CN103773759A - Exogenous insertion element flanking sequences of transgenic rice strain 223F-S21 and application thereof - Google Patents
Exogenous insertion element flanking sequences of transgenic rice strain 223F-S21 and application thereof Download PDFInfo
- Publication number
- CN103773759A CN103773759A CN201310557887.XA CN201310557887A CN103773759A CN 103773759 A CN103773759 A CN 103773759A CN 201310557887 A CN201310557887 A CN 201310557887A CN 103773759 A CN103773759 A CN 103773759A
- Authority
- CN
- China
- Prior art keywords
- flanking sequence
- sequence
- primer
- paddy rice
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses an exogenous insertion element flanking sequence of a transgenic rice strain 223F-S21, wherein the flanking sequence is a 3-end flanking sequence and is shown as SEQ ID NO. 1. The invention further discloses an exogenous insertion element flanking sequence of another transgenic rice strain 223F-S21, wherein the flanking sequence is a 5-end flanking sequence and is shown as SEQ ID NO. 2. According to the invention, the exogenous insertion element flanking sequences of the transgenic rice strain 223F-S21 are cloned for the first time, and the situation that the exogenous insertion element flanking sequences of the transgenic rice strain 223F-S21 can be used as targeted DNA amplified fragments to establish sensitive and specific the strain specific qualitative PCR of the transgenic rice strain 223F-S21 is definite. By adopting the exogenous insertion element flanking sequences cloned and separated by the invention, a transgenic-strain specific PCR detection method can be further established.
Description
Technical field
The present invention relates to the gene order of biological technical field, specifically, relate to the flanking sequence of the external source Insert Fragment of a kind of transgenic paddy rice strain 223F-S21.
Background technology
Along with the development of genetic engineering technique, the new variety such as genetically modified crops corn, soybean, rape, cotton, tomato continue to bring out, and many countries have allowed plantation and the production of genetically modified crops.Paddy rice is one of most important food crop of China, and further investigation and the widespread use of transgenic technology in paddy rice had multiple transgenic paddy rice strains to carry out environment release at present, application commercialization plantation.Because transgenic product exists the series of problems such as ecological risk and food safety, therefore, corresponding security control laws and regulations have been formulated in countries in the world.The detection that transgenic plant are carried out to strain specificity is to the transgenic plant management that exercises supervision, and ensures the important technical basis of its sound development.And the flanking sequence of the external source Insert Fragment of transgenic plant is one of most important characterization of molecules of transgenic plant strain, therefore, the flanking sequence of external source Insert Fragment is the important technology data of setting up transgenic plant event-specific detection method.
Had Patents and bibliographical information at present transgenic plant external source insert flanking sequence, for example: magnify the people such as the soldier flanking sequence of external source Insert Fragment of corn strain MON863 that utilized TAIL-PCR methods analyst in 2006, set up the event-specific detection method of transgenosis MON863 corn.The people such as Xie Jiajian utilized the methods such as TAIL-PCR, genome walking and LD-PCR to obtain the flanking sequence of the external source Insert Fragment of No. 6, transgenic paddy rice Kemingdao, Bt Shan excellent 863 and Ke Feng in 2007, the people such as Yang Zhengyou utilized TAIL-PCR method to set up the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain SK-2 in 2012, and had set up the detection method of strain specificity.But, the analysis of existing patent and document is found, also without any article and the patent report of the flanking sequence of the external source Insert Fragment about transgenic paddy rice strain 223F-S21.
Related reference is specific as follows:
1, Liu Y-G, Mitsukawa N, Oosumi T, Whittier RF.1995.Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR(uses hot asymmetric interlaced PCR Arabidopis thaliana T-DNA to be inserted to effective separation and the mapping of node);
2, The Plant Journal8:457-463.Sambrook, Joseph, Russell and W.David.2001.Molecular Cloning:a laboratory manual(molecular cloning a: laboratory manual) .Volum 1-3.Cold Spring Harbor Laboratory Press;
3, Shen Zhicheng, woods Chaoyang, Xu Xiaoli, special gene and modification method and application, the CN201110009329[P of becoming of high-resistance glyphosate of Li Xinlan] .2011-08-10;
4, Xie Jiajian, Wang Xifeng, the flanking sequence of the external source Insert Fragment of the transgenic paddy rice strain Kemingdao 1 of Peng Yufa; China, 200710063778.7[P] .2008-08-13;
5, Xie Jiajian, Wang Xifeng, Peng Yufa. the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain Bt Shanyou 63: China, 200710063777.2[P] .2008-08-13;
6, Xie Jiajian, Wang Xifeng, Peng Yufa. the flanking sequence of the external source Insert Fragment that No. 6, strain Kefeng: China, 200710063780.4[P] .2008-08-13;
7, Yang Zhengyou, Li Wenhua, Zhao Fengchun, rural area. a kind of transgenic paddy rice exogenous insertion vector flanking sequence and application: 201210084127.7[P thereof] .2012-08-08;
8, magnify soldier, Yang Litao, Pan Aihu, Liang Wanqi, Yin Changsong, Xu Songci, Zhang Kewei, Wu Aibo. the adjacent gene order in side of the exogenous insertion vector of corn strain MON863: China, 200510027952.3[P] .2006-03-01.
Summary of the invention
The technical problem to be solved in the present invention is to provide flanking sequence of the external source Insert Fragment of a kind of transgenic paddy rice strain 223F-S21 and uses thereof.
In order to solve the problems of the technologies described above, the invention provides the flanking sequence of the external source Insert Fragment of a kind of transgenic paddy rice strain 223F-S21, described flanking sequence is 3 ' end flanking sequence, 3 ' end flanking sequence is as shown in SEQ ID NO.1.
The present invention also provides the flanking sequence of the external source Insert Fragment of another kind of transgenic paddy rice strain 223F-S21 simultaneously, and described flanking sequence is 5 ' end flanking sequence, and 5 ' end flanking sequence is as shown in SEQ ID NO.2.
The present invention also provides the preparation method of above-mentioned flanking sequence simultaneously: extract the genomic dna of transgenic paddy rice strain 223F-S21, increased and obtained by TAIL-PCR.
The present invention also provides the preparation method of above-mentioned flanking sequence simultaneously: extract the genomic dna of transgenic paddy rice strain 223F-S21, obtain by pcr amplification.
The present invention also provides the qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21 simultaneously: a primer is the forward primer according to 1-1155 bit sequence design in SEQ ID NO.1, and another primer is the reverse primer according to the 1156-1792 bit sequence design of SEQ ID NO.1; , two combination of primers in described PCR reaction are the Auele Specific Primer of flanking sequence described in claim 1.
Improvement as qualitative PCR detection method of the present invention: forward primer Rice-L sequence is:
5’-ACACAAGAAATAGAGGAAGCAGAGGAAT-3’
Described reverse primer LB-R sequence is:
5’-GCAAGGAACAGTGAATTGGAGTTCGTC-3’。
The present invention also discloses the qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of above-mentioned transgenic paddy rice strain 223F-S21 simultaneously: a primer is the forward primer according to 1-516 bit sequence design in SEQ ID NO.2, and another primer is the reverse primer according to the 517-1276 bit sequence design of SEQ ID NO.2; , two combination of primers in described PCR reaction are the Auele Specific Primer of flanking sequence described in claim 2.
Improvement as qualitative PCR detection method of the present invention:
Described forward primer RB-F sequence is: 5 '-GTCGCTGGTAGATGGTTGGCTGCAGGTCGT-3 '
Described reverse primer Rice-R sequence is: 5 '-TATCATATCACTCGTAGATCCCTTCTGCCT-3 '.
Qualitative PCR detection method as the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21 of the present invention: simultaneously contain following primer in described PCR reaction:
Forward primer Rice-L:5 '-ACACAAGAAATAGAGGAAGCAGAGGAAT-3 '
Reverse primer LB-R:5 '-GCAAGGAACAGTGAATTGGAGTTCGTC-3 '
Forward primer RB-F:5 '-GTCGCTGGTAGATGGTTGGCTGCAGGTCGT-3 '
Reverse primer Rice-R:5 '-TATCATATCACTCGTAGATCCCTTCTGCCT-3 '.
In the present invention: Agrobacterium-mediated Transformation T-DNA carrier is to build based on pCambia1300 carrier (CAMBIA, Brisbane, Austrilia), and structure is shown in Fig. 1.Be positioned at two independently T-DNA regions for the goal gene (Cry1Ac-Cry1Ie) and the selectable marker gene (G10, Antiglyphosate gene, Shen Zhicheng etc., 2011, patent No. CN102146371A) that transform.One of them T-DNA is made up of selectable marker gene G10 expression casette; Another T-DNA is made up of Cry1Ac-Cry1Ie fusion gene expression cassette.
Remarks: according to 35SYN promoter sequence: GeneBank ID:KF303140 and Cry1Ac-Cry1Ie sequence are: GeneBank ID:KF303141, just can obtain transgenic paddy rice strain 223F-S21.
