CN103834627B - Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain - Google Patents
Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain Download PDFInfo
- Publication number
- CN103834627B CN103834627B CN201410087811.XA CN201410087811A CN103834627B CN 103834627 B CN103834627 B CN 103834627B CN 201410087811 A CN201410087811 A CN 201410087811A CN 103834627 B CN103834627 B CN 103834627B
- Authority
- CN
- China
- Prior art keywords
- xynagn16
- xylanase
- gene
- enzyme
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/248—Xylanases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/248—Xylanases
- C12N9/2482—Endo-1,4-beta-xylanase (3.2.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01008—Endo-1,4-beta-xylanase (3.2.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01037—Xylan 1,4-beta-xylosidase (3.2.1.37)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01055—Alpha-N-arabinofuranosidase (3.2.1.55)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01139—Alpha-glucuronidase (3.2.1.139)
Abstract
The invention discloses low-temperature xylanase XynAGN16 and a gene thereof, a recombinant vector and a recombinant strain. The invention provides xylanase XynAGN16 from arthrobacter sp., wherein the amino acid sequence of xylanase XynAGN16 is shown by SEQ ID No.1; the invention also provides a coding gene xynAGN16 of the xylanase and a recombinant vector and a recombinant strain of the xylanase gene xynAGN16. The xylanase disclosed by the invention has the following properties: the optimal pH is 6.5, the optimal temperature is 45 DEG C, and the enzyme activity is 17.2%, 27.6% and 41.8% at 0 DEG C, 10 DEG C and 20 DEG C respectively; after one-hour treatment at 60 DEG C, the remaining enzyme activity is 23.3%, and the xylanase is more stable than other low-temperature xylanase. The xylanase disclosed by the invention can be applied to the feed and food industries.
Description
Technical field
The present invention relates to gene engineering technology field, specifically a kind of zytase XynAGN16 and gene, recombinant vectors, recombinant bacterial strain with low temperature active.
Background technology
Hemicellulose is the main ingredient of plant cell wall, is the second rich in carbohydrate after nature relaying Mierocrystalline cellulose.Xylan is the important component of hemicellulose, is extensively present in fern, gymnosperm and angiosperm, as the corn cob in agricultural by-products, wheat bran, rice bran, stalk and bagasse etc.Zytase is can by the class of enzymes of xylan backbone and Side chain cleavage, comprise inscribe-1,4-β-D-zytase (endo-1,4-β-D-xylanase, EC3.2.1.8), α-l-arabfuranglycosidase (α-L-arabinofuranosidase, EC3.2.1.55), α-D-glucuronidase (α-D-glucuronidase, and β-D-xylosidase (β-D-xylosidase EC3.2.1.139), (the Collins et al.FEMS Microbiol Rev such as EC3.2.1.37), 2005,29:3 – 23.).According to amino acid sequence homology, zytase mainly ranges glycoside hydrolase the 10th, 11,30,39,43,52,62 and 67 family (Finn et al.NucleicAcids Res, 2008,36:D281 – D288.).Inscribe-Isosorbide-5-Nitrae-β-D-zytase, namely our usually said zytase, mainly range glycoside hydrolase the 10th and 11 family.In the degradation process of xylan, inscribe-Isosorbide-5-Nitrae-β-D-zytase can cut the main chain backbone of xylan randomly, generates wood sugar or xylo-oligosaccharide, is most study and have the class of enzymes of using value most in xylan degrading relevant enzyme.
Inscribe-1,4-β-D-zytase is with a wide range of applications in fields such as feed, food, wine brewing, weaving and papermaking, as inscribe-Isosorbide-5-Nitrae-β-D-zytase can improve feed performance in feedstuff industry and eliminate or reduce anti-oxidant action, poisonous bleaching chemical substance can be replaced in papermaking and Pulp industry but still paper can be made to reach bleaching effect, the color and luster of wine can be improved in liquor industry and increase alcohol productive rate, food performance can be improved in food service industry, can come unstuck by auxiliary material in textile industry.Low-temperature xylanase has higher enzyme and lives in low temperature environment, can be used for low temperature to the habitat of middle temperature or the course of processing, its distinctive application advantage (Gerday et al.Trends Biotechnol is had relative to middle temperature or high-temperature xylanase, 2000,18:103 – 107), if aquatic products habitat is usually that awake face in 10 – 25 DEG C, food service industry and pole face process need carry out below 35 DEG C.Transfer the process of middle temperature or high temperature process to effect (Beg etal.Appl Microbiol Biotechnol, 2001,56:326 – 338.) that machining at low temperature process also can play reduction energy consumption.
Summary of the invention
The object of this invention is to provide a kind of zytase with low temperature active.
Another object of the present invention is to provide the gene of above-mentioned zytase of encoding.
Another object of the present invention is to provide the recombinant vectors comprising said gene.
Another object of the present invention is to provide the recombinant bacterial strain comprising said gene.
Zytase XynAGN16 of the present invention can derive from Arthrobacter (Arthrobacter sp.).The aminoacid sequence of XynAGN16 is as shown in SEQ ID NO.1.
Zytase XynAGN16 of the present invention is altogether containing 1212 amino acid, and theoretical molecular is 131.6kDa.The optimum pH of this enzyme is 6.5, maintains the enzymic activity of more than 50% in the scope of pH6.0 – 8.0, maintains the enzymic activity of more than 20% in the scope of pH9.0 – 11.0; Through the damping fluid process 1h of pH7.0 – 12.0, this enzyme enzyme residue alive reaches more than 45%; This enzyme optimum temperuture is 45 DEG C, and the enzyme respectively at 0 DEG C, 10 DEG C and 20 DEG C with 17.2%, 27.6% and 41.8% is lived; At 37 DEG C, 50 DEG C and 60 DEG C, process 1h, residual enzyme is lived and is respectively 52.4%, 21.2% and 23.3%; This enzyme hydrolyzable oat xylan, birch xylan and beech wood glycan, can not hydrolyzed carboxymethylcellulo, e receive, pulullan polysaccharide and beta-glucan.
The invention provides the gene xynAGN16 of above-mentioned zytase of encoding, this gene order is as shown in SEQ IDNO.2.
The present invention has cloned the encoding gene xynAGN16 of zytase XynAGN16 by the method for gene order-checking, its total length 3639bp, and initiation codon is ATG, and termination codon is TGA.Through amino acid sequence homologous comparison, this zytase XynAGN16 is Multidomain albumen, holds C to hold be followed successively by glycoside hydrolase the 10th family structure territory, saccharan deacetylase structural domain (polysaccharide deacetylase), carbohydrate binding domain (CBM_4_9) and glycoside hydrolase the 10th family structure territory from N.The zytase having similar domain to form with XynAGN16 is not also retrieved in GenBank.The potential zytase (CAA90745) that zytase XynAGN16 and Cellulomonas fimi JCFX5 originates has the highest consistence, is 30.7%.Above analytic explanation zytase XynAGN16 is a kind of new zytase.
Present invention also offers the recombinant vectors comprising above-mentioned xylanase gene xynAGN16, be preferably pET-xynAGN16.Xylanase gene of the present invention is inserted in expression vector, its nucleotide sequence is connected with expression regulation sequence.As the most preferred embodiment of the present invention, xylanase gene of the present invention is inserted into plasmid pET-28a(+) on Hind Ш and NotI restriction enzyme site between, obtain expression of recombinant e. coli plasmid pET-xynAGN16.
Present invention also offers the recombinant bacterial strain comprising above-mentioned xylanase gene xynAGN16, preferred described bacterial strain is intestinal bacteria, yeast, genus bacillus or lactobacillus, is preferably recombinant bacterial strain BL21 (DE3)/xynAGN16.
The method that the present invention prepares zytase XynAGN16 is carried out according to the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction recombined xylanase is expressed;
3) the zytase XynAGN16 expressed by recovery.
Wherein, preferred described host cell is Bacillus coli cells, preferably by expression of recombinant e. coli plasmid transformation escherichia coli cell BL21(DE3), obtain recombinant bacterial strain BL21 (DE3)/xynAGN16.
The invention provides a new xylanase gene, zytase optimum pH of its coding is 6.5, maintains the enzymic activity of more than 50% in the scope of pH6.0 – 8.0, maintains the enzymic activity of more than 20% in the scope of pH9.0 – 11.0; Through the damping fluid process 1h of pH7.0 – 12.0, this enzyme enzyme residue alive reaches more than 45%; This enzyme optimum temperuture is 45 DEG C, and the enzyme respectively at 0 DEG C, 10 DEG C and 20 DEG C with 17.2%, 27.6% and 41.8% is lived; At 37 DEG C, 50 DEG C and 60 DEG C, process 1h, residual enzyme is lived and is respectively 52.4%, 21.2% and 23.3%; This enzyme hydrolyzable oat xylan, birch xylan and beech wood glycan, can not hydrolyzed carboxymethylcellulo, e receive, pulullan polysaccharide and beta-glucan.This enzyme can be applicable to feed and food service industry.
Accompanying drawing explanation
Fig. 1: analyze at the SDS-PAGE of the recombined xylanase XynAGN16 of expression in escherichia coli, wherein, M: protein Marker; CK: containing carrier pET-28a(+) the broken supernatant liquor of coli somatic; S: the broken supernatant liquor of the coli somatic containing recombinant vectors pET-xynAGN16.
The pH of Fig. 2: recombined xylanase XynAGN16 is active.
The pH stability of Fig. 3: recombined xylanase XynAGN16.
Fig. 4: the thermal activities of recombined xylanase XynAGN16.
Fig. 5: the thermostability of recombined xylanase XynAGN16.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
Test materials and reagent
1, bacterial strain and carrier: Arthrobacter (Arthrobacter sp.) with bibliographical information bacterial classification character, as China General Microbiological culture presevation administrative center strains A rthrobacter citreus CGMCC1.1893; Intestinal bacteria Escherichia coli BL21(DE3) and expression vector pET-28a(+) be purchased from Novagen company.
2, enzyme and other biochemical reagents: archaeal dna polymerase, restriction enzyme and dNTP are purchased from TaKaRa company; Oat xylan, birch xylan, beech wood glycan, cellulose sodium carboxymethyl, pulullan polysaccharide and beta-glucan available from Sigma; Genomic DNA Clean & Concentration test kit is purchased from Zymo Research company, TureseqTM DNA Sample Preparation Kit is purchased from Illumima company, and other is all domestic reagent (all can buy from common biochemical Reagent Company and obtain).
3, substratum:
LB substratum: Peptone10g, Yeast extract5g, NaCl10g, adding distil water is to 1000ml, pH nature (being about 7).Solid medium adds 2.0%(w/v on this basis) agar.
Illustrate: in following examples, do not make the experimental methods of molecular biology illustrated, all carry out with reference to concrete grammar listed in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book, or carry out according to test kit and product description.
Embodiment 1: the clone of xylanase gene xynAGN16
Extract Arthrobacter gene sequence group DNA: by the bacterium liquid centrifuging and taking thalline of liquid culture 2d, add 1mL N,O-Diacetylmuramidase, 37 DEG C of process 60min, then add lysate, lysate consists of: 50mM Tris, 20mM EDTA, NaCl500mM, 2%SDS(w/v), pH8.0,70 DEG C of water-bath cracking 60min, every 10min mixing once, the centrifugal 5min of 10000rpm at 4 DEG C.Get supernatant extrct foreigh protein removing in phenol/chloroform, then get supernatant and add equal-volume Virahol, after room temperature leaves standstill 5min, the centrifugal 10min of 10000rpm at 4 DEG C.Abandon supernatant, precipitate with 70% washing with alcohol twice, vacuum-drying, adds appropriate TE and dissolves, be placed in-20 DEG C for subsequent use.
To interrupt that the Arthrobacter gene sequence group of 5 μ g interrupts by instrument Biorupter be the fragment of 400 – 600bp with ultrasonic, with Genomic DNA Clean & Concentration test kit, purifying is carried out to the DNA fragmentation interrupted, after purifying with TureseqTM DNA Sample Preparation Kit carry out the end-filling of DNA fragmentation, 3' end adds A base and adds the pcr amplification (operate and undertaken by test kit specification sheets) of joint and DNA fragmentation.With MiSeq gene order-checking instrument (Illumima company), gene order-checking is carried out to the above-mentioned library prepared.
The data that gene order-checking obtains are through reading frame prediction and Local BLAST comparison, and obtain xylanase gene xynAGN16, this gene order is as shown in SEQ ID NO.2.
Embodiment 2: the preparation of recombined xylanase XynAGN16
With 5'CCCAAGCTTGCGTGCAGCCGGAGGAAAAACGTC3' and 5'ATAAGAATGCGGCCGCGTGCCTTCCGTGGTGCCGGT3' for primer pair, Arthrobacter gene sequence group DNA is template, carries out pcr amplification.PCR reaction parameter is: 94 DEG C of sex change 5min; Then 94 DEG C of sex change 30sec, 63 DEG C of annealing 30sec, 72 DEG C extend 3min30sec, 30 rear 72 DEG C of insulation 10min of circulation.PCR result obtains xylanase gene xynAGN16, and introduces Hind Ш and NotI restriction enzyme site respectively at this gene 5 ' and 3 ' end.The gene xynAGN16 of encoding xylanase is carried out double digestion (Hind Ш and NotI), simultaneously by expression vector pET-28a(+) carry out double digestion (Hind Ш and NotI), the xylanase gene xynAGN16 that above-mentioned enzyme is cut and expression vector pET-28a(+) be connected, obtain the recombinant plasmid pET-xynAGN16 containing xylanase gene xynAGN16, by pET-xynAGN16 transformation of E. coli BL21(DE3), obtain recombinant escherichia coli strain BL21 (DE3)/xynAGN16.
Get recombinant escherichia coli strain BL21 (the DE3)/xynAGN16 containing recombinant plasmid pET-xynAGN16, the inoculum size with 0.1% is inoculated in LB(containing 50 μ g mL
-1kan) in nutrient solution, 37 DEG C of quick oscillation 16h.Then this bacterium liquid activated is inoculated into fresh LB(containing 50 μ g mL with 1% inoculum size
-1kan), in nutrient solution, quick oscillation cultivates about 2 – 3h(OD
600reach 0.6 – 1.0) after, the IPTG adding final concentration 0.7mM induces, and is about a 20h or 26 DEG C shaking culture is about 8h in 20 DEG C of continuation shaking culture.The centrifugal 5min of 12000rpm, collects thalline.After appropriate pH7.0Tris-HCl damping fluid suspension thalline, ultrasonic disruption thalline under low temperature water-bath, through the centrifugal 10min of 13,000rpm after fragmentation, draws supernatant and carries out SDS-PAGE analysis.Above process is with containing carrier pET-28a(+) coli strain for contrast by pET-28a(+) transformation of E. coli BL21(DE3), namely obtain containing carrier pET-28a(+) coli strain.SDS-PAGE result (Fig. 1) shows, in the position of about 130Kda, containing carrier pET-28a(+) the broken supernatant liquor of coli somatic without band, and the broken supernatant liquor of coli somatic containing recombinant vectors pET-xynAGN16 has obvious band; Meanwhile, containing carrier pET-28a(+) the broken supernatant liquor of coli somatic without xylanase activity, and the broken supernatant liquor of coli somatic containing recombinant vectors pET-xynAGN16 has xylanase activity.These results suggest that recombined xylanase XynAGN16 obtains expression in intestinal bacteria.
Embodiment 3: the property testing of recombined xylanase XynAGN16
1, the activation analysis of recombined xylanase XynAGN16
The activity determination method of embodiment 2 recombined xylanase XynAGN16 adopts 3,5-dinitrosalicylic acid (DNS) method: be dissolved in by substrate in 0.1M damping fluid, make its final concentration be 0.5%(w/v); Reaction system contains the appropriate enzyme liquid of 100 μ L, 900 μ L substrates; Substrate, at the reaction temperatures after preheating 5min, reacts 10min again after adding enzyme liquid, then adds 1.5mL DNS termination reaction, boiling water boiling 5min, measure OD value after being cooled to room temperature under 540nm wavelength.1 Ge Meihuo unit (U) is defined as the raw enzyme amount needed for 1 μm of ol reducing sugar (in wood sugar) of per minute bottom exploded produce under given conditions.
2, the active and pH Stability Determination of the pH of recombined xylanase XynAGN16:
The optimal pH of enzyme measures: zytase XynAGN16 is carried out enzymatic reaction at 37 DEG C and in the damping fluid of 0.1M pH5.0 – 12.0.The pH Stability Determination of enzyme: damping fluid enzyme liquid being placed in 0.1M pH5.0 – 12.0, processes 1h at 37 DEG C, then carries out enzymatic reaction at pH6.5 and 37 DEG C, with untreated enzyme liquid in contrast.Damping fluid is: 0.1M McIlvaine buffer(pH5.0 – 8.0) and 0.1Mglycine-NaOH(pH9.0 – 12.0).With beech wood glycan for substrate, reaction 10min, measures the zymologic property of XynAGN16.Result shows: the optimal pH of XynAGN16 is 6.5, maintains the enzymic activity of more than 50% in the scope of pH6.0 – 8.0, maintains the enzymic activity (Fig. 2) of more than 20% in the scope of pH9.0 – 11.0; Through the damping fluid process 1h of pH7.0 – 12.0, this enzyme enzyme residue alive reaches more than 45% (Fig. 3).
3, the thermal activities of recombined xylanase XynAGN16 and thermal stability determination:
The optimum temperuture of enzyme measures: in the damping fluid of pH6.5, at 0 – 70 DEG C, carry out enzymatic reaction.The thermal stability determination of enzyme: the enzyme liquid of same enzyme amount is placed in 37 DEG C, 50 DEG C and 60 DEG C, after processing 0 – 60min, carries out enzymatic reaction, with untreated enzyme liquid in contrast at pH6.5 and 37 DEG C.With beech wood glycan for substrate, reaction 10min, measures the zymologic property of XynAGN16.Result shows: the optimum temperuture of XynAGN16 is 45 DEG C, and the enzyme respectively at 0 DEG C, 10 DEG C and 20 DEG C with 17.2%, 27.6% and 41.8% lives (Fig. 4); This enzyme processes 1h at 37 DEG C, 50 DEG C and 60 DEG C, residual enzyme live be respectively 52.4%, 21.2% and 23.3%(Fig. 5).This result shows that recombined xylanase XynAGN16 has low temperature active, and the thermostability simultaneously 60 DEG C time is better than the low-temperature xylanase (patent No.: ZL201010238563.6, ZL201110360254.0 and ZL201110142556.0) reported
4, different metal ion and chemical reagent are on the impact of recombined xylanase XynAGN16 vigor:
In enzymatic reaction system, add metal ion and the chemical reagent of 10.0mM, study its impact on enzymic activity.Under 37 DEG C and pH6.5 condition, with beech wood glycan for substrate measures enzymic activity.Result (table 1) shows, SDS and HgCl of 10.0mM
2xynAGN16 can be suppressed completely, AgNO
3, MnSO
4and ZnSO
4comparatively strong to the suppression of XynAGN16, PbAC and FeSO
4more weak to the suppression of XynAGN16, all the other metal ions and the impact of chemical reagent on XynAGN16 less.
Table 1. metal ion and chemical reagent are on the impact of recombined xylanase XynAGN16 vigor
5, recombined xylanase XynAGN16 is to the degraded of substrate:
At pH6.5 and 45 DEG C, recombined xylanase XynAGN16 is to 0.5%(w/v) beech wood glycan, oat xylan and birch xylan enzyme live be respectively 125.1 ± 3.0,122.0 ± 4.4 and 117.6 ± 1.5U mL
-1, cellulose sodium carboxymethyl, pulullan polysaccharide and beta-glucan are lived without enzyme.
Should be understood that, for those of ordinary skills, can be improved according to the above description or convert, and all these improve and convert the protection domain that all should belong to claims of the present invention.
Claims (4)
1. a zytase XynAGN16, is characterized in that its aminoacid sequence is as shown in SEQ ID NO.1.
2. an xylanase gene xynAGN16 of coding zytase XynAGN16 according to claim 1, is characterized in that its nucleotide sequence is as shown in SEQ ID NO.2.
3. one kind comprises the recombinant vectors of xylanase gene xynAGN16 described in claim 2.
4. one kind comprises the recombinant bacterial strain of xylanase gene xynAGN16 described in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410087811.XA CN103834627B (en) | 2014-03-11 | 2014-03-11 | Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410087811.XA CN103834627B (en) | 2014-03-11 | 2014-03-11 | Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834627A CN103834627A (en) | 2014-06-04 |
| CN103834627B true CN103834627B (en) | 2015-05-13 |
Family
ID=50798524
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410087811.XA Active CN103834627B (en) | 2014-03-11 | 2014-03-11 | Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834627B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111876398B (en) * | 2020-07-14 | 2022-03-22 | 云南师范大学 | Endo-xylanase mutant S05F04 and preparation method and application thereof |
| CN111690631B (en) * | 2020-07-14 | 2021-02-23 | 云南师范大学 | Endo-xylanase mutant S23B01, and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101175860A (en) * | 2005-03-15 | 2008-05-07 | 维莱尼姆公司 | Cellulases, nucleic acids encoding them and methods for making and using them |
| CN101967490A (en) * | 2002-06-14 | 2011-02-09 | 先正达公司 | Xylanases, nucleic adics encoding them and methods for making and using them |
-
2014
- 2014-03-11 CN CN201410087811.XA patent/CN103834627B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967490A (en) * | 2002-06-14 | 2011-02-09 | 先正达公司 | Xylanases, nucleic adics encoding them and methods for making and using them |
| CN101175860A (en) * | 2005-03-15 | 2008-05-07 | 维莱尼姆公司 | Cellulases, nucleic acids encoding them and methods for making and using them |
Non-Patent Citations (4)
| Title |
|---|
| Gartemann K. et al..TR:M5BAQ3_9MICO,Beta-xylanase.《EMBL》.2013,全文. * |
| Gartemann K.-H et al..A5CRL7_CLAM3,beta-xylanase.《EMBL》.2007,全文. * |
| Isolation,purification and characterization of the xylanase produced by arthrobacter sp. MTCC 5214 when grown in solid-state fermentation;R.D.S.Khandeparkar et al.;《Enzyme and Microbial Technology》;20060802;第39卷(第4期);732-742 * |
| 微生物木聚糖酶的生产及其在食品工业中应用的研究进展;江正强;《中国食品学报》;20050331;第5卷(第1期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834627A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105950592B (en) | The xylosidase JB13GH39 and preparation method thereof of the resistance to trypsase of the resistance to ethyl alcohol of salt tolerant | |
| CN105950586B (en) | A kind of low temperature xylosidase HJ14GH43 and its salt-tolerant mutant | |
| Kumar et al. | Biochemical and thermodynamic characteristics of thermo-alkali-stable xylanase from a novel polyextremophilic Bacillus halodurans TSEV1 | |
| Cann et al. | Molecular cloning, sequencing, and expression of a novel multidomain mannanase gene from Thermoanaerobacterium polysaccharolyticum | |
| Xu et al. | Molecular and biochemical characterization of a novel xylanase from Massilia sp. RBM26 isolated from the feces of Rhinopithecus bieti | |
| Wang et al. | Production, purification and characterisation of a novel halostable xylanase from Bacillus sp. NTU‐06 | |
| Zafar et al. | Cloning, expression, and purification of xylanase gene from Bacillus licheniformis for use in saccharification of plant biomass | |
| CN104726434B (en) | A kind of zytase XynRBM26 and its encoding gene | |
| CN102220303B (en) | Xylanase XynAHJ3 with protease resistance and gene thereof | |
| CN102220301B (en) | Alkali-resistant low-temperature alpha-galactosidase AgaAJB13 and genes thereof | |
| CN103981161A (en) | Salt-tolerant ethanol-tolerant protease-tolerant surfactant-tolerant exoinulinase, gene thereof, vector and strain | |
| Nadaroglu et al. | A thermostable-endo-β-(1, 4)-mannanase from Pediococcus acidilactici (M17): purification, characterization and its application in fruit juice clarification | |
| CN102220304B (en) | Low-temperature xylanase XynAHJ2 and gene thereof | |
| Badejo et al. | Biochemical properties of partially purified surfactant-tolerant alkalophilic endo beta-1, 4 xylanase and acidophilic beta-mannanase from bacteria resident in ruminants’ guts | |
| CN105543197B (en) | The difunctional hemicellulose degrading enzymes of high xylose tolerance, its encoding gene and preparation method thereof | |
| CN103834627B (en) | Low-temperature xylanase XynAGN16, gene thereof, recombinant vector and recombinant strain | |
| Ali et al. | Cloning of cellulase gene using metagenomic approach of soils collected from Wadi El Natrun, an extremophilic desert valley in Egypt | |
| CN102311944B (en) | Mannase with low-temperature activity and salt resistance and gene thereof | |
| Zhang et al. | Gene cloning, expression, and characterization of a novel β‐mannanase from the endophyte Paenibacillus sp. CH‐3 | |
| Wang et al. | A novel endo-β-1, 4-xylanase GH30 from Dickeya dadantii DCE-01: clone, expression, characterization, and ramie biological degumming function | |
| Jacomini et al. | Cloning, expression and characterization of C. crescentus xynA2 gene and application of Xylanase II in the deconstruction of plant biomass | |
| Rajabi et al. | Metagenomic psychrohalophilic xylanase from camel rumen investigated for bioethanol production from wheat bran using Bacillus subtilis AP | |
| Hudson et al. | Purification and properties of an aryl β-xylosidase from a cellulolytic extreme thermophile expressed in Escherichia coli | |
| Kurakake et al. | Production of L‐arabinose from corn hull arabinoxylan by Arthrobacter aurescens MK5 α‐L‐arabinofuranosidase | |
| CN104726430B (en) | The α galactosidase As gaAHJ8 and its gene of salt tolerant resistant protease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |