CN103773699B - The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi - Google Patents
The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi Download PDFInfo
- Publication number
- CN103773699B CN103773699B CN201410035994.0A CN201410035994A CN103773699B CN 103773699 B CN103773699 B CN 103773699B CN 201410035994 A CN201410035994 A CN 201410035994A CN 103773699 B CN103773699 B CN 103773699B
- Authority
- CN
- China
- Prior art keywords
- penicillium purpurogenum
- biotechnological formulation
- lichee
- purpurogenum
- penicillium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to field of biological pesticide, disclose a strain with microorganism raw in lichee for screening object, application Peronophythora Litchii germ being had to raw penicillium purpurogenum and biotechnological formulation and control peronophythora litchi in remarkable inhibiting lichee that separation obtains.By this penicillium purpurogenum called after penicillium purpurogenum (Penicillium? purpurogenum) GY-19, China typical culture collection center is preserved on December 31st, 2013, being called for short CCTCC, address: Wuhan, China Wuhan University, does is preserving number CCTCC? NO:M2013738.This bacterium source is in lichee endogenetic fungus, can surely grow on litchi fruits surface well, to Peronophythora Litchii germ, there is strong restraining effect, there is the Biocontrol Effect of excellent control peronophythora litchi, and biogenetic derivation environment-protecting asepsis, little to eco-environmental impact, culture condition is low, has good development prospect.
Description
Technical field
The invention belongs to field of biological pesticide, in particular to a strain with microorganism raw in lichee for screening object, be separated application Peronophythora Litchii germ being had in remarkable inhibiting lichee to raw penicillium purpurogenum and biotechnological formulation and control peronophythora litchi obtained.
Background technology
Lichee (LitchichinensisSonn) is the important subtropics cash crop in southern area, and have the laudatory title of " the precious fruit of China ", its economic worth is high, is one of the fruit of China's most competitive power in the international market.But in China's lichee main producing region, the peronospora tabacina caused by Peronophythora Litchii germ (PeronophythoralitchiiChenexKoetal.) is one of topmost disease causing the lichee underproduction.The popular feature with indirect outburst of this disease, climate impact is comparatively large, in the time of suitable morbidity, can cause the loss of lichee more than 80%.At present, to Peronophythora Litchii disease control effective measure mainly based on chemical prevention, but the problem of environmental pollution brought out due to a large amount of uses of chemical pesticide and the resistance problems day of pathogen show outstanding, thus research and develop low toxicity, noresidue biogenic pesticide for the control of lichee disease, for control agriculture residual, guarantee edible safety and improve product competitiveness tool to be of great significance.
Penicillium (Penicilliumspp.) and paecilomyces (Paecilomycesspp.) fungi are a kind of Antagonistic Fungis of broad spectrum, its meta-bolites---penicillin, as the one of antibiotic, can play significant restraining effect to multiple mankind pathogenetic bacteria and plant pathogenic fungi.The research such as Wang Bo finds that Paecilomyces lilacinus (Paecilomyceslilacinus) is as important nematosis fungi, has stronger invasiveness to Meloidogyne, ball cyst roundworm genus, multiple nematode such as rice puncture Turbatrix and false Meloidogyne etc.; Zhao Rui etc. are separated to a penicillium from the Rhizophora stylosa root soil of mangrove swamps protected area, and its fermented liquid has the effect of obvious antibacterial suppression plant pathogenic fungi growth.For penicillium purpurogenum (Penicilliumpurpurogenum), the research such as Wu Changjing finds that the new product active result of the two plant mutant bodies of penicillium purpurogenum G59 has significant anti-tumor activity; Wang Tao etc. are separated the strain penicillium purpurogenum obtained from soil has obvious bacteriostatic action to Pyricularia oryzae (Pyriculariaoryzae).
Therefore, penicillium purpurogenum, as the important natural resources of a class, causes extensive concern, has the potentiality of exploitation biological pesticide.
Summary of the invention
In order to overcome the shortcoming of above-mentioned prior art with not enough, the application of exploitation penicillium purpurogenum, primary and foremost purpose of the present invention is to provide a strain with microorganism raw in lichee for screening object, what separation obtained has raw Penicillium notatum in remarkable inhibiting lichee to Peronophythora Litchii germ, through being accredited as penicillium purpurogenum (Penicilliumpurpurogenum) GY-19, for the biological control of peronophythora litchi lays the foundation.Due to the Antagonistic Endophytic that the present invention screens from lichee, used back the control of lichee disease, only show as growth or the abatement of certain microbe population between specific population, do not change the classification of microbial population on lichee thus maintain the stability of population.Meanwhile, due to itself and lichee long-term co-existence, reciprocal symbiosis, defines a series of survival mechanism similar to it.
Another object of the present invention is to provide a kind of biotechnological formulation prepared based on penicillium purpurogenum raw in above-mentioned lichee.
Still a further object of the present invention is to provide the application of raw penicillium purpurogenum in control peronophythora litchi in above-mentioned lichee.
Object of the present invention is realized by following proposal:
One strain penicillium purpurogenum, by its called after penicillium purpurogenum (Penicilliumpurpurogenum) GY-19, is preserved in China typical culture collection center, be called for short CCTCC, address: Wuhan, China Wuhan University, preserving number is CCTCCNO:M2013738, and the preservation time is on December 31st, 2013.
Described penicillium purpurogenum on PDA substratum 25 DEG C cultivate 7d, bacterium colony is velvet-like, and mycelia is yellow, produces spore face deep green, after become dark deep green, the red or red-purple in the back side, conidiophore is short and smooth, stigma lanceolar, and conidium is oval to sub-spherical.
A kind of biotechnological formulation, prepares based on above-mentioned penicillium purpurogenum.
Described biotechnological formulation is prepared through liquid fermenting by penicillium purpurogenum raw in lichee, and preferably comprise following steps: be seeded to by penicillium purpurogenum in PDB nutrient solution and cultivate, gained bacteria suspension, through centrifugal, can obtain biotechnological formulation.
The pH value of described PDB nutrient solution is 7.0.
Described cultivation refers at 28 ~ 30 DEG C, and shaking table concussion speed is cultivate 4d under 180 ~ 200rpm.
The application of above-mentioned biotechnological formulation in control peronophythora litchi.
The application of raw penicillium purpurogenum in control peronophythora litchi in above-mentioned lichee.
The present invention, relative to prior art, has following advantage and beneficial effect:
(1) penicillium purpurogenum that the present invention obtains derives from lichee endogenetic fungus, can surely grow on litchi fruits surface well; The Antagonistic Endophytic that screens from lichee of the present invention in addition, use it for the control of lichee disease, only show as growth or the abatement of certain microbe population between specific population, change the classification of microbial population on lichee thus affect the stability of population, in addition due to itself and lichee long-term co-existence, reciprocal symbiosis, defines a series of survival mechanism similar to it, sprayed application to lichee surface and be used for the control of disease, concerning more safe and reliable the edible of lichee and converted products thereof.
(2) penicillium purpurogenum of the present invention has strong restraining effect to Peronophythora Litchii germ, has the Biocontrol Effect of excellent control peronophythora litchi, and biogenetic derivation environment-protecting asepsis, little to eco-environmental impact.
(3) penicillium purpurogenum that obtains of the present invention, culture condition requires low, has good development prospect.
Accompanying drawing explanation
Fig. 1 is the front elevation of penicillium purpurogenum GY-19 on Radix Dauci Sativae substratum (A) and back view (B).
Fig. 2 is conidium (stalk) figure of penicillium purpurogenum GY-19.
Fig. 3 is the restraining effect design sketch of penicillium purpurogenum GY-19 to Peronophythora Litchii germ, and wherein, A is Peronophythora Litchii germ normal growth colonial morphology, and B is the suppression figure of penicillium purpurogenum to Peronophythora Litchii germ.
Fig. 4 is that penicillium purpurogenum GY-19 and biotechnological formulation thereof are to the prevention effect figure of Peronophythora Litchii.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited thereto.
Embodiment 1: give birth to the separation of penicillium purpurogenum, purifying and preservation in lichee
(1) configuration of PDA substratum: take 200g potato, clean peeling chopping, the 1000mL that adds water boils 0.5h, filtered through gauze, then add 20g glucose and 20g agar, filtered through gauze while hot after fully dissolving, 121 DEG C of sterilizing 20min, are distributed into the rear storage of cooling in culture dish for subsequent use.
(2) separation, the purifying of penicillium purpurogenum is given birth in lichee:
For separating of litchi fruits sample pick up from College of Horticulture of Agricultural University Of South China lichee base, Shenzhen's kylin mountain villa Litchi Garden and Nong Ke orchard, Bao'an, Shenzhen respectively, selected Litchi Varieties is the large main breed of glutinous rice wrapped in lotus leaves, cv. Feizixiao and osmanthus taste three, is divided into three groups.
With reference to conventional organization partition method, and slightly make an amendment: by the tissue (blade of health, fruit) clean with tap water, the fritter of about 2cm × 2cm is cut into after drying moisture, surface sterilization is carried out: with the alcohol rinsing (blade 35 ~ 45s of 70% according to follow procedure, pericarp 40 ~ 50s), then 5% clorox rinsing 3 ~ 5min is used, finally use aseptic water washing 4 times, tissue block is placed with after suck dry moisture by aseptic filter paper and cultivates on PDA flat board, Mei Minfang 5 block organization block, each process 3 repetition, be placed in 25 DEG C of incubators and cultivate observation, the bacterium colony that picking grows at any time carries out purifying.
Take rinsing liquid method of inspection (Schulzetal., 1993.) to test the sterilisation effect of tissue surface, the last rinsing liquid getting 0.2mL is coated on LB solid plate and is cultivated, observe to cultivate and grow with or without bacterium colony, drop out existing if aseptic, testimonial material surface sterilization is thorough, otherwise separating resulting can not use.
Separation and purification obtained strains is carried out ITS sequence analysis, is defined as penicillium purpurogenum (Penicilliumpurpurogenum), called after penicillium purpurogenum bacterial strain GY-19.Described penicillium purpurogenum bacterial strain GY-19 is separated the blade from the osmanthus taste kind of kylin mountain villa, Shenzhen Litchi Garden, its sequence is as follows: the Penicilliumpurpurogenum homology being JQ422620 with the number of logging in GenBank reaches 100%, confirm that its Classification And Nomenclature is penicillium purpurogenum (Penicilliumpurpurogenum), called after penicillium purpurogenum (Penicilliumpurpurogenum) GY-19.Sequence fragment is as follows:
CCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACATCTGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACTGGCGGGGGTTGGTCACCACCAAAATTTTACCACGGT。
Penicillium purpurogenum GY-19 is 30 DEG C of cultivations on PDA substratum, and cultivate 7d, bacterium colony is velvet-like, and mycelia is yellow, produce spore face deep green, after become dark deep green, the red or red-purple in the back side.Conidiophore is short and smooth, stigma lanceolar, and conidium is oval to sub-spherical.(see Figure 1A, B and Fig. 2).
(3) preservation of penicillium purpurogenum GY-19: the China typical culture collection center this bacterial strain being preserved in Wuhan, China Wuhan University on December 31st, 2013, preserving number is CCTCCNO:M2013738.
Embodiment 2: opposite culture method measures the activity of penicillium purpurogenum
(1) preparation of PDA substratum is with embodiment 1; The preparation of PDB liquid nutrient medium is not except adding agar, and other are identical with the formula of PDA solid medium, be sub-packed in Erlenmeyer flask (every bottle of 100mL nutrient solution), jump a queue, wrap up, 121 DEG C of sterilizing 20min after fully being dissolved by the medicament claimed, and after cooling, storage is for subsequent use.
(2) preparation of Radix Dauci Sativae substratum: take 200g Radix Dauci Sativae, by 16 layers of filtered through gauze after fully squeezing the juice with juice extractor, filtrate supplies moisture to 1000mL, add 15g agar again, Erlenmeyer flask (every bottle of 100mL nutrient solution) is sub-packed in after abundant heating for dissolving, 121 DEG C of sterilizing 20min, after cooling, storage is for subsequent use.
(3) preparation of penicillium purpurogenum list bacterium colony and bacterium dish: with inoculating needle picking mould mycelia on PDA culture medium flat plate, cultivate 4 ~ 5d, obtain single bacterium colony for 28 DEG C; With punch tool in the punching of penicillium purpurogenum colony edge, obtain circular bacterium dish.
(4) preparation of penicillium purpurogenum fermented liquid (biotechnological formulation) and filtrate: get in the PDB nutrient solution Erlenmeyer flask that penicillium purpurogenum bacterium dish access step (1) that step (3) prepares prepares, be placed in 30 DEG C, shaking table speed is cultivate under 200rpm after 4d in the centrifugal 10min of 5000rpm, get supernatant liquor and namely obtain penicillium purpurogenum biotechnological formulation, be the strainer filtering thalline of 0.2 μm again with aperture, obtain penicillium purpurogenum bacteria-free filtrate.
(5) cultivation of Peronophythora Litchii germ and the preparation of sporangia suspension thereof: after the Peronophythora Litchii germ that inoculation is numbered Zhaoqing 10 cultivates 7d to Radix Dauci Sativae flat board, the mycelia of getting colony edge is beaten with the punch tool that diameter is 5mm, be seeded on fresh Radix Dauci Sativae flat board, cultivate 7d at 25 DEG C after, in flat board, add aseptic water washing sporocyst and be mixed with the sporangia suspension of desired concn.
(6) determination of activity:
1. penicillium purpurogenum measures the restraining effect of Peronophythora Litchii pathogen growth: by the central authorities of penicillium purpurogenum streak inoculation obtained for step (3) to Radix Dauci Sativae culture medium flat plate, at the bacterium cake apart from this bacterium cake 3cm place inoculation Peronophythora Litchii germ, not inoculate penicillium purpurogenum for contrast in experiment, 3 repetitions, constant temperature culture at being placed in 25 DEG C, when contrasting colony diameter and reaching 6cm, measure antibacterial bandwidth, result as shown in Figure 3.
2. penicillium purpurogenum inhibiting mensuration that Peronophythora Litchii germ sporocyst is sprouted: embodiment 1 be separated in the PDB liquid nutrient medium that penicillium purpurogenum inoculation to the step (1) that obtains prepares and shake bacterium, being mixed with concentration according to step (4) is 10
2the penicillium purpurogenum fermented liquid of individual/mL and filtrate, the sporangia suspension concentration that fermented liquid, filtrate is obtained with step (5) is respectively 4 × 10
4the Peronophythora Litchii germ sporangia suspension equal-volume mixing of individual/mL, and mix in contrast with sterilized water, PDB and sporangia suspension equal-volume.Getting mixed solution 100 μ L drips on aseptic concave surface slide glass, and 25 DEG C of moisturizings are cultivated, and takes out and calculate sporangial germination rate after 4h.
Inhibiting rate (%)=(contrast sporocyst germination rate-process sporocyst germination rate)/contrast sporocyst germination rate × 100
Interpretation of result:
In lichee, the growth of raw penicillium purpurogenum GY-19 to Peronophythora Litchii germ has obvious restraining effect.Wherein, the fermented liquid of the bacterial strain GY-19 that the present invention obtains and filtrate thereof are all sprouted the sporocyst of Peronophythora Litchii germ pole restraining effect significantly, and bacteriostasis rate is respectively 100% and 99.09%.
Embodiment 3: in lichee, raw penicillium purpurogenum GY-19 prevents and treats peronophythora litchi
(1) preparation of PDA substratum is with embodiment 1.The preparation of Radix Dauci Sativae substratum and PDB liquid nutrient medium is with embodiment 2.
(2) produce the preparation of purple penicillium bacterial strain GY-19 fermented liquid and filtered liquid in lichee, Peronophythora Litchii germ cultivate and the preparation of sporangia suspension with embodiment 2.
(3) the healthy fruit of consistent, the of uniform size lichee of picking ripening degree, after rinsing well in flowing water, dry, about 5min is soaked in the penicillium purpurogenum fermented liquid prepared in step (2) by litchi fruits respectively and sterile filtration liquid thereof, be taken out to drop no longer to drip, put into sterilized antistaling box moisturizing process.Adopt the sporangial method (10 of spray inoculation Peronophythora Litchii
4individual/mL), in being placed in room temperature 25 DEG C and 4 DEG C (storage temperature of lichee) cultivation respectively, the incidence of routine observation fruit after inoculation.With clear water process, the process of PDB nutrient solution, only connect the process of penicillium purpurogenum biotechnological formulation and only connect Peronophythora Litchii germ sporangia suspension process etc. 4 process in contrast.Each process is each selects the strong fruit 30 of lichee, arranges 3 repetitions.
The indoor inoculation test carried out under the condition of medial temperature 25 DEG C, relative humidity 80%, the contrast being connected to Peronophythora Litchii germ after inoculation 36h starts morbidity, and inoculation has the process of penicillium purpurogenum biotechnological formulation and penicillium purpurogenum filtered liquid not fall ill temporarily; After inoculation process 3d, the sickness rate of germ contrast is 97.3%, and the sickness rate that penicillium purpurogenum biotechnological formulation and filtrate thereof processed is only 13.8% and 18.9%, and prevention effect reaches 85.8% and 80.6%.
The indoor inoculation test carried out under the condition of medial temperature 4 DEG C, relative humidity 80%, the experimental result after storage cultivates 20d is as table 1 and Fig. 4.
Table 1 penicillium purpurogenum is to the biocontrol effect (4 DEG C) of lychee storage phase peronospora tabacina
From table 1, although the sickness rate of GY-19 fermented liquid and GY-19 filtered liquid two process is close with the positive control only connecing Peronophythora Litchii germ, but its disease index is all starkly lower than the latter, show that penicillium purpurogenum biotechnological formulation and filtrate thereof are adopted rear peronospora tabacina to lichee and all had obvious preventive and therapeutic effect.Meanwhile, the process of only deliver a child anti-penicillium purpurogenum fermented liquid or its filtrate does not cause lichee to fall ill, and illustrates that this bacterial strain is not the pathogenic bacteria of lichee, can use bacterial strain as after control the adopting of peronophythora litchi.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Claims (7)
1. a strain penicillium purpurogenum, it is characterized in that its called after penicillium purpurogenum (Penicilliumpurpurogenum) GY-19, be preserved in China typical culture collection center, be called for short CCTCC, address: Wuhan, China Wuhan University, preserving number is CCTCCNO:M2013738, and the preservation time is on December 31st, 2013.
2. a biotechnological formulation, is characterized in that: prepare based on penicillium purpurogenum according to claim 1; Described biotechnological formulation is prepared through liquid fermenting by penicillium purpurogenum.
3. biotechnological formulation according to claim 2, is characterized in that: prepared by the method comprising following steps: be seeded to by penicillium purpurogenum in PDB nutrient solution and cultivate, and gained bacteria suspension, through centrifugal, can obtain biotechnological formulation;
The configuration of described PDB nutrient solution: take 200g potato, clean peeling chopping, the 1000mL that adds water boils 0.5h, filtered through gauze, add 20g glucose again, after fully dissolving, be sub-packed in Erlenmeyer flask, every bottle of 100mL nutrient solution, jump a queue, wrap up, 121 DEG C of sterilizing 20min, after cooling, storage is for subsequent use.
4. biotechnological formulation according to claim 3, is characterized in that: the pH value of described PDB nutrient solution is 7.0.
5. biotechnological formulation according to claim 3, is characterized in that: described cultivation refers at 28 ~ 30 DEG C, and shaking table concussion speed is cultivate 4d under 180 ~ 200rpm.
6. the application of the biotechnological formulation according to any one of claim 2 ~ 5 in control peronophythora litchi.
7. the application of penicillium purpurogenum according to claim 1 in control peronophythora litchi.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410035994.0A CN103773699B (en) | 2014-01-24 | 2014-01-24 | The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410035994.0A CN103773699B (en) | 2014-01-24 | 2014-01-24 | The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103773699A CN103773699A (en) | 2014-05-07 |
CN103773699B true CN103773699B (en) | 2016-01-06 |
Family
ID=50566466
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410035994.0A Active CN103773699B (en) | 2014-01-24 | 2014-01-24 | The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103773699B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106929430A (en) * | 2017-02-10 | 2017-07-07 | 三峡大学 | One plant of penicillium oxalicum SY 15 with strong anti-oxidation and its application |
CN112143654B (en) * | 2020-09-08 | 2022-03-22 | 华南农业大学 | Trichoderma pseudokoningii and application thereof in preventing and treating litchi anthracnose |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103421722A (en) * | 2013-09-05 | 2013-12-04 | 华南农业大学 | Litchi endogenous bacillus subtilis strain and biological agent and application thereof |
-
2014
- 2014-01-24 CN CN201410035994.0A patent/CN103773699B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103421722A (en) * | 2013-09-05 | 2013-12-04 | 华南农业大学 | Litchi endogenous bacillus subtilis strain and biological agent and application thereof |
Non-Patent Citations (2)
Title |
---|
Antifungal Activity of Hypothemycin against Peronophythora Litchii In Vitro And In Vivo;Liangxiong Xu et al.;《J. Agric. Food Chem.》;20130916;第61卷(第42期);10091–10095 * |
新杀菌剂双炔酰菌胺防治荔枝霜疫霉病药效试验;宋晓兵 等;《广东农业科学》;20101231(第10期);99–100 * |
Also Published As
Publication number | Publication date |
---|---|
CN103773699A (en) | 2014-05-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102433282B (en) | Bacillus subtilis NB12, as well as culture method and application thereof | |
CN102676398B (en) | Separation and purification method of endophytic fungi from ginkgo biloba | |
CN104894035B (en) | A kind of screening technique of bacillus and its application | |
CN105296364B (en) | A kind of penicillium oxalicum and preparation method and application | |
CN104789509B (en) | Raw bacillus pumilus and its application in one plant of bark of eucommia | |
CN103087960A (en) | Bacillus amyloliquefaciens FQS38 and application thereof | |
CN104611254A (en) | BaciIllus polymyxa KN-03 and culturing method and use thereof | |
CN106085885A (en) | The Trichoderma asperellum of a kind of antagonism banana blight and application thereof | |
CN102899266A (en) | Konjak endophytic bacteria Pantoea agglomerans bacterial strain1-7 and application | |
CN106701623A (en) | Bacillus atrophaeus antagonistic to lycium chinensis root rot and application of bacillus atrophaeus | |
CN104342388B (en) | Streptomycete bacterial strain and prevent and treat tomato wilt use in conjunction | |
CN101914474B (en) | Ectomycorrhizal helper bacteria bacillus pumilus and application thereof | |
CN101928685A (en) | Streptomyces albus MC-15 bacterial strain as well as method and application thereof for preparing fermentation liquor thereby | |
CN102732430A (en) | Aspergillus niger strain and application thereof | |
CN103773699B (en) | The application of one strain penicillium purpurogenum and biotechnological formulation and control peronophythora litchi | |
CN105112304A (en) | Bjerkandera sp. Gause 15 for controlling vegetable root diseases and preparation thereof | |
CN102154177B (en) | Oil-tea disease-resistant bacterial strain and application thereof | |
CN103421722B (en) | One strain lichee endophytic Bacillus subtilis and biotechnological formulation thereof and application | |
CN101914469B (en) | Bacillus cereus ectotrophic mycorrhiza helper bacteria and use thereof | |
CN107043720A (en) | Bacillus amyloliquefaciens HMB28388 and its application | |
CN104513802B (en) | A kind of corn endophytic Bacillus subtilis and its biological and ecological methods to prevent plant disease, pests, and erosion application | |
CN105018354A (en) | Trichoderma pleuroticola and application thereof | |
CN105733984B (en) | Bacillus subtilis and its application in terms of control of leaf spot of corn | |
CN104982459B (en) | One bacillus pumilus N103 1 and its application | |
CN102690759A (en) | Separation and purification method of endophytic fungi of solidago canadensis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |