Background technology
In the last few years, relevant data and the fact showed, only for Asia, broke out the relatively mild fowl stream that comparesSense, hundred million dollars of loss 900-1100. If the bird flu great outburst in the whole world, may be to causing global economic recession. Meanwhile,Estimate according to economist, when being in the period of Avian Influenza, it is straight that bird flu causes be injured regional trade and tourist industryConnecing economic loss also cannot weigh by numeral. From four worldwide influenzas of eighties of last century outburst, there are three times to the mankindBring great injury, be in the propagation of the influenza A virus of Spain in 1918 outburst, in the first 2 of nineteen fifty-seven outburst(H2N2) outburst of the propagation of subtype influenza virus and nineteen sixty-eight the propagation of first 3 (H3N2) subtype influenza, and caused societyUpheaval, direct economic loss is crossed 10,000,000,000 dollars. Since Italy's outburst bird flu in 1878, H5, H7 bird flu hypotype diseaseTheir infection to local bird that what strain cut in and out all over the world detect also causes flu outbreak and popular. ExampleAs, there is more than 40 turkey group to break out bird flu in the U.S. Minnesota State in 1978, directly cause the warp of more than 500 ten thousand dollars, governmentJi loss. And for example nineteen eighty-three has broken out at Pennsylvania, America the bird mortality that H5N2 Strain causes, directly makesMore than 1900 ten thousand turkey death, all closing down in locality and periphery poultry cultivation farm, causes the economic loss of 6,500 ten thousand dollars. ?The influenza spread being caused by H5N1 hypotype strain has been broken out on multiple cultivation farm, China Hong Kong Special Administrative Region New Territory in 1997, makesBecome multiple plants to close down, the die by visitation of God of the birds such as 9000 chickens, duck. In recent years, there is at home report bird flu also timePropagate, although China's economy is not produced to large negative effect, seriously hindered the development of the aquaculture of China.At present, although having on the market some immune vaccines and antiviral drugs, also obtain some good curative effects,Be, these medicines also have certain limitation, and cost higher, expensive, supply limitedly, cause market-oriented commodity priceBe difficult to obtain consumer satisfaction. Therefore, many scholars and both at home and abroad expert just transfer to biological means sight, utilize biologicalReactor is produced has bird flu plant vaccine immunogenic, edibility.
Avian influenza virus (avianinfluenzavirus, AIV) is commonly called as fowl plague, is to be caused by avian influenza virusThe high deadly infectious disease of causing a disease of a kind of one being popular among bird. How spherical in shape, general diameter between 80~120nm,Be made up of an inner nucleocapsid and cyst membrane, the fiber of many radial arrangement in the surface distributed of cyst membrane is outstanding. According toThe difference of protein antigenicity, can be divided into virus 15 H hypotypes and 9 N hypotypes. Mainly through respiratory infectious, also can be from fowlExcreta, secretion and the edible water source being polluted by virus of class are propagated. Up to now, also do not have certain evidence to prove fowlInfluenza virus directly can infect the mankind, also there is no the interpersonal example of directly propagating. International epizootic disease center is by fowlInfluenza is classified I class infectious disease as, and the Ministry of Agriculture of various countries has also been classified as Class A infectious disease to be monitered.
Complete avian influenza virus comprises interior China and foreign countries three-decker, and wherein outer field double-deck adipose capsule film has two kinds of glycoprotein fibresProminent, be hemagglutinin (hemagglutinin, HA) and neuraminidase (Neuraminidase, NA), its ratio is at 4:1 extremelyBetween 5:1. Virus has infectivity, must be first HA1 and HA2 by host protein enzymatic lysis, and secondly the HA2 after cracking exposesGo out hydrophobic region, and mutually combine with the lipid bilayer of host cell membrane, be cracked into so avian influenza virus has pathogenic HAHA1 and HA2 are very crucial. Also comprising in viral internal layer and middle level have nucleoprotein (NP), stromatin (MA), polymerizationEnzyme and non-structural protein [8-11]. Wherein nucleoprotein is the main composition composition of nucleocapsid, in the transcribing and translate of virus, risesImportant function. Stromatin is a kind of non-glycosylated protein, is present in the inner side of cyst membrane, also can be its inner membrane protein, itIn the assembling of virion and dispose procedure, bringing into play and acting on. Polymerase is made up of PA, PB1 and tri-kinds of subunits of PB2, in virusIn the process that copies and transcribe, three moves with the prolongation that copies or transcribe chain, can infer that three has formed RNA jointly poly-Fit. Non-structural protein codified NS1 and NS2, wherein NS2 copied in the later stage, and NS1 is early stage a large amount of the answering of virus infectionSystem, thus participate in the nuclear work of infecting. Here main structure and pathogenesis to hemagglutinin and neuraminidase carries outAnalyze.
From eighties of last century, genetically modified plants technology is just widely used in agricultural, thereby cultivates some high-performanceThe agriculture new varieties of degeneration-resistant, high yield, from traditional crossbreeding technology, break through out. Since this century, people lookWild had again new transformation, not only genetically modified plants treated as bread and cheese, but utilize plant to add as productionThe place of work, develops some biologics, thereby serves the mankind. The proposition of transgene vaccine is exactly one of them. He isUtilize plant gene engineering technology and immunology knowledge, choose certain Plants and produce and can make body exist as bioreactorAfter taking, obtain the vaccine of specificity resistance against diseases. Current, be mainly to prevent with vaccine inoculation to the control of various infectious diseasesControl, still, the production of these vaccines now and injection all there are a lot of drawbacks, such as its complex manufacturing, be difficult for storeAnd transport, secondly in inoculation, often the disinfection due to syringe needle thoroughly and does not easily cause cross-infection. ButTo select plant crop bioreactor to produce orally taken plant vaccine and just removed these trouble and worry from. First, plant belongs to highDeng biological, have the modification immune system of higher organism, the plantation of plant simultaneously and cultivate simple, do not need special technology andHuge investment, does not have too many requirement to storing and transporting yet. Secondly, adopt plant relatively to pacify as bioreactorEntirely, the albumen of recombinating out can not cause huge injury to the mankind after the modification such as glycosylation, phosphorylation, on the contrary, utilizes animal to doFor bioreactor does not wait eukaryotic protein is carried out to correct processing, easily cause the generation of many pathogens, cause disease woundEvil (HiattA, CaferkeyR, BowdishB.Productionofantibodiesintransgenetisplants[J].Nature,1989,342:76-78;MasonHS,BaUJM,si.ExPressionofNorwalkviruscapsidproteininransgenictobaccoandpotatoanditsoralimraunoGenieiryinmiee[J] .ProNatlAeadSciUSA, 1996,93:5335-5340). Finally, genetically modified plantsCan transcribe accurately foreign gene, translation etc. processed and modified. By sexual or vegetative propagation is stable entailsOffspring. At present, there have been a lot of viral genes and cell factor to pass through transgenosis means plants such as paddy rice, potato or tobaccosIn expressed, and obtain good plant gene vaccine effect. Such as in 1992, Mason and his team were at cigaretteIn grass, just the surface antigen to hepatitis type B virus is successfully expressed, and succeed (MasonHS, LamDM,ArntaenCJ.ExpresionofhepatitisBsurfaceantigenintransgenicplants.ProcNatlAcadSciUSA, 1992,89 (24): 11745-9.). Nineteen ninety-five, the people such as Verwoerd, successfully by phytase baseBecause transduceing in rape, through the detection to phytase, the existence of phytase in the 15th generation, can be detected equally. 2008Year, McCormick etc. have expressed anti-non-Hodgkin lymphoma lymthoma antiidiotype ScFv in tobacco, by mouse experiment, detectGo out mouse and produced immune response. Also carried out human immunity experiment, found that this product more easily produces immunity instead to human body simultaneouslyShould.
Chlamydomonas reinhardtii is that a kind of protein content is high, growth rate is fast, nutrition-allocated proportion is reasonable and produces and nothing without endotoxinThe edible animal feed of any toxic and side effect, is considered to optimal edibility recombinant vaccine receptor biological. In addition,Chlamydomonas reinhardtii can carry out photoautotrophy certainly under illumination cultivation, and can carry out heterotrophic growth under dark condition, and it is gathered aroundHave two flagellums, (RochaixJD.Chlamydomonasreinhardtiiasthe can freely move about in waterPhotosyntheticyeast[J] .AnnuRevGenet, 1995,29:209-230.). Since eighties of last century, Lay mattressChlamydomonas as model organism at molecular biology, molecular genetics, chloroplaset origin, mitochondrial function, circadian rhythm and the light that becomesThe research in the fields such as property play an important role (HarrisE.Chlamydomonasasamodelorganism[J] .AnnuRevPlantPhysiolPlantMolBiol, 2001,52:363-406.). But, in prior art, still do not haveClose technical scheme or the relevant report of expressing bird flu antigen gene with Chlamydomonas reinhardtii as host.
Summary of the invention
An object of the present invention is to provide a kind of bird flu antigen gene of optimizing through Chlamydomonas reinhardtii preference codon, toolThere is the nucleotide sequence being selected from as shown in SEQIDNO.1, SEQIDNO.3 or SEQIDNO.5.
Another object of the present invention is to provide a kind of recombinant expression carrier that contains described bird flu antigen gene. DescribedRecombinant expression carrier, for being selected from pH124HAV1, pNCFHAV2, pH423HAV3, have respectively as shown in Figure 1, Figure 2 and Figure 3Structure.
Another object of the present invention is to provide and contains the described bird flu antigen of optimizing through Chlamydomonas reinhardtii preference codonThe transgene Chlamydomonas reinhardtii of gene; Described transgenosis chlamydomonas, in the purposes of preparing in additive for farm animal feed, especially hasThe additive for farm animal feed of avian influenza vaccine effect; And further provide described recombinant expression carrier to turn base in preparation edibilityBecause of the application in Chlamydomonas reinhardtii avian influenza vaccine.
Another object of the present invention is to provide a kind of preparation of transgene Chlamydomonas reinhardtii of expressing bird flu antigen geneMethod and the transgene Chlamydomonas reinhardtii being obtained by described preparation method. Described preparation method comprises following three kinds of concrete operations sidesMethod:
1. a preparation method who expresses the transgene Chlamydomonas reinhardtii of bird flu antigen gene, comprises the following steps:
(1) synthesize and increase Chlamydomonas reinhardtii preference codon optimize bird flu antigen gene, its nucleotide sequence is as SEQShown in IDNO.1;
(2) the bird flu antigen gene of Chlamydomonas reinhardtii preference codon being optimized and Chlamydomonas reinhardtii Mesoplast heredity transform and carryBody pH124 is operably connected, and obtains Chlamydomonas reinhardtii Mesoplast heredity conversion carrier pH124HAV1, wherein said pH124HAV1There is structure as shown in Figure 1;
(3) adopt pearl mill method, pH124HAV1 is transformed in Chlamydomonas reinhardtii nucleus;
(4) cultivate and screen the transgene Chlamydomonas reinhardtii of expressing bird flu antigen gene.
2. a preparation method who expresses the transgene Chlamydomonas reinhardtii of bird flu antigen gene, comprises the following steps:
(1) synthesize and increase Chlamydomonas reinhardtii preference codon optimize bird flu antigen gene, its nucleotide sequence is as SEQShown in IDNO.3;
(2) the bird flu antigen gene of Chlamydomonas reinhardtii preference codon being optimized and Chlamydomonas reinhardtii mitochondrial inheritance are expressed and are carriedBody pNCF is operably connected, and obtains Chlamydomonas reinhardtii mitochondrial inheritance conversion carrier pNCFHAV2, wherein said pNCFHAV2 toolThere is structure as shown in Figure 2;
(3) adopt particle bombardment, pNCFHAV2 is transformed in Chlamydomonas reinhardtii mitochondria;
(4) cultivate and screen the transgene Chlamydomonas reinhardtii of expressing bird flu antigen gene.
3. a preparation method who expresses the transgene Chlamydomonas reinhardtii of bird flu antigen gene, comprises the following steps:
(1) synthesize and increase Chlamydomonas reinhardtii preference codon optimize bird flu antigen gene, its nucleotide sequence is as SEQShown in IDNO.5;
(2) the bird flu antigen gene of Chlamydomonas reinhardtii preference codon optimization is operably connected with carrier p423, obtainsObtain Chlamydomonas reinhardtii Chloroplast Inheritance expression cassette 5 ' atpA::HAV3::3 ' rbcL, then the acquisition that is operably connected with carrier pH423Chlamydomonas reinhardtii Chloroplast Inheritance conversion carrier pH423HAV3, wherein said pH423HAV3 has structure as shown in Figure 3;
(3) adopt electric shock conversion method, pH423HAV3 is transformed in Chlamydomonas reinhardtii chloroplaset;
(4) cultivate and screen the transgene Chlamydomonas reinhardtii of expressing bird flu antigen gene.
Transgene receptor to achieve these goals, concrete scheme of the present invention is as follows:
The screening of Chlamydomonas reinhardtii algae strain: in carrying out Chlamydomonas reinhardtii foreign gene genetic transformation, different heredity turnChange method can select the different strain of Chlamydomonas reinhardtii to carry out genetic transformation, for example, adopt " particle gun " or " electric shock conversionMethod " carry out genetic transformation, can select the Chlamydomonas reinhardtii algae strain of Cell wall deficiency or acellular wall deficiency, if adopted" pearl mill method " carries out genetic transformation, can select Cell wall deficiency Chlamydomonas reinhardtii to contribute to like this to improve the something lost of foreign genePass transformation efficiency (CN101255438A). In the selection of transgene receptor Strain selection mark, above several genetic transformation sidesMethod all can be selected the strain of auxotroph algae or antibiotic-screening mark. In case study on implementation of the present invention, selection be geneDeficiency or Cell wall deficiency Chlamydomonas reinhardtii are as the strain of transgene receptor algae. Chlamydomonas reinhardtii is that a kind of protein content is high, growthSpeed is fast, nutrition-allocated proportion is reasonable and without endotoxin produce and unicellular eukaryote without any side effects. Chlamydomonas reinhardtiiCultivation: the present invention has selected the culture medium of Tris-acetate-phosphate (TAP) culture medium as Chlamydomonas reinhardtii. SelectThe compound method of 1L is example, first chooses suitable container and adds 975mL deionized water, then adds 1mL1M (K) PO4BufferingSolution, 2.42gTris, 25mL4 × Beijerincksalts, 1mLTrace trace element mixed solution, and use glacial acetic acidRegulate pH value to 6.98~7.02. Fall and connect from solid TAP flat board from algae kind chamber by Chlamydomonas reinhardtii list algae good growth conditionsKind in the liquid TAP culture medium of fresh sterile, under 22 DEG C, 2000LUX continuous illumination intensity, leave standstill and be cultured to mid-log phase.
Manually synthesizing external source genes of interest: the external source genes of interest of selection is and is suitable for expressing in Chlamydomonas reinhardtiiBird flu antigen gene (GenBank accession number: AY609312). According to (the GenBank login of bird flu antigen gene sequencesNumber: AY609312) and Chlamydomonas reinhardtii genome preference codon, foreign gene is carried out codon optimized, optimization is appropriate toBird flu antigen gene that can high efficient expression in Chlamydomonas reinhardtii adopts synthetic this gene of artificial synthetic method simultaneously; InstituteState be suitable for Chlamydomonas reinhardtii express bird flu antigenic site can for be suitable for Chlamydomonas reinhardtii nucleus express bird flu antigenGene, be suitable for the bird flu antigen gene that Chlamydomonas reinhardtii mitochondria expresses, the fowl stream that is suitable for Chlamydomonas reinhardtii chloroplast expressionInduction reactance protogene.
The Chlamydomonas reinhardtii expression vector that structure contains described external source genes of interest: described expression vector can be bird fluAntigen gene Chlamydomonas reinhardtii Mesoplast heredity expression vector, bird flu antigen gene Chlamydomonas reinhardtii mitochondrial inheritance expression vector,Bird flu antigen gene Chlamydomonas reinhardtii Chloroplast Inheritance expression vector. Thin at Chlamydomonas reinhardtii for improving external source bird flu antigen geneTransformation efficiency in karyon and expression have accessed one section of noncoding region RBCS2 introne in nucleus expression vector Ph124(CN101255438A), when giving expression to corresponding object after external source genes of interest and the restructuring of suitable carrier for expression of eukaryonAlbumen. In the middle of eukaryotic expression process, the characteristic that can rely on host cell is sheared RBCS2, knows closing of ripe mRNABecome. In one embodiment of the invention, replace and artificial synthetic external source object through Chlamydomonas reinhardtii nucleus preference codonGene is HAV1 gene, and its sequence is the nucleotide sequence shown in SEQIDNO.1, and artificial synthetic HAV1 gene is at its 3 ' endEnd, with 6 histidine affinity labelings, is conducive to the bird flu antigen protein of restructuring to carry out affinitive layer purification. In the present inventionAn embodiment in, the bird flu antigen gene Chlamydomonas reinhardtii Mesoplast heredity expression vector that contains external source genes of interest HAV1For pH124HAV1, its building process is as follows: from plasmid Puc57 plasmid (the TaKaRa biology (Dalian) that contains external source genes of interestCo., Ltd) in obtain HAV1 (1815bp) gene, and be inserted into Chlamydomonas reinhardtii Mesoplast heredity expression vector pH124 and (refer toPatent publication No. CN101255438A) Nhe I and Pmac I site, obtain the genetic expression framework HSP70A-of HAV1RBCS2::HAV::RBCS2 obtains bird flu antigen gene Chlamydomonas reinhardtii Mesoplast heredity expression vector pH124HAV1 simultaneously(seeing Fig. 1). In another embodiment of the present invention, the Chlamydomonas reinhardtii mitochondrial inheritance table of external source bird flu antigen gene HAV2Reaching carrier is pNCFHAV2, and its building process is as follows: due to Chlamydomonas reinhardtii mitochondrial inheritance expression vector, pNCF has from wildThe ND4 that in type Chlamydomonas reinhardtii DNA, amplification obtains and Cob gene whole audience sequence (being called for short NC) are as genetic expression carrier conversion carrierRight-hand member homologous sequence; Also there is Left as genetic expression carrier conversion carrier left end homologous sequence simultaneously. So only need be by orderGenetic fragment HAV2 (1742bp) be inserted into Pst I and the Xho I site (CN101255438A) of pNCF carrier, obtain fowlInfluenza antigens gene Chlamydomonas reinhardtii mitochondrial inheritance expression vector pNCFHAV2 (seeing Fig. 2). In an alternative embodiment of the inventionIn, the Chlamydomonas reinhardtii Chloroplast Inheritance expression vector of external source bird flu antigen gene HAV3 is pH423HAV3, its building process asUnder: because Chlamydomonas reinhardtii Chloroplast Inheritance expression vector pH423 (CN101255438A) has from wild type Chlamydomonas reinhardtii DNA5 ' ch1B gene of amplification is as the right-hand member homologous fragment of Chloroplast Inheritance conversion carrier, 3 ' ch1B gene conduct of amplification simultaneouslyThe left end homologous fragment (seeing Fig. 4) of Chloroplast Inheritance conversion carrier. First cut by plasmid p423 (CN101255438A) by enzymeAadA Gene Replacement become artificial synthetic HAV3 (1742bp) gene, and two by restriction enzyme EcoR V and Sma IEnzyme is cut, and obtains HAV3 gene Chlamydomonas reinhardtii Chloroplast Inheritance expression cassette 5 ' atpA::HAV3::3 ' rbcL, and with through EcoR VThe pH423 plasmid that enzyme is cut connects. Cut and filter out the recombinant plasmid that forward connects by enzyme, obtain aaadA gene as screening markNote, contain HAV3 gene expression and Chlamydomonas reinhardtii chloroplast expression vector pH423HAV3 (seeing Fig. 3).
The genetic transformation of bird flu antigen gene genetic expression carrier: comprise " particle bombardment ", " electric shock conversion method " or " pearlMill method ". For example, can HAV2 gene Chlamydomonas reinhardtii mitochondrial inheritance expression vector be turned to transfered cell look by " particle bombardment "In element b deficiency (purchased from Duke university of U.S. chlamydomonas heredity center) Chlamydomonas reinhardtii acceptor algae strain. Can pass through " particle bombardment "" electric shock conversion method " transduces HAV3 gene Chlamydomonas reinhardtii Chloroplast Inheritance expression vector into Cell wall deficiency Chlamydomonas reinhardtiiIn (purchased from Duke university of U.S. chlamydomonas heredity center) algae strain. Can be by " pearl mill method " by HAV1 gene Chlamydomonas reinhardtii nucleusGenetic expression carrier transduction enters in the strain of Cell wall deficiency Chlamydomonas reinhardtii algae.
The screening of transgene Chlamydomonas reinhardtii: use different genetic transforming methods to lose Chlamydomonas reinhardtii according to different requirementsPass expression vector and carry out genetic transformation, and to transgenosis chlamydomonas adopt contain corresponding antibiotic TAP solid medium dull and stereotyped orAuxotrophy selection markers is cultivated and is screened, through the illumination cultivation of about 15 days, and the green monoclonal in 1mm to be grown left and rightAlgae falls behind, and adopts the detection means of molecule and protein level to carry out transgenosis checking to transgenic algae strain. Wherein these detect handSection comprises that DNA-Southernblot detects, RT-PCR detects and Westernblot detects.
Bird flu antigen gene genetic expression carrier of the present invention is in preparation edibility transgene Chlamydomonas reinhardtii bird flu epidemic diseaseApplication in seedling: for example collect and turn HAV1, HAV2 and HAV3 gene Chlamydomonas reinhardtii frustule, and with 0.9% physiological salineRegulating frustule concentration is 1 × 108~2×108Cell/mL. Get six week age simultaneously, clean 8 of level, male BALB/C mices, feedWhat food had been collected turns HAV1, HAV2 and HAV3 gene Chlamydomonas reinhardtii frustule, and once a day, each 1mL/ only, observes little during this timeWhether mouse self has abnormal response (festering etc. as whether active degree, epidermis have), feeds continuously after one month and adopts eyeball to getThe method of blood is collected mice serum. Concrete steps are as follows: after mouse is fixing with left hand, remove eyeball of mouse with elbow tweezers folder, withIn time, presses mouse heart blood is flowed out fast, and access blood with the EP pipe of the clean aseptic 1.5mL of preprepared (willThe EP pipe that blood is housed is placed on ice to be preserved). Take after blood the processing of mouse cracked ends. By the blood 5 gathering, 000rpm, fromIt is stand-by that heart 5min collection supernatant is saved to-20 DEG C of refrigerators. Adopt the method detection mouse of Western hybridization whether to produce phase simultaneouslyAnswer antibody.
Compared with prior art, edibility transgene Chlamydomonas reinhardtii avian influenza vaccine of the present invention has the following advantages:The present invention utilizes Chlamydomonas reinhardtii as bioreactor, external source bird flu antigen gene to be expressed, and production has bird flu and exempts fromThe edibility plant vaccine of epidemic focus, for production of vaccine and the further exploitation for bird flu epidemic situation control from now on has fowl streamThe research and development of the bird feed of cold and raising immunity originality lay the foundation. Compared with traditional vaccine, Transgenic Plant Vaccines advantages: firstIts low production cost, can Direct-fed animal, do not need separating-purifying. Secondly Transgenic Plant Vaccines just can at normal temperaturesTo preserve 2 years, without refrigeration, produce process in the middle of also without strict sterile working. Again, Transgenic Plant VaccinesHave better immunogenicity, the totipotency of plant cell and complete eukaryotic cell expression system thereof keep antigen proteinImmunogenicity under nature, and can carry out the processing after correct translation to eukaryotic protein. Again, plant vaccine ratioTraditional immunization route is safer, and Transgenic Plant Vaccines does not need syringe, the intersection of having avoided sterilization strictly not causeInfect, the transformed host Chlamydomonas reinhardtii that the present invention simultaneously selects can utilize luminous energy to carry out photosynthesis, be easy to cultivate, do not produceRaw any toxin, concentrate the double dominant of bacterium and higher plant expression alien gene, had broad application prospects.
The present invention is by Chlamydomonas reinhardtii nucleus preference codon table, Chlamydomonas reinhardtii mitochondria preference codon table and Lay mattressChlamydomonas reinhardtii chloroplast preference codon table is replaced and artificial synthetic method has been synthesized respectively applicable Chlamydomonas reinhardtii nucleus expressionBird flu antigen gene, be suitable for bird flu antigen gene that Chlamydomonas reinhardtii mitochondria expresses, to be suitable for Chlamydomonas reinhardtii leaf greenThe bird flu antigen gene that body surface reaches. And further built carry above-mentioned external source object fragment Chlamydomonas reinhardtii nucleus losePass expression vector, Chlamydomonas reinhardtii mitochondrial inheritance expression vector and Chlamydomonas reinhardtii Chloroplast Inheritance expression vector. Adopted simultaneouslyDifferent method for transformation obtains corresponding transgenic algae strain, and transgenic algae strain is detected at molecule and albumen water product,Its presentation of results bird flu antigen gene successfully transduceed in the middle of Chlamydomonas reinhardtii, and all have and transcribe in Chlamydomonas reinhardtiiActivity, can give expression to corresponding destination protein simultaneously.
Detailed description of the invention
Optimization and the amplification of [embodiment 1] bird flu antigen gene
Inclined to one side to codon according to known bird flu antigen gene (GenBank accession number: AY609312) and Chlamydomonas reinhardtiiThe property liked, the codon that selection can preferentially be expressed in Chlamydomonas reinhardtii nucleus, enters known bird flu antigen geneRow is replaced, and amino acid sequence is constant, thereby obtains being suitable for HAV1 and the HAV1 ' base that Chlamydomonas reinhardtii Mesoplast heredity is expressedCause, respectively as shown in SEQIDNO.1 and SEQIDNO.2; Optimization is suitable for the expression of Chlamydomonas reinhardtii mitochondrial inheritanceHAV2 and HAV2 ' gene, respectively as shown in SEQIDNO.3 and SEQIDNO.4; Optimization is suitable for Chlamydomonas reinhardtii chloroplasetHAV3 and the HAV3 ' gene of expressing, respectively as shown in SEQIDNO.5 and SEQIDNO.6. Above-mentioned through codon optimized mistakeBird flu antigen gene SEQIDNO.1-SEQIDNO.6 is manually closed by Sangon Biotech (Shanghai) Co., Ltd.Become.
Respectively by above-mentioned synthetic gene HAV1, HAV1 '; HAV2, HAV2 '; HAV3, HAV3 ' adopt molecular biosciences means withPUC57vector (purchased from precious bioengineering (Dalian) Co., Ltd) connects. Its step is as follows: first pUC57vector is dividedDo not use Nhe I, Pmac I; Pst I, Xho I; Nco I, Pst I digest 2h respectively at the temperature of 37 DEG C, secondly use equallyState enzyme and digest respectively gene HAV1, HAV1 '; HAV2, HAV2 '; HAV3, HAV3 '; Finally adopt T4 ligase (purchased fromFermentas) connection of spending the night under 26 DEG C of conditions, adopts heat shock method that the connecting fluid of spending the night is transduceed in competent cell Top10.Heat shock is applied in cell to contain on corresponding antibiotic LB flat board later, filters out monoclonal, and uses Auele Specific Primer respectivelyHAV1a, HAV1b; HAV2a, HAV2b; HAV3a, HAV3b are by method (94 DEG C of denaturation 5min, 94 DEG C, the 30s of bacterium colony PCR;55 DEG C, 30s; 72 DEG C, 1min, 30 circulations, 72 DEG C are extended 5min) filter out positive colony. Obtain respectively containing plasmidPUC57HAV1, pUC57HAV1 '; The bacterial strain of pUC57HAV2, pUC57HAV2 ' and pUC57HAV3, pUC57HAV3 ' (contains respectivelyThere are the HAV1, the HAV1 ' that have optimized; HAV2, HAV2 '; HAV3, HAV3 ' gene). For making said gene in Chlamydomonas reinhardtiiExpression product facilitate purifying, special added Histag affinity labeling at its N end, can adopt the method pair of affinity chromatographyExpression product carries out purifying.
The Auele Specific Primer design of qualification positive colony is as follows:
HAV1a:5′-CTAGCTAGCAGCAAAAGCAGGGGT-3′
NheⅠ
HAV1b:5′-CACGTGAGTAGAAACAAGGGTGTTTTTAAC-3′
PmacⅠ
HAV2a:5′CTGCAGAGCAAAAGCAGGGGTC3′
PstⅠ
HAV2b:5′CTCGAGAGTAGAAACAAGGGTGTT3′
XhoⅠ
HAV3a:5′CCATGGAGCAAAAGCAGGGGT3′
NcoⅠ
HAV3b:5′CTGCAGAGTAGAAACAAGGGTGTTT3′
PstⅠ
The selection and culture of [embodiment 2] transgene receptor algae strain
The transgene receptor algae strain that the present invention selects is: Cell wall deficiency Chlamydomonas reinhardtii (ChlamydomonasReinhardtii, cc-849, purchased from Duck university of U.S. chlamydomonas heredity center) and cytochrome b deficiency Chlamydomonas reinhardtii (cc-2654, purchased from Duck university of U.S. chlamydomonas heredity center). Select TAP as the culture medium of transgenic algae strain, its compound method asUnder: 25mL4 × Beijerincksalts (4gMgSO4.7H2O、2gCaCl2.2H2O、16gNH4Cl is dissolved in deionized waterIn, be settled to 1L), 2.42gTris, 1mL1M (K) PO4, 1mLTrace trace element mixed liquor (50gNa2EDTA、1.1g(NH4)6Mo7O24、1.57gCuSO4.5H2O、1.61gCoCl2.6H2O、4.99gFeSO4.7H2O、22gZnSO4.7H2O、5.6gMnCl2.4H2O、11.4gH3BO3Be settled in 1L deionized water), after being mixed, above-mentioned solution is dissolved in going of 975mLIn ionized water, use glacial acetic acid to regulate pH value to 6.98~7.02. The condition of culture of Chlamydomonas reinhardtii should be at the temperature of 25 DEG C, lightBe 90 μ E/M according to intensity2Under/s condition, leave standstill and be cultured to mid-log phase, when the concentration of frustule is 1-2 × 106When cell/mL, enterThe genetic transformation of row chlamydomonas.
[embodiment 3] turns the structure of bird flu antigen gene Chlamydomonas reinhardtii genetic expression carrier
(1) structure of bird flu antigen gene Chlamydomonas reinhardtii Mesoplast heredity expression vector
By learning in embodiment 1 that plasmid pUC57HAV1 contains HAV1 gene, pUC57HAV1 ' contains HAV1 ' gene,Owing to having added suitable restriction enzyme site in optimization, so can pass through restriction enzyme Nhe IObtain HAV1 and HAV1 ' gene with Pmac I double digestion (purchased from Fermentas). With EcoR I digested plasmid pH105 (WuJXetal.Efficientexpressionofgreenfluorescentprotein(GFP)mediatedbyachimericpromoterinChlamydomonasreinhardtii.ChineseJournalofOceanologyAndLimnology.Vol.26No.3, P.242-247,2008) obtain containing HSP70A-RBCS2 promoter and RBCS2 stopsThe about 731bp of part of son, is inserted into pSP124 (Lambrerasv, StevensDR, PurtonS.EfficientforeigngeneexpressioninChlamydomonasreinhardtiimediatedbyanEndogenousintron.PlantJ.1998; 14 (4): 441-447), in, obtain plasmid pH124. Chlamydomonas reinhardtii nucleusGenetic transformation plasmid pH124 contains HSP70A-RBCS2 promoter sequence and RBCS2 terminator sequence, and centre carriesThe polyclone restriction enzyme sites such as Nhe I, Pmac I, SalI, XbaI, BamHI and DdeI, can insert the genes of interest of external source at LayIn mattress chlamydomonas, express. Plasmid pH124 contains genetic expression box HSP70A-RBCS2::ble::RBCS2 simultaneously. When what transformWhen host cell obtains phleomycin and Zeomycin resistance, can be used as the selection markers of Chlamydomonas reinhardtii genetic transformation.
Obtain HAV1 and HAV1 ' gene from plasmid pUC57HAV1 and pUC57HAV1 ' time, use restriction enzymeEnzyme Nhe I and Pmac I digest 2h to Mesoplast heredity expression vector pH124 under 37 DEG C of conditions, and adopt molecular biosciences to learn to doSection is spent the night and is connected with HAV1 or HAV1 ' gene respectively, adopts heat shock method that the connecting fluid of spending the night is transduceed into competent cellIn Top10. Heat shock is applied in cell respectively contains on corresponding antibiotic LB flat board later, filters out monoclonal, and respectivelyWith Auele Specific Primer HAV1a, HAV1b by method (94 DEG C of denaturation 5min, 94 DEG C, the 30s of bacterium colony PCR; 55 DEG C, 30s; 72DEG C, 1min, 30 circulations, 72 DEG C are extended 5min) filter out positive colony. Obtain HAV1 and express framework HSP70A-RBCS2::HAV1::RBCS2, the Chlamydomonas reinhardtii Mesoplast heredity that has also obtained HAV1 gene simultaneously transforms expression vector pH124HAV1 (to be seenFig. 1) and obtain HAV1 ' expressions framework HSP70A-RBCS2::HAV1 ':: RBCS2, the while has also obtained the Lay of HAV1 ' geneMattress chlamydomonas Mesoplast heredity transforms expression vector pH124HAV1 '.
(2) structure of bird flu antigen gene Chlamydomonas reinhardtii mitochondrial inheritance expression vector
By learning in plasmid pUC57HAV2 and contain in HAV2 gene, pUC57HAV2 ' and contain HAV2 ' in embodiment 1Gene, owing to having added suitable restriction enzyme site, so can pass through restriction enzyme in optimizationPst I and Xho I double digestion obtain HAV2 and HAV2 ' gene. Its right-hand member of Chlamydomonas reinhardtii mitochondrial inheritance expression vector pNCF hasND4 and the Cob gene whole audience are as the right-hand member homologous sequence (being called for short NC gene, 2503bp) of genetic transformation, and its left end has left end weightComplex sequences (Left gene, 544bp) is as the left end repetitive sequence of genetic transformation.
Obtain obtaining HAV2 ' gene in HAV2 gene, plasmid pUC57HAV2 ' from plasmid pUC57HAV2 time, makeWith restriction enzyme Pst I and Xho I to Mesoplast heredity expression vector pNCF (CN101255438A) temperature at 37 DEG CLower digestion 2h, spends the night HAV2 to be connected with it with HAV2 ' gene respectively, adopts heat shock method that the connecting fluid of spending the night is transduceed into competenceIn cell Top10. Heat shock is applied in cell respectively contains on corresponding antibiotic LB flat board later, filters out monoclonal, andPass through method (94 DEG C of denaturation 5min, 94 DEG C, the 30s of bacterium colony PCR with Auele Specific Primer HAV2a, HAV2b respectively; 55 DEG C,30s; 72 DEG C, 1min, 30 circulations, 72 DEG C are extended 5min) filter out positive colony. Obtain HAV2 gene Chlamydomonas reinhardtii mitochondriaGenetic expression carrier pNCFHAV2 (seeing Fig. 2) and acquisition HAV2 ' gene Chlamydomonas reinhardtii mitochondrial inheritance expression vectorpNCFHAV2’。
(3) structure of bird flu antigen gene Chlamydomonas reinhardtii Chloroplast Inheritance expression vector
Contain in HAV3 gene, plasmid pUC57HAV3 ' and contain by learning in embodiment 1 in plasmid pUC57HAV3HAV3 ' gene, owing to having added suitable restriction enzyme site in optimization, so can be by restrictedCut enzyme Nco I and Pst I double digestion and obtain HAV3 gene, HAV3 ' gene. Because plasmid p423 is (purchased from Duck university of U.S. clothingAlgae center) on carry aadA expression cassette (5 ' atpA::aadA::3 ' rbcL), meanwhile, aadA gene can be used as Chlamydomonas reinhardtiiThe selection markers of genetic transformation, gives host cell spectinomycin resistance, and it 5 ' has chlB gene (490bp) as chlamydomonasThe right-hand member homologous sequence of genetic transformation, 3 ' has the left end homologous sequence of chlB gene (630bp) as chlamydomonas genetic transformation equally.By Nco I and Pst I restriction enzyme digestion enzyme, p423 is digested to 2h under 37 DEG C of conditions, excision aadA gene, then respectively willThe HAV3 gene obtaining, Nco I and the Pst I restriction enzyme site that HAV3 ' gene is inserted into p423 carrier, adopt T4 ligase 26The connection of spending the night under DEG C condition, obtains HAV3 expression casette 5 ' atpA::HAV3::3, and rbcL, obtains HAV3 ' expression casette 5 'AtpA::HAV3 ':: 3, rbcL. Use respectively restriction enzyme Ecor V and Sma I double digestion 2h under 37 DEG C of conditions to obtainTo HAV3, HAV3 ' expression casette, spend the night and be connected with the p423 plasmid digesting through Ecor V, adopt heat shock method spending the night connectionLiquid is transduceed in competent cell Top10. Heat shock is applied in cell respectively contains on corresponding antibiotic LB flat board later, sieveSelect monoclonal, and pass through method (94 DEG C of denaturation 5min, 94 of bacterium colony PCR with Auele Specific Primer HAV3a, HAV3b respectivelyDEG C, 30s; 55 DEG C, 30s; 72 DEG C, 1min, 30 circulations, 72 DEG C are extended 5min) filter out positive colony. Pass through restriction enzymeEnzyme Xho I filters out Chlamydomonas reinhardtii Chloroplast Inheritance expression plasmid pH423HAV3 (seeing Fig. 3) and the Chlamydomonas reinhardtii leaf that forward connectsGreen body genetic expression plasmid pH423HAV3 '.
The genetic transformation of [embodiment 4] Chlamydomonas reinhardtii
(1) conversion of Chlamydomonas reinhardtii Chloroplast Inheritance expression vector
Adopt " electric shock conversion method " to carry out genetic transformation: configure fresh TAP culture medium, sterilizing, cooling, by healthy growthChlamydomonas reinhardtii cc-849 is inoculated in liquid TAP culture medium, treats that frustule grows to concentration for (1-2 × 106Cells/mL), putPut in cooled on ice, add 10%Tween-20 (1/2000/v/v), 4 DEG C, 5000rpm, centrifugal 5min, abandoning supernatant, to pack up algae thinBorn of the same parents; Resuspended with the frustule to collect being carried out containing the TAP nutrient solution of 40mM sucrose, and adjust frustule concentration and be 2 ×108Cells/mL; Get 100ul frustule suspension and transform in cup to 1mm electric shock, add concentration is 10ug/mL's simultaneouslyThe salmon sperm DNA (purchased from multifarious bio tech ltd) of pH423HAV3 or pH423HAV3 ' plasmid and 25ug/mL, evenly mixedClose; (temperature is that 10 DEG C, voltage are 2KV/cm in conversion to adopt electroporation (Eppendorf) to shock by electricity; Electric shock is transformed to cup to be placed in25 DEG C of water-bath 5min, transfer to suspension in the centrifuge tube that contains the fresh TAP culture medium of 10mL, under 22 DEG C of low light levels, cultivate 8h;The centrifugal 5min of 3000rpm room temperature (20-25 DEG C, identical up and down), abandons supernatant and collects frustule; With the fresh TAP nutrient solution pair of 500ulFrustule carries out after resuspended adding 3.5mL0.5%TAP culture medium, pours into and contain spectinomycin (150ug/mL) after mixingTAP solid plate on, be placed in 25 DEG C illumination box leave standstill cultivate about 15 days, the green of 1mm size to be grownAfter monoclonal algae group, it is identified.
(2) conversion of Chlamydomonas reinhardtii mitochondrial inheritance expression vector
Adopt " particle bombardment " to carrying out genetic transformation (must ensure that all operations process is strictly aseptic): to configure freshTAP culture medium, sterilizing, cooling, is inoculated in the Chlamydomonas reinhardtii cc-2654 of healthy growth in liquid TAP culture medium, treats frustuleGrow to concentration for (1-2 × 106Cells/mL), 5000rpm, centrifugal 5min, abandons supernatant and packs up frustule; With aseptic freshThe resuspended frustule precipitation of TAP culture medium, adjusting frustule concentration is 2 × 108Cells/mL; Draw 300ul frustule suspensionCoat TAP solid plate central authorities (diameter 3cm); (the approximately 90 μ E/M of illumination cultivation under the condition of 25 DEG C2/ s) 24h, waits to put downAfter forming one layer of cells layer, plate surface carries out next step operation; Getting concentration is the bronze suspension 100ul of 60mg/mL, adds simultaneouslyEntering concentration is plasmid to be transformed (pNCFHAV2 or pNCFHAV2 '), the 100ul2.5MCaCl of 100ug/ul5ug2And 40ul0.1M spermidine, with vortex oscillation device vibration 2-3mim, leaves standstill 1min, and centrifugal 2 seconds of 8,000rpm room temperature, abandons supernatant; AddThe ethanol of 280ul70% (volume ratio) cleans, and abandons supernatant; Add 280ul absolute ethyl alcohol to clean, abandon supernatant; Add 100ul withoutWater-ethanol is resuspended; Adopt via Particle Bombardment Transformation instrument (Bio-Rad) to carry out chlamydomonas conversion, get 10ulDNA bronze coating buffer and bombard,Parameter is: can split film helium pressure is 1100psi, and vacuum is 25inches.Hg, and target distance is 9cm, and bronze particle diameter is100nm; When after end of bombardment, the flat board after bombardment is positioned in the illumination box of 25 DEG C and cultivates 8h; With the fresh TAP of 1mLNutrient solution is washed down chlamydomonas cell to coat to contain on antibiotic flat board and is cultivated about 15 days, treats that flat board grows about 1mmThe green monoclonal algae of size is identified it after rolling into a ball.
(3) conversion of Chlamydomonas reinhardtii Mesoplast heredity expression vector
Adopt " pearl mill method " to carry out genetic transformation: to adoptPlasmidPurificationKit reagentBox (purchased from precious bioengineering (Dalian) Co., Ltd) extract Chlamydomonas reinhardtii Mesoplast heredity transform plasmid pH124HAV1 andPH124HAV1 ', then adopts " pearl mill method " to be carried out genetic transformation, and concrete operation step is as follows: (1) is by Cell Wall DeficientProperty Chlamydomonas reinhardtii cc-849 is inoculated in fresh TAP culture medium, and (cell number is under the condition of continuous illumination, to be cultured to logarithmic phase1-2 × 106 cell/mL), the centrifugal 6min of 5000rmp room temperature, abandons supernatant, collects frustule; (2) train with the TAP of fresh sterileThe resuspended precipitation of nutrient solution, adjusts frustule concentration to 2 × 108 cell/mL. Draw 300 μ l suspension in the EP pipe of 1.5mL(containing the 0.3mm bead of sterilizing); (3) add 1 μ g target DNA (to be digested to the conversion plasmid pH124HAV1 of wire by Not IOr pH124HAV1 ') in EP pipe, allow bead, algae strain and foreign DNA mix quick oscillation 25s; (4) mixed liquor is transferred toIn the culture tube of 50mL with sterilizing, add the aseptic fresh TAP nutrient solution of 10mL, 22 DEG C of cultivations under the 100rpm/min shaking table low light level20h, makes cellular-restoring; (5) the centrifugal 5min of 3000rpm room temperature, goes supernatant to collect algae liquid, resuspended gently with 0.8mLTAP, adds3.5mL, 40 DEG C, 0.5%TAP culture medium, is uniformly coated on by (containing the Zeomycin antibiotic of 10 μ g/ml) on TAP flat board. Extremely quietAfter dull and stereotyped 30min, be inverted flat board and cultivate 3-4 week in 22 DEG C of illumination boxs, treat that flat board grows the green list of about 1mm sizeAfter clone algae group, it is identified.
Screening and the qualification of [embodiment 5] transgene Chlamydomonas reinhardtii
Adopt different genetic transforming methods to Chlamydomonas reinhardtii Mesoplast heredity expression vector, Chlamydomonas reinhardtii mitochondrial inheritanceExpression vector and Chlamydomonas reinhardtii Chloroplast Inheritance expression vector carry out in genetic transformation, owing to having integrated corresponding resistance base simultaneouslyCause, as ble gene (having Zeomycin resistance) or aadA gene (having spectinomycin resistance), so by correspondingThe Zeomycin antibiotic flat board of 10ug/mL or the spectinomycin flat board of 150ug/mL can Preliminary screening go out to transform successfully singleThe strain of clone algae. Chlamydomonas reinhardtii cc-2654 carries out genetic transformation as genetic transformation acceptor to plasmid pNCFHAV2 and pNCFHAV2 'After, the Left gene order of its mitochondrial genomes disappearance can be repaired, and can be under the condition of illumination or darkCultivation continues to go down to posterity.
Can identify by the following method the monoclonal algae strain containing healthy growth on corresponding antibiotic flat board:Genomic DNA-Southernblot detects, RT-PCR detects, Westernblot detects and mouse antibodies WesternBlot detects. Specific as follows:
(1) extraction of the total DNA of transgenosis chlamydomonas
Can be inoculated in fresh TAP, at light in the monoclonal algae strain that contains healthy growth on corresponding antibiotic flat boardAccording to being cultured to the logarithm middle and later periods under condition, collect frustule, use TAKARAUniversalGenomicDNAExtractionKitVer.3.0 kit extracts total DNA of transgenic algae. Concrete operation step is as follows: (1) get 50mL fromCore barrel collect grow into the logarithm middle and later periods turn HAV1, HAV1 ', HAV2, HAV2 ', HAV3, HAV3 ' gene Chlamydomonas reinhardtii algae liquid,Centrifugal 5 minutes of 5,000rpm, abandons supernatant (algae liquid can repeat to get algae liquid once not as felt); (2) add the sterilizing of 150ulDistilled water or PBS suspension cell; (3) add the SolutionA of 500ul and the RNaseA1 of 1ul (when use, need mix), swashAfter 15 seconds of strong vibration, ice bath 5 minutes; (4) add the SolutionB of 400 μ l, vibration mixes; (5) add 4 DEG C of 1ml pre-Cold SolutionC solution, after fully mixing, the centrifugal 2min of 12,000rpm; (6) discard upper organic phase, then add 1ml'sThe SolutionC solution of 4 DEG C of precoolings, after fully mixing, 12,000rpm, 2min; (7) discard upper organic phase, then by waterPhase solution (colourless lower floor) is transferred to the FilterCup being placed on CollectionTube, centrifugal 1 minute of 12,000rpm(note: organic phase (upper strata), with color, do eliminate is attached to DNA and prepares on film otherwise can hinder DNA. INTERPHASE CARBIDE PRECIPITATION is notMust consider, in the time filtering, will be removed); (8) abandon FilterCup pipe, in filtrate, add the DBBuffer of 400 μ l, evenlyMix; (9) SpinColumn in kit is placed on CollectionTube. By mixed in above-mentioned steps (8) operationThe solution closing is transferred in SpinColumn, and the centrifugal 1min of 12,000rpm, abandons filtrate; (10) add the RinseA of 500 μ l to addEnter to SpinColumn, the centrifugal 30s of 12,000rpm, abandons filtrate; (11) add the RinseB of 700 μ l to be added to SpinIn Column, the centrifugal 30s of 12,000rpm, abandons filtrate. (note: added 100% of designated volume in PLSCONFM RinseBEthanol. Please add RinseB along SpinColumn tube wall surrounding, contribute to like this to rinse completely the salt being built-up on tube wallPart); (12) repeat step (11) 1 times; (13) SpinColumn is placed in to CollectionTube above, 12,The centrifugal 1min of 000rpm; (14) SpinColumn is placed on the centrifuge tube of new 1.5ml, in SpinColumn filmCentre place adds sterile purified water or the ElutionBuffer of 50~200 μ l, and room temperature leaves standstill 1min. (15) 12,000rpm are centrifugal1min, eluent is DNA.
(2) DNA-Southernblot of transgenosis chlamydomonas detects
Adopt MiniBESTPlasmidPurificationKitVer2.0 kit to extract corresponding genetic transformationPlasmid, as template, designs Auele Specific Primer (FHAV1/RHAV1, FHAV2/RHAV2, FHAV3/RHAV3) simultaneously and makes land used highPungent labelled molecular probes kit (DIG-labeledDNAprobe) carries out pcr amplification. PCR product is carried out to 1% (qualityThan) agarose gel electrophoresis separation, cut glue and reclaim purifying, obtain the corresponding molecular probe by digoxigenin labeled.
FHAV1:5′-CTAGCTAGCAGCAAAAGCAGGGGT-3′
NheⅠ
RHAV1:5′-GATATCAGTAGAAACAAGGGTGTTTTTAAC-3′
EcoRⅤ
FHAV2:5′-CTAGCTAGCAACTCACGCTCAAGACATT-3′
NheⅠ
RHAV2:5′-GATATCGCAGAAGATACACCAGAAGA-3′
EcoRⅤ
FHAV3:5′-CTAGCTAGCGTATGGAATCAGTTCGTAATGG-3′
NheⅠ
RHAV3:5′-GATATCTGGTGGTGGTGGTGTTAA-3′
EcoRⅤ
PCR condition is: 94 DEG C of sex change 30sec, and 58 DEG C of renaturation 30sec, 72 DEG C are extended 120sec, 30 circulations.
Adopt vacuum transferring film method to carry out transferring film, its concrete steps are as follows: transgenosis chlamydomonas is inoculated in to fresh TAP culture mediumIn, under low light condition, be cultured to after logarithmic phase, extract respectively the total DNA of transgenosis chlamydomonas and the total DNA of blank cc849. ToolBody step is as follows: (1) is extracted and obtained after the total DNA of transgenosis chlamydomonas, in total DNA to the 200ul centrifuge tube of the about 10ug of total amount; (2) addEnter corresponding appropriate restriction enzyme and (use Hind III and/or Nde I digestion with restriction enzyme transgenosis Lay mattress Lay mattress clothingAlgae genome enzyme are cut Chlamydomonas reinhardtii cc-849 genome and are done the negative control that corresponding enzyme is cut) enzyme spends the night in the water-bath of 37 DEG CCut (adding during this time enzyme once); (3) next day, the agarose electrophoresis glue of configuration one 0.8% (mass ratio), and enzyme is cut to productDNA is all splined in running gel glue hole, 110V, 90min; (4), after electrophoresis is run through, running gel through 10 × SSC rinse onceBe placed on rinsing 15min in 0.25MHCl, then use ddH2O washed with de-ionized water 2 times; (5) by running gel 0.5NNaOHRinsing 30min (film and filter paper are placed in to 10 × SSC after ddH2O rinse soaks simultaneously); (6) now, by vacuum transferring filmInstrument is opened preheating, and blank and partial veil are cleaned up and install stand-by (blank being put into after vacuum transferring film instrument then by filter paperBe padded on blank upper strata, then put film, after pressing surely with green flexible glue piece, put running gel, drive gently bubble away with glass bar, press steadyTransferring film instrument, opens vacuum valve, pour 10 × SSC into not having running gel, and vacuum pressure is adjusted to 5inchesofHg, transferring film90min); (7) turned after film, cleaned film 2 times, each 5min with 2 × SSC; (8) by the moisture above film with filter paper blot (note:Unavailable filter paper goes to wipe, and should clip film with two filter paper and put into 120 DEG C of baking ovens and dry 30min); (9) by DIGEasyHyb (10ml/100cm2) and film are put hybrid pipe (as far as possible avoiding producing aeration hybridization efficiency), 37 DEG C of prehybridizations together into30min; (10) be ready to hybridization solution, probe (about 25ng/ml) boiling water bath 5min is placed in cooled on ice at once, cooling after by liquidBody is centrifugal to managing at the end, and (suitable hybridization bottle size and determining is put-15~-20 DEG C to add appropriate DIGEasyHyb to be mixed with hybridization solutionPreserve; Bathe 10min with carrying out before 68 DEG C of temperature); (11) hybridization: by prehybridization solution evacuation, pour the new hybridization solution of certain volume into,37 DEG C of hybridization of spending the night; (12) hybridized after by 2 × SSC for film (0.1%SDS), clean 2 times, each 5min (at room temperature shakesBed jog); (13) 0.5 × SSC (0.1%SDS), clean 2 times, and (solution need preheating in 68 DEG C of water-baths, water-bath for each 15minMiddle rinsing); (14) with appropriate Washingbuffer by film rinsing 1-5min; (15) use appropriate Blockingsolution(100ml/100cm2) sealing 30min (shaking table shakes gently); (16) in (15), add appropriate Anti-Digoxigenin-AP, 30min (shaking table shakes gently); (17) add Detectionbuffer, 4ml, 2-5min (shaking table shakes gently); (18)Add appropriate nitrite ion (80 μ lNBT/BCIPStocksolution+3.920mlDetectionbuffer, dark colour developing30min-4h, until there is obvious black-and-blue band (can observe every half an hour colour developing situation, as existing obvious band is used immediatelyddH2O rinses, cessation reaction).
Result is as shown in Fig. 5, Fig. 6, Fig. 7.
(3) extraction of the total RNA of transgenosis chlamydomonas and RT-PCR detect
To turn HAV1, HAV1 ', HAV2, HAV2 ', HAV3, HAV3 ' Chlamydomonas reinhardtii is inoculated in respectively in TAP culture medium at lightAccording to condition under cultivate to the logarithm middle and later periods, adopt the very fast extraction agent box of the total RNA of RNAfast200-to extract transgenosis chlamydomonas totalRNA, its concrete operation step is as follows: (1) gets 10ml chlamydomonas cell culture fluid, and 4 DEG C, the centrifugal 3min of 10,000rpm, abandons and takes back completelyCollection frustule; (2) add the resuspended frustule of 1ml1% (volume ratio) DEPC water, room temperature, the centrifugal 1min of 13,000rpm, abandons supernatant,And add again the resuspended frustule of 100 μ l1% (volume ratio) DEPC water; (3) add RA2 liquid 500 μ l, fully put upside down and mix 1min;(4) sample dissociation liquid is sucked in inner sleeve to room temperature, the centrifugal 1min of 13,000rpm; (5) discard the liquid in outer tube, inner sleeveIn pipe, add 500 μ l washing lotions, room temperature, the centrifugal 1min of 13,000rpm; Repeat this step once; (6) discard the liquid in outer tubeBody, does not add washing lotion, room temperature, the centrifugal 1min of 13,000rpm; (7) inner sleeve is added in another new 1.5mlEP pipe, at filmCentral authorities add 25 μ l1% (volume ratio) DEPC water, and room temperature leaves standstill 1min, and the centrifugal 1min of 13,000rpm, obtains total RNA; (8) getThe total RNA of 1 μ l capable 1% (mass ratio) agarose gel electrophoresis is analyzed the integrality of RNA.
Turn HAV1, HAV1 ', HAV2, HAV2 ', HAV3, the total RNA of HAV3 ' gene Chlamydomonas reinhardtii as template taking what extract, adoptUse TaKaRaRTreagentKitWithGdnaEraser (PerfectRealtime) reagentBox carries out RT-PCR. Use OligodTprimer and Random6mers to carry out the synthetic of cDNA the first chain. With reverse transcriptionCc849 and transgenosis chlamydomonas are template, use Auele Specific Primer to carry out the synthetic of cDNA the second chain. Concrete operation step is as follows:
A, the removal reaction of genomic DNA in total RNA. In 200uldPCR pipe, prepare following reactant liquor in table 1.
Table 1DNA removes reactant liquor
B adds 5.0ulTotalRNA (200ng/ul) in template operation district, and uses liquid-transfering gun in above-mentioned reactant liquorMix.
C carries out genomic removal reaction (42 DEG C, 2min) in PCR instrument, and 4 DEG C of preservations are stand-by.
D, reverse transcription reaction. Be formulated as follows reactant liquor in table 2.
Table 2 inverse transcription reaction liquid
E adds genome to remove reactant liquor 10.0ul in above-mentioned reactant liquor.
F carries out reverse transcription reaction (37 DEG C, 15min, 85 DEG C, 5s, 4 DEG C of preservations) in PCR instrument.
G, uses Auele Specific Primer to carry out the synthetic of cDNA the second chain, has reacted rear use 1 ﹪ (mass ratio) agarose and has coagulatedGel electrophoresis qualification.
As shown in Figure 8, all there is an obvious and single electrophoretic band in experimental group to result, and negative control does not have bar to take out ofExisting, this illustrates HAV1, HAV1 '; HAV2, HAV2 ' and HAV3, HAV3 ' gene have transcriptional activity in Chlamydomonas reinhardtii.
(4) the Western hybridization analysis of transgenosis chlamydomonas
Respectively by HAV1, HAV1 '; HAV2, HAV2 ' and HAV3, HAV3 ' transgenosis chlamydomonas are inoculated in fresh TAP culture mediumIn, in the time that frustule grows to the logarithm later stage, utilize the method for Mechanical Crushing to extract transgenosis chlamydomonas total protein, concrete steps asUnder: (1) gets the frustule nutrient solution 50mL after heat-inducible in blake bottle, and the centrifugal 5min of 5000rpm, abandons supernatant, collects algaeCell; (2) add 1mL deionized water resuspended, the centrifugal 5min of 5000rpm, abandons supernatant, collects frustule; (3) add 800ulPBS is resuspended, and adds a little bead after algae liquid is transferred in 1.5mLEP pipe, as for cooled on ice; (4) by cooling goodSample is put into the broken 25s of Mechanical Crushing instrument, totally 5 times. After fragmentation, all EP pipe to be taken out and put into cooled on ice each time, anti-Stop excess Temperature and cause albuminous degeneration; (5) by 4 DEG C of EP pipes, 12,000rpm, 20min, collects supernatant-80 DEG C preservation. SupernatantFor the total protein of transgenosis chlamydomonas cell. To extract transgene Chlamydomonas reinhardtii total protein, and carry out 12% SDS-PAGE electrophoresis and divideFrom, using 6 × His monoclonal antibody is primary antibodie, the goat anti-mouse igg of alkali phosphatase enzyme mark is anti-as two, (purchased from multifarious lifeThing Science and Technology Ltd.) carry out Western blotting. Concrete steps are as follows: (1) take out appropriate transgenic algae albumen add 5ul4 ×DualcolorProteinLoadingBuffer adds ddH simultaneously2O to 20ul carries out 12%SDS-PAGE electrophoresis, sampleHandle rear loading well and carry out electrophoretic separation (each loading swimming lane ensures that protein content is in 10ug left and right); (2) careful after electrophoresisUnload the separation gel separation gel part of running gel, gel is immersed in to electrotransfer buffer solution (0.037% (W/V) SDS, 48mMTris, 39mMGlycine, 20% (V/V) methyl alcohol) middle 5min; (3) with the filter paper and 1 of 10 suitable sizes of clean scissors cuttingOpen nitrocellulose filter (NC film), size is coincide with gel, then filter paper and NC film is immersed in to balance in electrotransfer buffer solution15min; (4) electrotransfer device is installed, (order once from negative pole to positive pole, once to put filter paper, NC film, gel and sponge wellFor black clamping plate-5 metafiltration paper-gel-NC film-5 metafiltration paper-white clamping plate), clamping device, guaranteeing does not have between glue and filmBubble; (5) switch on power, regulating electric current (constant current) is 320mA, 60min (note: answer handle assembly to be placed in the middle of the process turning at electricityIn the middle of ice bath, prevent that excess Temperature from affecting transfer effect); (6) take out film with pincet, with lavation buffer solution TBST rinsing 3 times,Each 5min; (7) by NC film as for 20mL3% (volume ratio) BSA (bovine serum albumin(BSA)) or PBST (0.13MNaCl, 0.01MNaH2PO4,, 0.2%Tween-20, pH7.0) in confining liquid, 4 DEG C of sealings are spent the night; (8) rare with confining liquid in the ratio of 1000:1Release 6 × His monoclonal antibody, film is taken out from confining liquid, be placed in hybrid pipe, the primary antibodie that adds to have diluted, 37 DEG C, assortedHand over 2h; (9) wash hybond membrane 3 times, each 10min with PBST (containing 0.2%Tween-20); (10) in envelope for the ratio of 1:1000Close liquid dilution two anti-(goat anti-mouse iggs of alkali phosphatase enzyme mark), and be positioned in hybrid pipe adherent hybond membrane, add withThat has diluted is two anti-, room temperature hybridization 1h; (11) wash hybond membrane 3 times with PBST (0.2%Tween-20), each 10min; (12)During hybond membrane is agreed without prior consultation as for one, under dark condition, add appropriate alkaline phosphatase substrate BCIP/NBT to develop the color;(12) if any obviously band appearance, add at once deionized water cessation reaction.
Results of hybridization is as shown in Fig. 9,10,11. This illustrates HAV1; HAV2, HAV2 ' and HAV3, HAV3 ' gene are at Lay mattress clothingIn algae, all can give expression to corresponding destination protein, but due to codon optimized mode difference, each in three groups of optimizationsThe expression of individual optimization is not identical yet, and the high-visible HAV1 ' of hybridization band of HAV1 fails to occur corresponding band;All there is corresponding band in HAV2 and HAV2 ', and the former is obviously dark than the latter's hybridization band color. HAV3 and HAV3 ' are alsoAll occur corresponding band, the former is obviously dark than the latter's hybridization band color. The gene that this explanation codon is optimizedHAV1, HAV1 '; HAV2, HAV2 '; The expression of HAV3, HAV3 ' gene is different. Therefore the preferred SEQID of the present inventionThe bird flu antigen gene of the optimization nucleotide sequence shown in NO.1, SEQIDNO.3 or SEQIDNO.5.
(5) the zoology antibody test of transgenosis chlamydomonas:
Collection turns HAV1, HAV1 '; HAV2, HAV2 ' and HAV3, HAV3 ' gene Chlamydomonas reinhardtii frustule, and with 0.9%It is 1 × 10 that physiological saline regulates frustule concentration8~2×108Cell/mL. To get six week age, clean level, male BALB/C little simultaneously8 of mouse, what feeding was collected turns HAV1, HAV1 '; HAV2, HAV2 ' and HAV3, HAV3 ' gene Chlamydomonas reinhardtii frustule, every dayOnce, whether only, observe during this time mouse self has abnormal response (festering etc. as whether active degree, epidermis have) to each 1mL/,Feed continuously the method that adopts eyeball to get blood after month and collect mice serum. Concrete steps are as follows: mouse is fixed with left handRemove eyeball of mouse with elbow tweezers folder afterwards, press mouse heart simultaneously blood is flowed out fast, and clean with prepreparedThe EP pipe of aseptic 1.5mL accesses blood (the EP pipe that blood is housed is placed on ice and is preserved). Take after blood mouse cracked endsProcess. By the blood 5 gathering, 000rpm, it is stand-by that centrifugal 5min collection supernatant is saved to-20 DEG C of refrigerators. Adopt Western simultaneouslyThe method of hybridization detects mouse and whether produces corresponding antibodies. Results of hybridization, as shown in Figure 12,13,14, turns HAV1 gene algae albumenHave obvious band to produce, HAV1 ' does not have corresponding band to occur, the AC of generation in HAV1 ' Mice Body is described veryLow or fail to produce corresponding antibody. Turning HAV2 and HAV2 ' gene algae albumen all has obvious band to produce, and HAV2 by contrastGene recombination band is slightly bright, the antibody better effects if of HAV2 generation is described a bit. Turn HAV3 and HAV3 ' gene algae albumen all has brightAobvious band produces, but HAV3 gene recombination band is brighter, illustrates that the antibody effect that HAV3 produces is better than HAV3 '. By observingThe position of band is basically identical with the position of use 6 × His monoclonal antibody results of hybridization band, and has eaten transgenosisThe mouse that the antibody ratio that the mouse of HAV1, HAV2, HAV3 algae liquid produces has eaten transgenosis HAV1 ', HAV2 ', HAV3 ' algae liquid producesRaw antibody better effects if. This explanation has eaten the mouse that turns HAV1, HAV2, HAV3 gene Chlamydomonas reinhardtii plant vaccine and really canEnough produce avian influenza antibody, reached the effect of plant vaccine.