CN103805715A

CN103805715A - Preparation method and application of fluorescent marker gene chip reagent for detecting ToRCH (toxopasma, rubella virus, cytomegalo virus and herpes virus)

Info

Publication number: CN103805715A
Application number: CN201410016220.3A
Authority: CN
Inventors: 范晓军; 赵秋勇; 李瑶; 刘建红
Original assignee: Taiyuan University of Technology
Current assignee: Taiyuan University of Technology
Priority date: 2014-01-14
Filing date: 2014-01-14
Publication date: 2014-05-21

Abstract

The invention discloses a preparation method of a fluorescent marker gene chip reagent which can be used for simultaneously detecting ToRCH, namely five pathogens such as toxopasma, rubella virus, cytomegalo virus and pure herpes virus type I/II. Compared with the prior art, the preparation method has the characteristics of high specificity, high sensitivity and short operation time, and therefore, the preparation method has broad application prospect. In addition, the invention provides the reagent obtained by the preparation method and a kit used for the detection method.

Description

Fluorescent mark gene chip preparation method of reagent thereof and application thereof that a kind of ToRCH detects

Technical field

The invention belongs to medical test and biochip technology field, be to provide specifically a kind of gene chip kit to the five kinds of larger pathogenic micro-organism of harm: ToRCH of mankind's urogenital tract, toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I and II type (Herpes Virus I/II) infect and detect simultaneously.

Background technology

ToRCH is the English name abbreviation of one group of pathogenic micro-organism, wherein T (Toxopasma) is toxoplasma gondii, R (RubellaVirus) is rubella virus, C (Cytomegalo Virus) is giant cells, and H (Herpes Virus) is herpes simplex I and/or II type.The fetal anomaly that arch insect infection can cause comprises hydrocephalus, little deformity of brain, choroidoretinitis and brain calcification, rubella virus infection causes fetal congenital cataract, congenital heart disease and neural heariing loss, cytomegalovirus infection causes intrauterine growth retardation, little capitiform, encephalitis, retina arteries and veins film inflammation, jaundice, hepatosplenomegaly, hemolytic anemia etc., and herpes simplex virus I/II type infects and causes miscarriage or newborn infant's morbidity.

ToRCH detection is mainly based on immunological method clinically at present, as detected the IgG or the IgM that produce after corresponding pathogenic infection human body with ELISA or Radioactive colloidal gold, detect specific IgM explanation patient for recent infection, or the virus of the hiding generation recurrent infection that is activated, detecting specific IgG is previous infection, existing certain immune level.Pathogenic agent specific antigen or antibody horizontal in maternal blood are detected with immunological method, equal Shortcomings in its sensitivity and specificity, and owing to using reagent complexity, the operating time is long, is unfavorable for that patient learns detected result in time; And for the pathogenic infection that can cause fetal anomaly, as ToRCH etc., cannot accomplish to detect simultaneously.

Biochip technology is the emerging biometric technology that the nineties grows up.Classify according to detected object, can be divided into the large class of gene chip and protein chip etc. two.After referring to a large amount of (common every square centimeter of reticular density is higher than 400) probe molecules are fixed on upholder, gene chip hybridizes with the sample molecule of mark, by detecting the hybridization signal intensity of each probe molecule and then obtaining quantity and the sequence information of sample molecule.

Summary of the invention

The problems referred to above that exist for prior art, one of object of the present invention is to provide a kind of for carry out ToRCH simultaneously, that is toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), the preparation method of the fluorescent mark gene chip reagent of five kinds of pathogen detection such as herpes simplex virus I and II type (Herpes Virus I/II), adopt the method to make the peripheral blood of detection kit with pregnant woman, genital secretion, cerebrospinal fluid etc. are for detecting sample, one-time detection can infect and judge the ToRCH existing in sample, achievement in research can improve clinical diagnosis accuracy rate and ageing, prenatal and postnatal care is extremely important.

For achieving the above object, the technical solution used in the present invention is as follows:

One can detect ToRCH simultaneously, that is the preparation method of the fluorescent mark gene chip reagent of five kinds of pathogen detection such as toxoplasma gondii (Toxopasma), rubella virus (RubellaVirus), cytomegalovirus (Cytomegalo Viuus), herpes simplex virus I/II type (Herpes Virus), the method comprises the following steps:

1. target sequence is determined:

The present invention uses following target sequence: according to the gene order of toxoplasma gondii (Toxopasma), rubella virus (RubellaVirus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I and the II type (Herpes Virus I/II) of report, select one section of gene order that specificity is better, fragment length is applicable as the target sequence detecting;

Selected target sequence, after sequence analysis retrieval, is thought one section of sequence that specificity is higher;

Toxoplasma gondii

CTATGGTCATGAACCTCAGCGCTTCTGGGAATTCGTTAAAGACATTCCGGAGAAGCTTTCGCAGCCCTCGCCAGTTCTGGAGCTCACTAGGACGCATGCAGGGCAGCCTGACAAGAACGGCGTGTITTTCCTTGGGTCTAGAACGGTAACAAACGAGTGGAAAAAATCTTCCTCGTGGACCCACATTCTTGTGGGACACATG

Rubella

CTGGCACCGACTGCTGCGCATGCCAGTGCGCGGCCTCGACGGCGACAGCGCCCCGCTTCCCCCCCACACCACCGAGCGCATTGAGACCCGCTCGGCGCGCCATCCTTGGCGCATCCGCTTCGGTGCCCCCCAGGCCTTCCTTGCCGGGCTCTTGCTCGCCACGGTCGCCGTTGGCACCGCGCGCGCCGGGCTCCAGCCCCGCGCTGATATGGCGGCACCTC

Cytomegalovirus

CACGGTTACCACCAACTGTCTCGTGAAAGCAGAAAATACCCACCTGACATGTAAGTGCAATCCGAATACCACATCTAATACCAACAATGGCAGCAAGTGCCACGCGATGTGCAAATGCAGGGTCACAGAACCCATTACCATGCTAGGCGCATACTCGGCCTGGGGCGCGGGCTCGTTCGTGGCCACGCTGATAGTCCTGCTGGTG

Herpes simplex virus I-type

GCGAACTCGGTCTAACGTTACACCCGAGGCGGCCTGGGTCTTCCGCGGAGCTCCCGGGAGCTCCGCACCAAGCCGCTCTCCGGAGAGACGATGGCAGGAGCCGCGCATATATACGCTTGGAGCCAG

Herpes simplex virus type II

GTCTAGGGTTGAACCGGCGAGGGCGGCCTCGGCCGGCGGAGCCCCGGAGCTCCGAAGGTCTGCGCGAGGCCGCTCTCCGAAGAGACGATGGGAGCCCCGCGTATATATCCGCGAGGGCCC

Preferably, the present invention introduces human actin β-action gene as house-keeping gene, and checkout procedure is carried out to Quality Control.In one-time detection result, if Actin muscle β-action gene test site, is also that Quality Control site result is negative, so current detected result is insecure, only have site to be checked and Quality Control site to present the positive, this time detected result just can be confirmed as the positive simultaneously.

Special β-action gene order is as the target sequence of check, as follows:

TACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGC，TTCACcACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTG

2. probe and design of primers

After target sequence is determined, according to primer and probe design principle, each pathogenic agent primer and the concrete sequence of probe of design are as follows:

Toxoplasma gondii TOX

Primer l:5 ' cy3-CTATGGTCATGAACCTCAGCGCT-3 '

Primer 2: 5 '-CATGTGTCCCACAAGAATGTGG-3 '

5’NH3—TTTTTTTTTTTTTAGGGCTGCGAAAGCTTCTCCGGAATGTC—3’

Rubella RV

Primer 1:5 ' cy3-CTGGCACCGACTGCTGCGCATG-3 '

Primer 2: 5 '-GAGGTGCCGCCATATCAGCGCG-3 '

5’NH3—TTTTTTTTTTTTTAGCGGGTCTCAATGCGCTCGGTGGTGT—3’

Cytomegalovirus HCMV

Primer 1:5 ' cy3-CACGGTTACCACCAACTGTCTC-3 '

Primer 2: 5 '-CACCAGCAGGACTATCAGCGTG-3 '

5’NH3—TTTTTTTTTTTTTCACTTACATGTCAGGTGGGTATTTTC—3’

Hsv HSV I type

Primer 1:5'cy3GCGAACTCGGTCTAACGTTACAC-3 '

Primer 2: 5'-CTGGCTCCAAGCGTATATATGCG-3 '

5'NH3—TTTTTTTTTTTTTCCCGGGAGCTCCGCGGAAGACCCAGGCC—3’

Hsv HSV II type

Primer 1:5'cy3GTCTAGGGTTGAACCGGCGAGG-3 '

Primer 2: 5'-GGGCCCTCGCGGATATATACGC-3 '

Probe: 5 ' NH3-TTTTTTTTTTTTTGGAGCTCCGGGGCTCCGCCGGCCGAG-3 '

3. primer mark:

For make PCR result can be in time, effectively analyzed, carry out mark at 5 ' end of all primers 1 with the plain cy3 of flower cyanines, the absorption of cy3 and emission wavelength are respectively 548nm, 562nm;

4. probe modification

The present invention use probe need to through modification: 5 ends of probe after amido modified, be fixed to aldehyde radical activate gene chip sheet base on;

5. sample to be tested template extraction:

Ordinary method and testing sequence are extracted the genome of pathogenic agent;

6.PCR amplification and fluorescent mark,

With RT-PCR technology amplification template, adopt 25ul system, reaction conditions is 95 ℃, 30s; 55 ℃, 45s; 72 ℃, 60min, totally 35 circulations;

Composition	Use volume
		Primer (cy3 mark 5 ' end)	10pM0.2ul
I0×PCR?buffer	2.5ul
		Template DNA	3ul
Archaeal dna polymerase	0.5ul
		ThermoScript II	0.5ul
dNTP	2ul
		ddH2O	Be supplemented to 25ul

7. point sample, amidized probe is diluted to after 50pmol/ul with deionized water, getting 0.5ul drips on aldehyde radical sheet base, room temperature is placed and is spent the night, successively with the each wash-out 5min of elutriant I (5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS), to not have the probe of fixing to wash away, then centrifuge dripping be for subsequent use;

8. hybridization, carries out in situ hybridization by the probe on PCR product and sheet base, at 42 ℃, keeps 40min, use elutriant I (5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS) each wash-out 5min;

9. interpretation of result: by laser confocal scanning instrument detection results of hybridization;

Quality Control site and testing sample are all the positive: detect;

The Quality Control site positive, testing sample is negative: do not detect;

Quality Control site feminine gender, testing sample feminine gender: process of the test is wrong, need heavily examine.

Another object of the present invention is to provide a kind of reagent being made by preparation method of the present invention and detects the application in fluorescent mark gene chip kit at ToRCH;

A further object of the invention is to provide the fluorescent mark gene chip kit that a kind of ToRCH detects, mainly comprise gene chip body, the fluorescent mark gene chip reagent that adopts ToRCH that preparation method of the present invention makes to detect, wherein gene chip body is made up of solid phase carrier and the probe that is fixed on the ToRCH related diseases substance specific detection target sequence on this carrier-pellet base, described ToRCH related diseases substance is toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), five kinds, herpes simplex virus I-type and II type (Herpes Virus I and II) etc.

Preparation method of the present invention makes the beneficial effect of reagent:

(1) high specific: fluorescent mark combines with molecular detection technology and improved specificity and accuracy;

(2) high-throughput: can simultaneously detect 5 kinds of pathogenic agent;

(3) highly sensitive: after pcr amplification, even very low pathogenic agent copy number also can be detected and obtain;

(4) somatotype detects: the hypotype that can simultaneously detect two kinds of hsvs;

(5) elapsed time is short: detect required time consuming time shorter than ordinary method;

(6) contain internal reference point, the accuracy that detects operation is carried out to Quality Control.

Accompanying drawing explanation

Fig. 1 is five kinds of former while detected results of causing a disease, in figure, T represents toxoplasma gondii, R represents rubella virus, C represents cytomegalovirus, H I represents simple born of the same parents' rash I type, HII represents simple born of the same parents' rash II type, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 2 is toxoplasma gondii detected result, and in figure, T represents toxoplasma gondii, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 3 is rubella virus detected result, and in figure, R represents rubella virus, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 4 is cytomegalovirus detected result, and in figure, C represents cytomegalovirus, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 5 is herpes simplex virus I-type detected result, and in figure, H I represents simple born of the same parents' rash I type, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 6 is herpes simplex virus type II detected result, and in figure, HII represents simple born of the same parents' rash II type, and QC is house-keeping gene---the detection site of human actin β-action gene is also the Quality Control site of chip;

Fig. 7 is sensitivity experiment result figure;

Embodiment

Below in conjunction with embodiment to the present invention do further in detail, intactly explanation.

Laser confocal scanning instrument is purchased from cold spring port bio tech ltd, marque GenePix4000B; Thermostat water bath is purchased from global scientific instrument factory of Community of Jin Tan County city, marque HH-8; Gene chip sheet base is purchased from Baiao Science and Technology Co. Ltd., Shanghai, marque BSM03015; Virus genom DNA/RNA is total to extraction reagent kit purchased from Tian Gen biochemical technology company; SSC and SDS are all purchased from traditional Chinese medicines group.Other biological reagent and the chemical reagent that in the present invention, use, if no special instructions, be the above rank of analytical pure or analytical pure.

Embodiment 1

1. target sequence is determined:

Preferably, the present invention introduces human actin β-action gene as house-keeping gene, and checkout procedure is carried out to Quality Control, and sequence is as follows:

TACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTG

2. probe and design of primers

Toxoplasma gondii TOX

Primer 1:5'cy3-CTATGGTCATGAACCTCAGCGCT-3 '

Primer 2: 5'-CATGTGTCCCACAAGAATGTGG-3 '

5'NH3—TTTTTTTTTTTTTAGGGCTGCGAAAGCTTCTCCGGAATGTC—3’

Rubella RV

Primer 1:5 ' cy3-CTGGCACCGACTGCTGCGCATG-3 '

Primer 2: 5 '-GAGGTGCCGCCATATCAGCGCG-3 '

5'NH3—TTTTTTTTTTTTTAGCGGGTCTCAATGCGCTCGGTGGTGT—3’

Cytomegalovirus HCMV

Primer 1:5'cy3-CACGGTTACCACCAACTGTCTC-3 '

Primer 2: 5 '-CACCAGCAGGACTATCAGCGTG-3 '

5’NH3—TTTTTTTTTTTTTCACTTACATGTCAGGTGGGTATTTTC—3’

Hsv HSV I type

Primer 1:5'cy3-GCGAACTCGGTCTAACGTTACAC-3 '

Primer 2: 5 '-CTGGCTCCAAGCGTATATATGCG-3 '

5’NH3—TTTTTTTTTTTTTCCCGGGAGCTCCGCGGAAGACCCAGGCC—3’

Hsv HSV II type

Primer 1:5'cy3-GTCTAGGGTTGAACCGGCGAGG-3 '

Primer 2: 5 '-GGGCCCTCGCGGATATATACGC-3 '

Probe: 5 ' NH3-TTTTTTTTTTTTTGGAGCTCCGGGGCTCCGCCGGCCGAG-3 '

3. primer mark:

4. probe modification

5. sample to be tested template extraction:

Use virus genom DNA/RNA extraction reagent kit altogether, ordinary method and testing sequence are extracted the genome of pathogenic agent;

6.PCR amplification and fluorescent mark,

Composition	?
		Primer (cy3 mark 5 ' end)	10pM0.2ul

10×PCR?buffer	2.5ul
		Template DNA/RNA	3ul
Archaeal dna polymerase	0.5ul
		ThermoScript II	0.5ul
dNTP	2ul
		ddH2O	Be supplemented to 25ul

8. hybridization, by PCR product and sheet base on probe carry out in situ hybridization, at 42 ℃, keep 40min, the each wash-out 5min of use elutriant I (5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS);

9. interpretation of result: by laser confocal scanning instrument detection results of hybridization, specifically ask for an interview accompanying drawing 1.

Quality Control site and five kinds of testing samples, toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I/II type (Herpes Virus) are all rendered as the positive: result is for detecting.

Embodiment 2

With Coxsackie virus, treponema pallidum, parvovirus, hepatitis B virus, HIV virus, chlamydozoan virus, toxoplasma gondii, rubella virus, cytomegalovirus, the extracting genome of the pathogenic agent samples such as herpes simplex virus I/II type is template, adopt primer and the probe of this experimental design to carry out Probe In Situ Hybridization, result only has respectively toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I and II type (Herpes Virus I/II) produce fluorescent signal, detected result is shown in Fig. 2 to Fig. 6.Prove that preparation method of the present invention makes reagent and has specificity for the detection of toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), hsv herpes simplex virus I and II type (Herpes Virus I/II).

Embodiment 3

For determining detection sensitivity of the present invention, or the gene fragment of above-mentioned Quality Control gene human actin β-action is carried out to the verification test of concentration gradient.In the gene fragment of the synthetic β-action of Shanghai Sheng Gong biotechnology company limited, synthetic concentration is 1000ng/ml, the gene fragment of concentration known is carried out to 10 × gradient dilution, be diluted to 100ng/ml, 10ng/ml, 1ng/ml, 0.1ng/ml, 0.01ng/ml, 0.001ng/ml totally 6 concentration gradients.Carry out Fluorescent dye incorporation method mark pcr amplification with the primer that is marked with 5'cy3 designing.Amidized probe is diluted to after 50pmol/ul with deionized water, getting 0.5ul drips on aldehyde radical sheet base, room temperature is placed and is spent the night, successively with elutriant I (5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS) each wash-out 5min, will not have the probe of fixing to wash away, and then centrifuge dripping is for subsequent use.Probe on aforesaid PCR product and sheet base is carried out in situ hybridization, at 42 ℃, keep 40min, with the each wash-out 5min of elutriant I (5 × SSC, 1%SDS), elutriant II (0.25 × SSC, 1%SDS); Test result is through scanning, and sensitivity result is shown in respectively accompanying drawing 7.As can be seen here preparation method's gained reagent of the present invention in use lowest detectable limit can reach 10 ^-2extent of dilution, detecting lower bound is 10ng/ml.

Finally be necessary described herein: above embodiment is only for being described in more detail technical scheme of the present invention; can not be interpreted as limiting the scope of the invention, some nonessential improvement that those skilled in the art's foregoing according to the present invention is made and adjustment all belong to protection scope of the present invention.

Claims

One kind can be simultaneously for ToRCH, that is the preparation method of the fluorescent mark gene chip reagent of five kinds of pathogen detection such as toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I/II type (Herpes Virus), the method comprises the following steps:

A) target sequence is determined:

Select in the gene order of reported toxoplasma gondii (Toxopasma), rubella virus (Rubella Virus), cytomegalovirus (Cytomegalo Virus), herpes simplex virus I/II type (Herpes Virus) one section of gene order that specificity is better, fragment length is applicable as the target sequence detecting; Selected target sequence, after sequence analysis retrieval, is thought the sequence that specificity is higher, specific as follows:

Toxoplasma gondii

CTATGGTCATGAACCTCAGCGCTTCTGGGAATTCGTTAAAGACATTCCGGAGAAGCTTTCGCAGCCCTCGCCAGTTCTGGAGCTCACTAGGACGCATGCAGGGCAGCCTGACAAGAACGGCGTGTTTTTCCTTGGGTCTAGAACGGTAACAAACGAGTGGAAAAAATCTTCCTCGTGGACCCACATTCTTGTGGGACACATG(SEQ.ID.NO.1)

Rubella

CTGGCACCGACTGCTGCGCATGCCAGTGCGCGGCCTCGACGGCGACAGCGCCCCGCTTCCCCCCCACACCACCGAGCGCATTGAGACCCGCTCGGCGCGCCATCCTTGGCGCATCCGCTTCGGTGCCCCCCAGGCCTTCCTTGCCGGGCTCTTGCTCGCCACGGTCGCCGTTGGCACCGCGCGCGCCGGGCTCCAGCCCCGCGCTGATATGGCGGCACCTC(SEQ.ID.NO.2)

Cytomegalovirus

CACGGTTACCACCAACTGTCTCGTGAAAGCAGAAAATACCCACCTGACATGTAAGTGCAATCCGAATACCACATCTAATACCAACAATGGCAGCAAGTGCCACGCGATGTGCAAATGCAGGGTCACAGAACCCATTACCATGCTAGGCGCATACTCGGCCTGGGGCGCGGGCTCGTTCGTGGCCACGCTGATAGTCCTGCTGGTG(SEQ.ID.NO.3)

Herpes simplex virus I-type

GCGAACTCGGTCTAACGTTACACCCGAGGCGGCCTGGGTCTTCCGCGGAGCTCCCGGGAGCTCCGCACCAAGCCGCTCTCCGGAGAGACGATGGCAGGAGCCGCGCATATATACGCTTGGAGCCAG(SEQ.ID.NO.4)

Herpes simplex virus type II

GTCTAGGGTTGAACCGGCGAGGGCGGCCTCGGCCGGCGGAGCCCCGGAGCTCCGAAGGTCTGCGCGAGGCCGCTCTCCGAAGAGACGATGGGAGCCCCGCGTATATATCCGCGAGGGCCC(SEQ.ID.NO.5)

B) probe and design of primers

Each pathogenic agent primer and the concrete sequence of probe of design are as follows:

Toxoplasma gondii TOX

Primer 1:5 ' cy3-CTATGGTCATGAACCTCAGCGCT-3 ' (SEQ.ID.NO.7)

Primer 2: 5 '-CATGTGTCCCACAAGAATGTGG-3 ' (SEQ.ID.NO.8)

Probe: 5 ' NH3-TTTTTTTTTTTTTAGGGCTGCGAAAGCTTCTCCGGAATGTC-3 ' (SEQ.ID.NO.17)

Rubella RV

Primer 1:5 ' cy3-CTGGCACCGACTGCTGCGCATG-3 ' (SEQ.ID.NO.9)

Primer 2: 5 '-GAGGTGCCGCCATATCAGCGCG-3 ' (SEQ.ID.NO.10)

Probe: 5 ' NH3-TTTTTTTTTTTTTAGCGGGTCTCAATGCGCTCGGTGGTGT-3 ' (SEQ.ID.NO.18)

Cytomegalovirus HCMV

Primer 1:5 ' cy3-CACGGTTACCACCAACTGTCTC-3 ' (SEQ.ID.NO.11)

Primer 2: 5 '-CACCAGCAGGACTATCAGCGTG-3 ' (SEQ.ID.NO.12)

Probe: 5 ' NH3-TTTTTTTTTTTTTCACTTACATGTCAGGTGGGTATTTTC-3 ' (SEQ.ID.NO.19)

Hsv HSV I type

Primer 1:5 ' cy3-GCGAACTCGGTCTAACGTTACAC-3 ' (SEQ.ID.NO.13)

Primer 2: 5 '-CTGGCTCCAAGCGTATATATGCG-3 ' (SEQ.ID.NO.14)

Probe: 5 ' NH3-TTTTTTTTTTTTTCCCGGGAGCTCCGCGGAAGACCCAGGCC-3 ' (SEQ.ID.NO.20)

Hsv HSV II type

Primer 1:5 ' cy3-GTCIAGGGTTGAACCGGCGAGG-3 ' (SEQ.ID.NO.15)

Primer 2: 5 '-GGGCCCTCGCGGATATATACGC-3 ' (SEQ.ID.NO.16)

Probe: 5 ' NH3-TTTTTTTTTTTTTGGAGCTCCGGGGCTCCGCCGGCCGAG-3 ' (SEQ.ID. NO.21)

C) primer mark:

5 ' the end at all primers 1 carries out mark with flower cyanines element cy3, and the absorption of cy3 and emission wavelength are respectively 548nm, 562nm;

D) probe modification

5 ends of probe are fixed on the gene chip sheet base of aldehyde radical activation after amido modified;

E) sample to be tested template extraction:

Extract the genome of sample to be tested pathogenic agent by ordinary method and testing sequence;

F) pcr amplification and fluorescent mark,

With RT-PCR technology amplification template, adopt 25ul system, reaction conditions is 95 ℃, 30s; 55 ℃, 45s; 72 ℃, 60min, totally 35 circulations;

Composition ? Primer (cy3 mark 5 ' end) 10pM?0.2ul 10×PCR?buffer 2.5ul Template DNA 3ul Archaeal dna polymerase 0.5ul ThermoScript II 0.5ul dNTP 2ul ddH2O Be supplemented to 25ul

G) point sample, is diluted to amidized probe after 50pmol/ul with deionized water, gets 0.5ul and drips on aldehyde radical sheet base, and room temperature is placed and spent the night, and with elutriant wash-out 10min, will not have the probe of fixing to wash away, and then centrifuge dripping is for subsequent use;

H) hybridization, carries out in situ hybridization by the probe on PCR product and sheet base, at 42 ℃, keeps 40min, use elutriant I (5 × SSC, I%SDS), elutriant II (0.25 × SSC, 1%SDS) each wash-out 5min;

I) interpretation of result: by laser confocal scanning instrument detection results of hybridization.
2. the preparation method of the fluorescent mark gene chip reagent that can simultaneously detect ToRCH according to claim 1, it is characterized in that, described step target sequence a) is introduced human actin β-action gene as house-keeping gene in determining, checkout procedure is carried out to the monitoring of Quality Control point, special β-action gene order is as the target sequence of check, as follows:

TACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTG(SEQ.ID.NO.6)。
3. ToRCH detects the preparation method of fluorescent mark gene chip reagent according to claim 1, it is characterized in that described step I) interpretation of result, specific as follows:

Quality Control site and testing sample are all the positive: detect;

The Quality Control site positive, testing sample is negative: do not detect;

Quality Control site feminine gender, testing sample feminine gender: process of the test is wrong, need heavily examine.
4. the reagent making according to preparation method described in any one in claim 1～5 detects the application in fluorescent mark gene chip kit at ToRCH.
5. ToRCH detects a fluorescent mark gene chip kit, it is characterized in that, comprises following probe:

Toxoplasma gondii TOX probe:

5'NH3—TTTTTTTTTTTTTAGGGCTGCGAAAGCTTCTCCGGAATGTC—3’(SEQ.ID.NO.17)

Rubella RV probe:

5'NH3—TTTTTTTTTTTTTAGCGGGTCTCAATGCGCTCGGTGGTGT—3’(SEQ.ID.NO.18)

Cytomegalovirus HCMV probe:

5’NH3—TTTTTTTTTTTTTCACTTACATGTCAGGTGGGTATTTTC—3’(SEQ.ID.NO.19)

Hsv HSV I type probe:

Probe: 5'NH3-TTTTTTTTTTTTTCCCGGGAGCTCCGCGGAAGACCCAGGCC-3 ' (SEQ.ID.NO.20)

Hsv HSV II type probe:

5’NH3—TTTTTTTTTTTTTGGAGCTCCGGGGCTCCGCCGGCCGAG—3’(SEQ，ID，NQ.21)。