The present invention adopts ordinary method, extracts plant genome DNA, utilizes TAIL-PCR partition method to obtain 3 ' end flanking sequence 1792bp, and its nucleotide sequence is as shown in SEQ ID NO.1.By analyzing, this 3 ' end flanking sequence comprises: rice genome sequence, be positioned at the 18201551-18202706 position of No. 3 karyomit(e)s of paddy rice (GenBank registration number: NC_008396.2), its nucleotide sequence is identical from the nucleotide sequence of 1-1155 position with SEQ ID NO.1; T-DNA left margin regional sequence, derives from foreign aid's insertion vector 1300-ubi1174-e35SYN-Cry1Ac-223, and its nucleotide sequence is identical from the nucleotide sequence of 1156-1792 position with SEQ ID NO.1.
Utilize pcr amplification to obtain 5 ' end flanking sequence 1276bp, its nucleotide sequence is as shown in SEQ ID NO.2.By analyzing, this 5 ' end flanking sequence comprises: conversion carrier 1300-ubi1174-e35SYN-Cry1Ac-223 partial sequence, and its nucleotide sequence is identical with the nucleotide sequence of the 1-516 position in SEQ ID NO.2; Rice genome sequence, is positioned at the 18202730-18203489 position of No. 3 karyomit(e)s of paddy rice (GenBank registration number: NC_008396.2), and its nucleotide sequence is identical from the nucleotide sequence of 517-1276 position with SEQ ID NO.2.
The qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, with 3 ' end flanking sequence and/or using 5 ' end flanking sequence as target DNA amplified fragments.According to 3 ' end flanking sequence design Auele Specific Primer, its forward primer can be according to the nucleotide sequence design of 1-1155 position, be according to rice genome sequences Design, be positioned at the 18201551-18202706 position of No. 3 karyomit(e)s of paddy rice (GenBank registration number: NC_008396.2), reverse primer can be according to the nucleotide sequence design of 1156-1792 position, be to design according to T-DNA left margin regional sequence, it is Rice-L:5 '-ACA CA AGAAATAGAGGAAGCAGAGGAAT-3 ' that the present invention designs forward primer, and reverse primer LB-R is:
5’-GCAAGGA AC AGTGAATTGGAGTTCGTC-3’。
According to 5 ' end flanking sequence design Auele Specific Primer, its forward primer can be according to the nucleotide sequence design of 1-516 position, be to design according to conversion carrier 1300-ubi1174-e35SYN-Cry1Ac-223 partial sequence, reverse primer can be according to the nucleotide sequence design of 517-1276 position, be according to rice genome sequence, be positioned at the 18202730-18203489 position of No. 3 karyomit(e)s of paddy rice (GenBank registration number: NC_008396.2), the forward primer of the present invention's design is RB-F:5 '-GTCGCTG GTAGAT GGTT GGCT GCAG GTCGT-3 ', reverse primer is Rice-R:5 '-TATCAT ATCACTCGT AGATCCC TTCT G CCT-3 '.
The present invention has cloned the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21 first, and the flanking sequence of the external source Insert Fragment of clear and definite transgenic paddy rice strain 223F-S21 can be used as target DNA amplified fragments, set up the strain specificity qualitative PCR of sensitive, specific transgenic paddy rice strain 223F-S21.The flanking sequence of the external source Insert Fragment that the present invention cloned, separates can further be set up transgenic lines PCR method for detecting specificity.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
The T-DNA domain structure schematic diagram of the conversion carrier 1300-ubi1174-e35SYN-Cry1Ac-223 of Fig. 1 transgenic paddy rice strain 223F-S21.
Fig. 2 obtains 3 ' the end flanking sequence of transgenic paddy rice strain 223F-S21 by TAIL-PCR method;
M:DNA Marker(GeneRuler
tM1kb DNA Ladder), size successively: 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 2500bp, 3000bp, 3500bp, 4000bp, 5000bp, 6000bp, 8000bp, 10000bp;
The secondary products of 1:SPII/AD4L combination; Three grades of products of 2:SPIV/AD4L combination.
Fig. 3 obtains 5 ' the end flanking sequence figure of trans-genetic hybrid rice strain 223F-S21 by PCR method;
M:DNA Marker（GeneRuler
TM1kb DNA Ladder）；
Combination of primers TDNA-F/ RR amplification 1,2,3,4: transgenic paddy rice strain 223F-S21;
-: contrast elegant water 134.
Fig. 4 transgenic paddy rice strain 223F-S21 3 ' end flanking sequence Auele Specific Primer Rice-L/LB-R detects figure;
M:DNA Marker（GeneRuler
TM1kb DNA Ladder）；
1,2,3,4: transgenic paddy rice strain 223F-S21;
-: contrast elegant water 134.
Fig. 5 transgenic paddy rice strain 223F-S21 5 ' end flanking sequence Auele Specific Primer RB-F/Rice-R detects figure;
M:DNA Marker（GeneRuler
TM1kb DNA Ladder）；
1,2,3: transgenic paddy rice strain 223F-S21;
-: contrast elegant water 134.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.These examples are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, for example Sambrook equimolecular clone: laboratory manual (New York:Cold Spring Harbor Laboratory press, 2001) condition described in, or the condition of advising according to manufacturer.
The clone of the flanking sequence of the exogenous insertion vector of embodiment 1, transgenic paddy rice strain 223F-S21
One, experiment material
1, vegetable material
Transgenic paddy rice: transgenic paddy rice strain 223F-S21.
2, enzyme and reagent
Molecular biology reagent, if Taq enzyme, TaKaRaLA Taq, pMD@18-T, DNA Marker are purchased from Dalian precious biotinylated biomolecule Engineering Co., Ltd.
Other biochemical reagents are import packing or domestic analytical pure.Primer and degenerated primer are synthetic by the raw work in Shanghai.
3, laboratory apparatus
Pcr amplification (Eppendorf co.), nucleic acid electrophoresis apparatus (DYY-6C, Beijing Liuyi Instrument Factory)
Other Instruments comprises: whizzer, electric heating constant temperature tank, electronic balance, incubator etc.
Two, experimental technique and process
1, oryza sativa genomic dna extracts and detects
The extraction of 1.1 oryza sativa genomic dnas
1.1.1 the configuration of oryza sativa genomic dna extracting solution (2%CTAB damping fluid)
1.1.2CTAB method is extracted rice leaf genomic dna
A, take 0.1-0.5g rice leaf, in liquid nitrogen, grind, add the 2%CTAB damping fluid of 1ml65 ℃ of preheating, fully mix and put into 65 ℃ of water-bath incubations 1 hour, frequently mix during this time.
B, add isopyknic chloroform, fully put upside down and mix 3 minutes, centrifugal 10 minutes of 10,000rpm, reclaims upper strata water.
C, add the isopropanol precipitating DNA of 0.7 times of volume.
D, cotton-shaped DNA is ticked, put into 75% washing with alcohol, centrifugal 3 minutes of 10,000rpm, abandons supernatant.
E, the air-dry DNA of room temperature, and add the Eluent dissolving DNA of 50ul.
1.2 the detection of oryza sativa genomic dna
Get the DNA solution that 5ul extracts, with 1% agarose gel electrophoresis, tentatively judge according to its brightness and banding pattern the quality of extracting DNA.Adopt ultraviolet spectrophotometer to measure concentration and the purity of the DNA extracting.
After measured, the concentration of the DNA that surveys is 1262ng/ul; Purity: A260/A280=1.78.
2, the separation of transgenic paddy rice strain 223F-S21 flanking sequence
2.1TAIL-PCR separates transgenic paddy rice strain 223F-S21 3 ' end flanking sequence
TAIL-PCR is for the flanking sequence of the known region that increases.TAIL-PCR describes in detail and sees (the Liu et al. such as Liu, 1995, The Plant Journal, 8 (3): 457-463), according to three nido specific PCR primer LB-SPI of T-DNA left margin zone design, LB-SPII, LB-SPIV, be combined into performing PCR amplification with degenerated primer AD4L successively, primer sequence is in table 1, and PCR reaction conditions is in table 2.
Table 1 is for degenerated primer and the Auele Specific Primer of TAIL-PCR amplification
Table 2TAIL-PCR response procedures and condition
PCR reaction system:
First round reaction: take LB-SPI and AD4L as primer, the paddy rice 223F-S21 genome of extraction is template;
Second takes turns reaction: take LB-SPII and AD4L as primer, first round product is template;
Third round reaction: take LB-SPIV and AD4L as primer, second to take turns product be template.
The separation of 2.2223F-S215 ' end flanking sequence
According to 223F-S213 ' the end flanking sequence rice genome sequence of having measured, at its downstream design primer RR, sequence is: 5 '-TATCATATCACTCGTAGATCCCTTCTGCCT-3 ', primer TDNA-F in carrier right border sequence, sequence is: 5 '-CTCGTTGATGTTGGGGTTGTTGTCCATTG-3 ' combination is increased.
Reaction system is: 2 × GCbuffer25ul, the each 2.5mM of dNTP mixture() 8ul, template (rice genome) 100ng, the each 1ul(10uM of upstream and downstream primer), TakaRa LA Tap polysaccharase (0.5U/ul) 0.5ul, adds sterile purified water to 50ul.
Amplification program: 94 ℃ of 1min; (94 ℃ of 30s, 60 ℃, 1min, 72 ℃ of 1min) 30 circulations; 72 ℃ of 10min.
2.3 sequencings and analysis
Pcr amplification product (above-mentioned steps 2.1 and 2.2 gained) carries out electrophoresis on 1% agarose gel, with DNA Gel Extraction kit(A) reclaim amplified fragments, be connected on pMD-18T carrier, check order.Adopt vector NTI10.0(Invitrogen) compare and analyze sequence and the carrier sequence similarity measured, in ncbi database (http://www.ncbi.nlm.nih.gov/), retrieve similar rice genome sequence with BLASTN.
3, experimental result
3 ' the end flanking sequence of 3.1 transgenic paddy rice 223F-S21
The TAIL-PCR amplification (above-mentioned steps 2.1 gained) on transgenic paddy rice 223F-S21 exogenous insertion vector 1300-ubi1174-e35SYN-Cry1Ac-223 border shows, secondary, three grades of amplified fragments products are single, and the close (see figure 2) of clip size.Reclaim third stage amplified production, be connected on pMD-18T carrier, carry out sequencing.
Remarks explanation: 1300-ubi1174-e35SYN-Cry1Ac-223 carrier is to build based on pCambia1300 carrier (CAMBIA, Brisbane, Austrilia).As shown in Figure 1.
Sequencing result shows, expanding fragment length is 1792bp, and wherein 1-1155bp is positioned at the 18201551-18202706 position of No. 3 karyomit(e)s of rice genome (GenBank registration number: NC_008396.2); 1156-1792 position is conversion carrier 1300-ubi1174-e35SYN-Cry1Ac-223 partial sequence.
3.2 5 ' the end flanking sequence of transgenic paddy rice 223F-S21
Utilize the amplification of TDNA-F/RR assembly PCR to obtain specific amplification, see Fig. 3.Sequencing shows, expanding fragment length is 1276bp, wherein 1-516 position is conversion carrier 1300-ubi1174-e35SYN-Cry1Ac-223 partial sequence, 517-1276 position is rice genome sequence, is positioned at No. 3 karyomit(e)s of paddy rice (GenBank registration number: NC_008396.2) 18202730-18203489 position.
Remarks explanation: contrast the conversion female parent that elegant water 134 is transgenic paddy rices, as negative control.
The qualitative PCR of the external source Insert Fragment flanking sequence of transgenic paddy rice 223F-S21 detects
One, experiment material
1, vegetable material
Transgenic paddy rice: transgenic paddy rice strain 223F-S21
Conventional rice: elegant water 134
2, enzyme and reagent
Molecular biology reagent, if Taq enzyme, TaKaRaLA Taq, pMD@18-T, DNA Marker are purchased from Dalian precious biotinylated biomolecule Engineering Co., Ltd.
Other biochemical reagents are import packing or domestic analytical pure.Primer and degenerated primer are synthetic by the raw work in Shanghai.
3, laboratory apparatus
Pcr amplification (Eppendorf co.), nucleic acid electrophoresis apparatus (DYY-6C, Beijing Liuyi Instrument Factory)
Other Instruments comprises: whizzer, electric heating constant temperature tank, electronic balance, incubator etc.
Two, experimental technique and process
1, oryza sativa genomic dna extracts and detects
See " oryza sativa genomic dna extracts and detects " in embodiment 1
2, the strain specificity PCR based on 3 ' end and 5 ' end flanking sequence detects
According to the 3 ' end of measuring in embodiment 1 and 5 ' end flanking sequence, respectively at its rice genome Sequence and conversion carrier Sequence design primer, in table 3.Pcr amplification result shows, 3 ' the end of transgenic paddy rice strain 223F-S21 and 5 ' end amplimer combination have obtained the 670bp of expection and the amplified fragments (content as shown in the underscore in the NO1 of sequence table and NO2) of 700bp, there is no corresponding amplified band and contrast elegant water 134, see Fig. 4 and Fig. 5.
The flanking sequence of the exogenous insertion vector that therefore, the present invention cloned, separates can be further used for setting up transgenic strain PCR method for detecting specificity.
3 ' the end of table 3 transgenic paddy rice strain 223F-S21 and 5 ' end event-specific detection primer
Reaction system is: 2 × GCbuffer25ul, the each 2.5mM of dNTP mixture() 8ul, template (rice genome) 100ng, the each 1ul(10uM of upstream and downstream primer), TakaRa LA Tap polysaccharase (0.5U/ul) 0.5ul, adds sterile purified water to 50ul.
Amplification program: 94 ℃ of 1min; (94 ℃ of 30s, 60 ℃, 1min, 72 ℃ of 1min) 30 circulations; 72 ℃ of 10min.
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
<110> Zhejiang University
External source Insert Fragment flanking sequence and the application thereof of <120> transgenic paddy rice strain 223F-S21
<160> 2
<210> 1
<211> 1792
<212> DNA
<213> artificial sequence
<220>
<223> 3 ' terminal sequence
<400> 1
aggttatgct agtcaggtat ggagatggtg gtcagacaca gagcgaagtc ctccacggtc 60
tcatcggcgc ggaacgctag ccattcgtac tccgcgcgca ccttctgcgc gctcgccttg 120
cgaatgcggt cgttgccgac gcgcatcgtc ttgatgcagt cgcacgccgc cctagccgac 180
gctttggtcg ccagggtccc gatcatctcg ggcggaaccg cgctgcagat ggcatcgagt 240
gccatcccga tcttcgtgaa acaccacctc catgccgtcc ggctcaacag ccgcccacag 300
gttgcgagcc tgcagcttga tcttcatcag tagtgcccaa tcgttgtaat tggtttttgt 360
cagcagcgga tagttcaccg ggtcgcctcc atccttcacc acgcggtgta taaacagcct 420
gtggtcaccc ccgccgctgc ccgaagcgcg gccgccggag tcgagaggag agcacgcaat 480
cggcgaagac gaacgacgtc gcggcatcag aactccctct aatgcacgat cacgagtcca 540
cttcctaaac ctcgctctga taccaattgt cagggaaccc aaggatcgtg aggatcctgg 600
acgagcacct tacgcacgca ctgtagctga tctggcaaac
acaagaaata gaggaagcag 660
aggaattttg gcgaagggca acagcttgct gcttttctga tttactcctt tatataacaa 720
acgggattac aacgaaatca aaaccaccag gaccgcttct cacgctggca atttgctgca 780
tccatcccca cagccgctca acgtgcatca cgctctcagc gcacgatgcg ggctcaacga 840
gctattctcg cgaccctcaa ctgaagcacg actgccacag atatcggcaa gctcatgcat 900
gactgaatca aacaaatgca gaaataactg actaactaac ttaactaacc aaggcacacg 960
ttttatttcc aacagtaatt agactcaaaa gaatcgtctc gcgaattagt ctaaggttat 1020
ggaataagtt ttgtaattag tgtatgttta atactctaaa ttagtgtcca aacatccgat 1080
gtgatagtga cttggaataa gtccctgttt tccaaacagg ccctgagtag agaggctgtt 1140
ggagatgctc taagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt 1200
tttcaattcc ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag 1260
tatttaaaga taccccaaga agctaattat aacaagacga actccaattc actgttcctt 1320
gcattctaaa accttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg 1380
tataacatag tatcgacgga gccgattttg aaaccgcggt gatcacaggc agcaacgctc 1440
tgtcatcgtt acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca 1500
gcttagttgc cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa 1560
cggctctccc gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg 1620
tgccgagctg ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa 1680
acaaattgac gcttagacaa cttaataaca cattgcggac gtttttaatg tactgaatta 1740
acgccgaatt aattcggggg atctggattt tagtactgga ttttggtttt ag 1792
<210> 2
<211> 1276
<212> DNA
<213> artificial sequence
<220>
<223> 5 ' terminal sequence
<400> 2
ctcgttgatg ttggggttgt tgtccattgt tggatcccgc cgccgctgct gctgctccta 60
gctagctgcg tgcagtaatc cctgcggaca tgcatgcacg aacgatcacg acgacgactc 120
agctcagaag tcagaaccac acccggccac cggggccgga cgaaaagcag ctagctaagc 180
tgacagtgat ctacacacag gccgcggcag caggctaggt ggcacgcacc gtgctgctct 240
cgctcgctga
gtcgctggta gatggttggc tgcaggtcgt tagctgccga gccaaaagct 300
agccaatata ctagctgtgg cgccaagccc tggcgataat gccgggacgg agcgcaggtg 360
tgaccaccgc cgccccacgt ggcggcgcgc cagtggctgc accacgatat ggctttggct 420
ggccccggaa ccttatcccc tctctctgga tttcgtgtgg acgtactccg ccgctggatt 480
cgtactacgg cctcgcgcta gggtggggtg gggaattttt ttatacttag aaaccaatgt 540
actctgcagt ctgcgggtct tccttggact ttgtgtaaag cacaggacac cttcactcca 600
attagtgcag tggtaagcaa tccttttgtt ggtcgtggat tgtattcttt gaatgcttcc 660
catgtcattc tactgaatat gaaatgcata attccattgc cgcatccaat gcatttgact 720
ttccttgatg gttcttgctc tattgaacag attccaaaat cagctgtcgc taatcctaat 780
gatctagagc tctggctaaa ggtaaactat accaattcgt agacatgtag tgaatctatc 840
catttgcccc ctaagaggta gaaagtacac aaaattatta acaagcatag agaaatcttg 900
tccaggttga tgatgaactt aggcagaagg gatctacgag tgatatgatatttaagatac 960
catctctaat cagttatatc agttccatca tgacattaat ggagggtgat gttatattga 1020
ccggtaaatc acatttttgg agaacagttt gttgtgcaat agagttgtga ttgtgggggt 1080
tattgatgaa ttcctctgca ggtactcctg agggtgtagg cccagtacga ccaggacaga 1140
agatcaaagc tggtataacc ggcctcgttg atgttgagtt tgatgttcag aagcgcaaac 1200
ggtcattttc tacttaatgt gataggcaag agattaatac taagcaatgt cttctgcagg 1260
catatcagta tattgt 1276
Claims (9)
1. the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, described flanking sequence is 3 ' end flanking sequence, it is characterized in that: 3 ' end flanking sequence is as shown in SEQ ID NO.1.
2. the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, described flanking sequence is 5 ' end flanking sequence, it is characterized in that: 5 ' end flanking sequence is as shown in SEQ ID NO.2.
3. the preparation method of flanking sequence as claimed in claim 1, is characterized in that: extract the genomic dna of transgenic paddy rice strain 223F-S21, increased and obtained by TAIL-PCR.
4. the preparation method of flanking sequence as claimed in claim 2, is characterized in that: extract the genomic dna of transgenic paddy rice strain 223F-S21, obtain by pcr amplification.
5. the qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, it is characterized in that: a primer is the forward primer according to 1-1155 bit sequence design in SEQ ID NO.1, another primer is the reverse primer according to the 1156-1792 bit sequence design of SEQ ID NO.1; , two combination of primers in described PCR reaction are the Auele Specific Primer of flanking sequence described in claim 1.
6. qualitative PCR detection method according to claim 5, is characterized in that:
Described forward primer Rice-L sequence is:
5’-ACACAAGAAATAGAGGAAGCAGAGGAAT-3’
Described reverse primer LB-R sequence is:
5’-GCAAGGAACAGTGAATTGGAGTTCGTC-3’。
7. the qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, it is characterized in that: a primer is the forward primer according to 1-516 bit sequence design in SEQ ID NO.2, another primer is the reverse primer according to the 517-1276 bit sequence design of SEQ ID NO.2; , two combination of primers in described PCR reaction are the Auele Specific Primer of flanking sequence described in claim 2.
8. qualitative PCR detection method according to claim 7, is characterized in that:
Described forward primer RB-F sequence is: 5 '-GTCGCTGGTAGATGGTTGGCTGCAGGTCGT-3 '
Described reverse primer Rice-R sequence is: 5 '-TATCATATCACTCGTAGATCCCTTCTGCCT-3 '.
9. the qualitative PCR detection method of the flanking sequence of the external source Insert Fragment of transgenic paddy rice strain 223F-S21, its spy
Levy and be: in described PCR reaction, contain following primer simultaneously:
Forward primer Rice-L:5 '-ACACAAGAAATAGAGGAAGCAGAGGAAT-3 '
Reverse primer LB-R:5 '-GCAAGGAACAGTGAATTGGAGTTCGTC-3 '
Forward primer RB-F:5 '-GTCGCTGGTAGATGGTTGGCTGCAGGTCGT-3 '
Reverse primer Rice-R:5 '-TATCATATCACTCGTAGATCCCTTCTGCCT-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310557887.XA CN103773759B (en) | 2013-11-11 | 2013-11-11 | The external source Insert Fragment flanking sequence of transgenic rice lines 223F-S21 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310557887.XA CN103773759B (en) | 2013-11-11 | 2013-11-11 | The external source Insert Fragment flanking sequence of transgenic rice lines 223F-S21 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103773759A true CN103773759A (en) | 2014-05-07 |
| CN103773759B CN103773759B (en) | 2016-01-27 |
Family
ID=50566524
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310557887.XA Expired - Fee Related CN103773759B (en) | 2013-11-11 | 2013-11-11 | The external source Insert Fragment flanking sequence of transgenic rice lines 223F-S21 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103773759B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105238858A (en) * | 2015-09-25 | 2016-01-13 | 浙江大学 | Method for specificity identification and flanking sequence detection of transgenic recombinant human lactoferrin rice strain G281 |
| CN112899392A (en) * | 2021-03-10 | 2021-06-04 | 浙江大学 | Primer group for specific identification molecular marker of transgenic insect-resistant and glyphosate-resistant cotton and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240279A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
| CN101240277A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Bt Shanyou 63 |
| CN102628040A (en) * | 2012-03-27 | 2012-08-08 | 山东农业大学 | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence |
-
2013
- 2013-11-11 CN CN201310557887.XA patent/CN103773759B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240279A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
| CN101240277A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Bt Shanyou 63 |
| CN102628040A (en) * | 2012-03-27 | 2012-08-08 | 山东农业大学 | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105238858A (en) * | 2015-09-25 | 2016-01-13 | 浙江大学 | Method for specificity identification and flanking sequence detection of transgenic recombinant human lactoferrin rice strain G281 |
| CN105238858B (en) * | 2015-09-25 | 2019-02-05 | 浙江大学 | It is a kind of for detecting the flanking sequence and its specificity identification method that turn restructuring lactoferrin rice strain G281 |
| CN112899392A (en) * | 2021-03-10 | 2021-06-04 | 浙江大学 | Primer group for specific identification molecular marker of transgenic insect-resistant and glyphosate-resistant cotton and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103773759B (en) | 2016-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | CRISPR/Cas9-mediated editing of CsWRKY22 reduces susceptibility to Xanthomonas citri subsp. citri in Wanjincheng orange (Citrus sinensis (L.) Osbeck) | |
| Wei et al. | Dreb1 genes in wheat (Triticum aestivum L.): development of functional markers and gene mapping based on SNPs | |
| Jinxia et al. | A multiplex nested PCR assay for the simultaneous detection of genetically modified soybean, maize and rice in highly processed products | |
| Facella et al. | Cryptochrome 2 extensively regulates transcription of the chloroplast genome in tomato | |
| Deeba et al. | Multiplex PCR assay for identification of commonly used disarmed Agrobacterium tumefaciens strains | |
| WO2012065528A1 (en) | Identification and use of plant root-specific expression promoter | |
| CN103215346A (en) | Recombinant standard plasmid and kit used in transgenic rice screening | |
| CN102888398B (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
| CN103773759A (en) | Exogenous insertion element flanking sequences of transgenic rice strain 223F-S21 and application thereof | |
| Rajput et al. | The R2R3-MYB gene family in Cicer arietinum: genome-wide identification and expression analysis leads to functional characterization of proanthocyanidin biosynthesis regulators in the seed coat | |
| Wang et al. | Microarray identification of conserved microRNAs in Pinellia pedatisecta | |
| CN107460193A (en) | A kind of right side flap sequence of genetically engineered soybean WH8013 transformation event foreign insertion vectors | |
| US20170159064A1 (en) | Generation of artificial micrornas | |
| CN102628040A (en) | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN106480216A (en) | A kind of standard plasmid for detecting transgenic regulation element and its construction method and application | |
| KR101441916B1 (en) | Microspore or pollen specific expression promoter from Oryza sativa Os8g0560700 gene and uses thereof | |
| CN102250900B (en) | Thellungiella salsuginea COR15a gene promoter and application thereof | |
| CN101899513B (en) | PCR detection method for identifying transgenic insect-resistant cotton Nannong 6 and applications thereof | |
| CN112646829B (en) | Plasmid standard molecule capable of being used for detecting multiple crops and multiple exogenous genes | |
| CN103834737B (en) | Transgenic rice Kefeng No.2 line specific PCR detection primer as well as qualitative detection method and kit | |
| CN109628444B (en) | Microsatellite molecular marker and method for identifying rice variety and application thereof | |
| KR101554209B1 (en) | Microspore or pollen specific expression promoter from Oryza sativa Os05g0543000 gene and uses thereof | |
| KR101441945B1 (en) | Microspore or pollen specific expression promoter from Oryza sativa Os04g0585900 gene and uses thereof | |
| Hu et al. | Isolation and chromosomal localization of new MITE-like sequences from Secale |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160127 Termination date: 20191111 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |