioned DNA molecular.
Above-mentioned recombinant vectors is the carrier that the sequence in sequence table 3 is obtained from the Pst I site of 5 ' end 9-1057 position Nucleotide insertion pCAMBIA2300-Actin.
Above-mentioned DNA molecular, above-mentioned RNA or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium are also the scope of protection of the invention in the application of cultivating in male sterile plants; In above-mentioned application, described plant is specially dicotyledons or monocotyledons; Described monocotyledons is further specially paddy rice.
The 3rd object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention, in silence or inactivation object plant, OSWBC11 protein coding gene is expressed, and obtains transgenic plant, and described transgenic plant are male sterile plants.
In aforesaid method, in described silence or inactivation object plant, OSWBC11 protein coding gene is expressed as above-mentioned DNA molecular is imported in object plant, obtains transgenic plant; Described transgenic plant are male sterile plants.
In aforesaid method, described object plant is specially dicotyledons or monocotyledons; Described monocotyledons is further specially paddy rice.
Above-mentioned DNA molecular imports in object plant by above-mentioned recombinant vectors.
The present invention of experiment showed, of the present invention obtains a fine mutagenesis male-sterile mutation body of japonica rice Japan, finds out a gene WBC11 (white-brown complex homolog protein 11), its a kind of cross-film transport protein of encoding.Adopt method that RNA disturbs to carry out the interference of OSWBC11 protein expression by fine wild-type paddy rice Japan, make the forfeiture of protein function, cause paddy rice cannot produce pollen, form male sterile line.Therefore the mechanism that this albumen forms paddy pollen has important using value, and can explore and use it for paddy rice cross breeding breeding.
Brief description of the drawings
Fig. 1 is wild-type (left side) and wbc11 mutant (right side) phenotypic map
Fig. 2 is ripening stage flower pesticide semithin section
Fig. 3 is OSWBC11 map based cloning schematic diagram and OSWBC11 gene structure figure and sudden change position.
Fig. 4 is the phenotype that wild-type and RNA disturb plant
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
The phenotype of embodiment 1, rice male sterility mutant wbc11 and genetic analysis
1, the phenotype analytical of male-sterile mutation body wbc11
Rice male sterility mutant wbc11 is by processing and obtain the fine seed of wild-type Japan with ethylmethane sulfonate (EMS).Wbc11 mutant vegetative growth phase with contrast Japan fine comparing there is no notable difference, after heading, mutant just shows typical male sterile phenotype, show as the flower pesticide transparence that is white in color, the pollen that sheds can not ftracture, finally also cannot produce normal seed (Fig. 1, the plant that wherein A is heading stage; B is the tassel in ripening stage; C is pollen maturation phase flower pesticide).Wbc11 mutant is authorized to the pollen of wild-type, found that it can be normally solid, and this cenospecies can normal germination and growth, its plant at survival rate, the aspects such as reproductive growth of nourishing and growing all with wild-type plant no significant difference, show that mutant is female to educate.
2, the flower pesticide sections observation of mutant wbc11 is analyzed
Semithin section by and mutant wbc11 ripening stage flower pesticide fine to wild-type Japan is observed, in the pollen sac of discovery wild-type flower pesticide, form the mature flower powder that can be dyeed by toluidine blue dye liquor, and atrophy of mutant pollen sac of the same period, the inside does not have polliniferous formation, but exist residue (Fig. 2 that some can be colored, A is that wild-type Japan is fine, and B is wbc11 mutant).
3, the genetic analysis of rice male sterility mutant wbc11
In rice male sterility mutant wbc11 and wild-type long-grained nonglutinous rice, Xian 3037 hybridization obtain F1 generation, and F1 selfing obtains F2 generation, and F2 is carried out to phenotypic evaluation for plant, and its qualification result, as table 1, shows that this proterties of male sterility of rice meets Dominant gene genetic development.In table 1, normal strain number refers to the strain number with wild-type plant phenotype, and male sterile Wbc1l strain number refers to the strain number with Wbc11 phenotype.
The genetic analysis of table 1 rice male sterility mutant wbc11
| Combination | Normal strain number | Wbc11 phenotype strain number | Total strain number | Separate ratio |
| wbc11/3037 | 174 | 54 | 228 | 3.22:1 |
The map based cloning of embodiment 2, OsWBC11 gene
In order to clone OsWBC11 gene, the recessive individual wbc11 of 54 strain male sterile in F2 colony is carried out to the Primary Location of OsWBC11 gene.The STS mark that preserve application experiment chamber, utilizes PCR method, by the OsWBC11 assignment of genes gene mapping at No. 10 long-armed physical location 18.47(Ac09120-28 of karyomit(e)) to 18.96(Ac068923-75) and between in the scope of about 500K.Next for WBC11 gene is carried out to meticulousr location, from F3 colony, obtained 338 plant mutant body surface type plant, and newly designed multiple STS marks (table 2).Through F3 colony is carried out to STS labeled analysis, finally by the OsWBC11 assignment of genes gene mapping between Ac023240-45 and these two STS marks of Ac068950-97, physical distance is therebetween about 180kb(Fig. 3, A, OsWBC11 map based cloning schematic diagram.B, OsWBC11 gene structure figure and sudden change position, black rectangle represents exon, grey rectangle part represents non-translational region, black line represents intron).Utilize rice genome annotation database (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/) analysis to show, in this segment distance, exist 2 BAC, be respectively OSJNBa0051D19 and OSJNBa0041P03.Next in lock-in range, carry out candidate gene prediction and its genome sequence is checked order, found that annotation is for white-brown complex homolog protein 11(Os10g35180) gene in the ORF of its prediction, there is the single base mutation of a C to T, cause having formed a terminator codon, in translation, by causing the premature termination of translation, be OsWBC11 by this unnamed gene.
The genome sequence size of gene OsWBC11 is 6360bp, comprise 10 exons and 9 introns, wherein the ORF length of OsWBC11 gene is 2712bp, its nucleotides sequence is classified the sequence 1 in sequence table as, the albumen called after OsWBC11 of this ORF coding, the aminoacid sequence of this albumen is the sequence 2 in sequence table, is made up of 723 amino-acid residues.
The STS mark that this research of table 2 is newly developed
The functional verification of embodiment 3, OSWBC11 gene
1, RNA disturbs the acquisition of recombinant vectors
With Japonica rice (Japonica) Japan fine (Nipponbare) (The Plant Cell, Vol.24:577 – 588, February 2012; The public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity, below also referred to as wild-type paddy rice) young fringe cDNA is as template, carry out pcr amplification with following primer CTCGAGTGCTTCAGCGTTCTTCGTG and GGATCCGTGCCATCTCATTGACTTTC, obtain the PCR product of about 430bp, there is sequence 1 in sequence table through this PCR product of order-checking and, from restriction enzyme site Xho I and the BamH I of 5 ' end 739-1157 position Nucleotide and two ends interpolation, this PCR product is named to forward fragment.
The PCR product of 430bp (3 ' has 3 ' the outstanding cohesive end fragment of base A) is reclaimed to test kit (Biomed with Biomed glue, 28706) carry out purifying by product description, then with pMD19-T(Takara, D101) carrier connection, obtain carrier pMD19-WBC; Then obtain about 420bp fragment 1 with Xho I and BamH I double digestion carrier pMD19-WBC11, with Bgl II and Xho I double digestion carrier pUCC-RNAi(The Plant Cell, Vol.24:2562 – 2577, June 2012; The public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity) obtain about 2800bp fragment 2, fragment 1,2 is connected and obtains carrier pUCCWBC11-1; With BamH I and Sa1 I, carrier pUCCWBC11-1 is carried out to double digestion again and obtain about 3200bp fragment 3; Again fragment 1 is connected and obtains carrier pUCCWBC11-2 with fragment 3; Finally with Pst I, pUCCWBC11-2 carrier single endonuclease digestion is obtained to about 1000bp fragment 4(sequence 3); By fragment 4 and the over-express vector pCAMBIA2300-Actin(Journal of Cell Science 122 cutting through same enzyme, 2055-2063,2009; The public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity) be connected, obtain RNAi interference carrier pWBC11RNAi; Above-mentioned RNAi interference carrier pWBC11RNAi is carried out to enzyme with Pst I and cut checking, enzyme is cut product and is about the positive carrier of 1000bp.
Through order-checking, the carrier of this pWBC11RNAi for sequence 3 is obtained from the Pst I site of 5 ' end 9-1057 position Nucleotide insertion expression vector pCAMBIA2300-Actin.
In sequence table, the DNA molecular shown in sequence 3 comprises forward fragment, intron and reverse fragment, and wherein the nucleotides sequence of forward fragment is classified the sequence 1 of sequence 3 in 5 ' end 9-427 position Nucleotide or sequence table as from 5 ' end 739-1157 position Nucleotide; The nucleotides sequence of intron is classified as in sequence 3 from 5 ' end 434-632 position Nucleotide (intron St-GA20oxiIN sequence is from pUCC-RNAi carrier); Oppositely fragment is that sequence 3 is from 5 ' end 639-1057 position Nucleotide.
2, the acquisition of RNA interference of transgene paddy rice
Method by electric shock proceeds to positive carrier pWBC11RNAi in Agrobacterium (AgroBacterium tumefaciens) strain EHA105, obtain recombinant bacterium EHA105/pWBC11RNAi, extraction plasmid carries out enzyme with Pst I and cuts checking, and enzyme is cut product and is about the positive recombinant bacterium EHA105/pWBC11RNAi of 1000bp.
Positive recombinant bacterium EHA105/pWBC11RNAi is proceeded in Japonica rice (Japonica) Japan fine (below also referred to as wild-type paddy rice), obtain T0 for RNA interference of transgene paddy rice, concrete method for transformation is as follows:
By cutting out after the rataria sterilizing of the fine seed of wild-type paddy rice Japan, be inoculated into the substratum (463mg/l (NH of evoked callus
4)
2sO
4, 2830mg/l KNO
3, 166mg/l CaCl
22H
2o, 185mg/l MgSO
47H
2o, 400mg/l KH
2pO
4, 0.8mg/l KI, 1.6mg/l H
3bO
3, 4.4mg/l MnSO
44H
2o, 1.5mg/lZnSO
47H
2o, 27.8mg/l FeSO
47H
2o, 37.3mg/l Na
2-EDTA2H
2o, 100mg/l inositol, 2mg/l glycine, 0.52mg/l nicotinic acid, 12mg/l VB1,0.52mg/l VB6,0.5g/l caseinhydrolysate, 30g/l sucrose, 10g/l glucose, 2mg/l 2,4-D, 2.5g/l vegetable jelly, pH5.2.Before the system of falling is dull and stereotyped, add the Syringylethanone of 100-400 μ M) in, cultivate after 1 week, select growth vigorous, color is pale yellow, and more open embryo callus, as transformation receptor; Positive recombinant bacterium EHA105/PWBC11RNAi is cultured to OD
600for 0.8-1.0, obtain recombinant bacterium EHA105/PWBC11RNAi bacterium liquid; Infect transformation receptor with positive recombinant bacterium EHA105/PWBC11RNAi bacterium liquid, cultivate after 3 days selection substratum (the 640mg/l NH that is containing 50mg/L Totomycin at dark place for 25 DEG C
4nO
3, 1212mg/l KNO
3, 588mg/l CaCl
22H
2o, 247mg/lMgSO
47H
2o, 136mg/l KH
2pO
4, 0.83mg/l KI, 3.1mg/l H
3bO
3, 11.15mg/l MnSO
44H
2o, 5.76mg/l ZnSO
47H
2o, 27.8mg/l FeSO
47H
2o, 37.3mg/l Na
2-EDTA2H
2o, 90mg/l inositol, 2mg/l glycine, 6mg/l nicotinic acid, 8.5mg/l VB1,1mg/l VB6,0.5g/l caseinhydrolysate, 20g/l sucrose, 36.43g/l N.F,USP MANNITOL, 2mg/l 2,4-D, 2.5g/l vegetable jelly, pH5.8.Before system is dull and stereotyped, add 50mg/l Totomycin) upper screening transfer-gen plant; Hygromycin resistance plant is practiced to seedling in the cool, after 7 days, be transplanted to paddy field, obtain T0 for RNA interference of transgene paddy rice (can select the plant growing on substratum to be the plant that has proceeded to carrier at Totomycin, non-transgenic plant cannot grow).
Using T0 for the genomic dna of RNA interference of transgene paddy rice as template, with primer WBC11 (F:TGCTTCAGCGTTCTTCGTG, R:GTGCCATCTCATTGACTTTC) carry out pcr amplification, can obtain a treaty 420bp(from pWBC11RNAi carrier) fragment and a treaty 600bp(from genomic dna) fragment, positive T0 is for RNA interference of transgene paddy rice.(note: for the fragment that builds RNAi carrier from the fine cDNA of Japan, two sections of introns of middle span)
Adopting uses the same method proceeds to empty carrier pCAMBIA2300-Actin in wild-type paddy rice, obtain turning empty carrier paddy rice, can obtain a treaty 600bp(from pCAMBIA2300-Actin carrier with primer 2 3F:CCTTATCTGGGAACTACTCA and 23R:ATCTCCTGTCATCTCACCTT) fragment.
3, the phenotype of RNA interference of transgene paddy rice
By T0 for RNA interference of transgene paddy rice, turn the planting seed of empty carrier paddy rice and wild-type paddy rice, observe phenotype.
1) the vegetative reproduction stage
From seed germination, to heading, T0 is for the root of RNA interference of transgene paddy rice, stem, and the growth of leaf is compared with wild-type all without obvious difference; Turn empty carrier paddy rice and wild-type paddy rice result without significant difference.
2) phenotype after heading
Observing afterwards T0 in heading observes for the flower pesticide of RNA interference of transgene paddy rice and wild-type paddy rice:
(1) ripening stage flower pesticide
The T0 of after planting approximately 100 days is being dissected to Microscopic observation for RNA interference of transgene paddy rice and wild-type rice maturity little Hua, result as shown in Figure 4 A, T0 is for RNA interference of transgene rice maturity flower pesticide (right side) compared with wild-type ripening stage flower pesticide (left side), and flower pesticide is the generation of transparent atrophy shape and WUHUAFEN.Illustrate that T0 is male sterile plants for RNA interference of transgene paddy rice.Turn empty carrier paddy rice and wild-type paddy rice result without significant difference.
2) flower pesticide semithin section
After planting approximately 100 days T0 are carried out to semithin section (dyeing of toluidine blue dye liquor) for RNA interference of transgene paddy rice and wild-type rice maturity flower pesticide, and result is as shown in Fig. 4 B and Fig. 4 C, and Fig. 4 B is wild-type rice maturity flower pesticide semithin section; Fig. 4 C is that T0 is for RNA interference of transgene rice maturity flower pesticide semithin section; Can find out, form the mature flower powder that can be dyeed by toluidine blue dye liquor in the pollen sac of wild-type flower pesticide, and T0 of the same period is for the atrophy of RNA interference of transgene paddy pollen capsule, the inside does not have polliniferous formation.Turn empty carrier paddy rice and wild-type paddy rice result without significant difference.
Illustrate that T0 is male sterile plants for RNA interference of transgene paddy rice.
The above results shows, the transfer-gen plant that RNA disturbs does not have notable difference in the vegetative reproduction stage with Japanese fine the comparing of wild-type, but after heading, also show the male sterile phenotype the same with wbcll mutant, illustrate that OSWBC11 gene is carried out to RNA Recombinant Interferon α-2b obtains male sterile plants.
Claims (10)
1. the material that in silence or inactivation object plant, OSWBC11 protein coding gene is expressed is in the application of cultivating in male sterile plants; The aminoacid sequence of described OSWBC11 albumen is the sequence 2 in sequence table.
2. application according to claim 1, is characterized in that: the nucleotides sequence of described OSWBC11 protein coding gene is classified the sequence 1 in sequence table as; Described object plant is dicotyledons or monocotyledons; Described monocotyledons is specially paddy rice.
3. application according to claim 1 and 2, is characterized in that: in described silence or inactivation object plant OSWBC11 protein coding gene express material be following 1)-3) and at least one:
1) RNA molecule, it is from the DNA molecule encode RNA shown in 5 ' end 9-1057 position Nucleotide by the sequence 3 in sequence table;
2) DNA molecular, its nucleotides sequence is classified sequence 3 in sequence table as from the DNA molecular shown in 5 ' end 9-1057 position Nucleotide;
3) recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain described DNA molecular.
4. a DNA molecular, is made up of forward fragment, intron and reverse fragment; Described forward fragment is any one fragment in OSWBC11 protein coding gene; The nucleotides sequence of described reverse fragment is classified the reverse complementary sequence of described forward fragment as; The aminoacid sequence of described OSWBC11 albumen is the sequence 2 in sequence table;
The nucleotides sequence of described OSWBC11 protein coding gene is classified the sequence 1 in sequence table as;
The nucleotides sequence of described forward fragment is classified sequence 1 in the sequence table sequence 3 in 5 ' end 739-1157 position Nucleotide or sequence table as from 5 ' end 9-427 position Nucleotide.
5. DNA molecular according to claim 4, is characterized in that:
The nucleotides sequence of described DNA molecular is classified sequence 3 in sequence 3 or the sequence table in sequence table as from 5 ' end 9-1057 position Nucleotide.
6. by the RNA of DNA molecule encode described in claim 4 or 5.
7. contain recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium of DNA molecular described in claim 4 or 5.
8. DNA molecular, RNA claimed in claim 6 or recombinant vectors claimed in claim 7, expression cassette, transgenic cell line or the recombinant bacterium application in cultivation male sterile plants described in claim 4 or 5; Described plant is specially dicotyledons or monocotyledons; Described monocotyledons is further specially paddy rice.
9. cultivate a method for transgenic plant, comprise the steps: that in silence or inactivation object plant, OSWBC11 protein coding gene is expressed, obtain transgenic plant, described transgenic plant are male sterile plants;
In described silence or inactivation object plant, OSWBC11 protein coding gene is expressed to be specially DNA molecular described in claim 4 or 5 is imported in object plant, obtains transgenic plant; Described transgenic plant are male sterile plants;
Described object plant is specially dicotyledons or monocotyledons; Described monocotyledons is further specially water.
10. cultivate a method for transgenic plant, comprise the steps:, into DNA molecular described in claim 4 or 5 is imported in object plant, to obtain transgenic plant; Described transgenic plant are male sterile plants;
Described object plant is specially dicotyledons or monocotyledons; Described monocotyledons is further specially paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210488325.XA CN103834656B (en) | 2012-11-26 | 2012-11-26 | OSWBC11 albumen is cultivating the application in male sterible series of rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210488325.XA CN103834656B (en) | 2012-11-26 | 2012-11-26 | OSWBC11 albumen is cultivating the application in male sterible series of rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834656A true CN103834656A (en) | 2014-06-04 |
| CN103834656B CN103834656B (en) | 2016-04-20 |
Family
ID=50798553
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210488325.XA Active CN103834656B (en) | 2012-11-26 | 2012-11-26 | OSWBC11 albumen is cultivating the application in male sterible series of rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834656B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105968178A (en) * | 2016-07-27 | 2016-09-28 | 中国科学院遗传与发育生物学研究所 | Application of rice OsRAD1 protein or encoding gene thereof in regulating pollen fertility |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703471A (en) * | 2012-05-29 | 2012-10-03 | 安徽农业大学 | Application of corn defense-responsive gene |
-
2012
- 2012-11-26 CN CN201210488325.XA patent/CN103834656B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703471A (en) * | 2012-05-29 | 2012-10-03 | 安徽农业大学 | Application of corn defense-responsive gene |
Non-Patent Citations (2)
| Title |
|---|
| HIROKI UKITSU: "Cytological and Biochemical Analysis of COF1, an Arabidopsis Mutant of an ABC Transporter Gene", 《PLANT CELL PHYSIOL.》 * |
| TANAKA,T. ET AL: "Oryza sativa Japonica Group Os10g0494300 (Os10g0494300) mRNA, complete cds，NCBI Reference Sequence: NM_001071479.1", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105968178A (en) * | 2016-07-27 | 2016-09-28 | 中国科学院遗传与发育生物学研究所 | Application of rice OsRAD1 protein or encoding gene thereof in regulating pollen fertility |
| CN105968178B (en) * | 2016-07-27 | 2019-07-19 | 中国科学院遗传与发育生物学研究所 | The application of rice Os RAD1 albumen and its encoding gene in regulation pollen fertility |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834656B (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| De Pace et al. | Dasypyrum | |
| CN109844107A (en) | By manipulation gibberellin metabolism increase can crop the method and composition for short plant type plant | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| JP2020521492A (en) | Tobamovirus Tomato Brown Curled Leaf Fruit Virus (TBRFV) Tolerance in Sonnerum Lycopersicum Plants | |
| CN110213961A (en) | Crop based on genome editor is engineered and produces plant of short stem | |
| CN105821074B (en) | Application of rice temperature-sensitive male sterility gene TMS10 and fertility restoration method | |
| CN104313034B (en) | The application of male sterility gene OsLAP5 and the method for recovering male sterility of rice | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| US20220256793A1 (en) | Male sterility maintainer line plant and use thereof | |
| CN109735563A (en) | A kind of creation method of the tomato genic male sterile line of the green stem label of band | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| CN102726285B (en) | Preparation method, seed propagation method and two-line hybrid seed propagation method based on osms4 mutant | |
| CN107236810A (en) | Corn male nuclear sterile gene, its molecular labeling and application | |
| CN104004775A (en) | Fertility regulation gene and its application | |
| CN103834656B (en) | OSWBC11 albumen is cultivating the application in male sterible series of rice | |
| US20220119836A1 (en) | Rice thermo-sensitive male sterile gene mutant tms18 and uses thereof | |
| CN105968178B (en) | The application of rice Os RAD1 albumen and its encoding gene in regulation pollen fertility | |
| CN105579583A (en) | Reproduction of male sterility line and technology of hybrid seed production | |
| CN104846084B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9927 | |
| CN107459564A (en) | The application of rice ZYGO1 albumen and its encoding gene in pollen fertility is regulated and controled | |
| US11572573B2 (en) | Method for propagating sterile male plant line | |
| CN107176981B (en) | The application of MEICA1 albumen and its encoding gene in regulation pollen fertility | |
| EP4038193A1 (en) | Begomovirus resistance related genes | |
| Mujeeb-Kazi et al. | Production and cytogenetics of a new Thinopyrum elongatum/Triticum aestivum hybrid, its amphiploid and backcross derivatives |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |